ID: 1104945705

View in Genome Browser
Species Human (GRCh38)
Location 12:132414095-132414117
Sequence CCTGGCCCTGCTCTCCGGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104945691_1104945705 20 Left 1104945691 12:132414052-132414074 CCACCCTTGCTGACTCCGGAGGG No data
Right 1104945705 12:132414095-132414117 CCTGGCCCTGCTCTCCGGAGTGG No data
1104945698_1104945705 -7 Left 1104945698 12:132414079-132414101 CCAGCTCCTGCCCCGTCCTGGCC No data
Right 1104945705 12:132414095-132414117 CCTGGCCCTGCTCTCCGGAGTGG No data
1104945693_1104945705 17 Left 1104945693 12:132414055-132414077 CCCTTGCTGACTCCGGAGGGTAA No data
Right 1104945705 12:132414095-132414117 CCTGGCCCTGCTCTCCGGAGTGG No data
1104945695_1104945705 5 Left 1104945695 12:132414067-132414089 CCGGAGGGTAACCCAGCTCCTGC No data
Right 1104945705 12:132414095-132414117 CCTGGCCCTGCTCTCCGGAGTGG No data
1104945694_1104945705 16 Left 1104945694 12:132414056-132414078 CCTTGCTGACTCCGGAGGGTAAC No data
Right 1104945705 12:132414095-132414117 CCTGGCCCTGCTCTCCGGAGTGG No data
1104945687_1104945705 25 Left 1104945687 12:132414047-132414069 CCTGCCCACCCTTGCTGACTCCG No data
Right 1104945705 12:132414095-132414117 CCTGGCCCTGCTCTCCGGAGTGG No data
1104945689_1104945705 21 Left 1104945689 12:132414051-132414073 CCCACCCTTGCTGACTCCGGAGG No data
Right 1104945705 12:132414095-132414117 CCTGGCCCTGCTCTCCGGAGTGG No data
1104945697_1104945705 -6 Left 1104945697 12:132414078-132414100 CCCAGCTCCTGCCCCGTCCTGGC No data
Right 1104945705 12:132414095-132414117 CCTGGCCCTGCTCTCCGGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104945705 Original CRISPR CCTGGCCCTGCTCTCCGGAG TGG Intergenic
No off target data available for this crispr