ID: 1104946225

View in Genome Browser
Species Human (GRCh38)
Location 12:132415946-132415968
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104946214_1104946225 26 Left 1104946214 12:132415897-132415919 CCCACTGGAGGACGGGGCTGCAG No data
Right 1104946225 12:132415946-132415968 CGGTGGCGTCTCTGGGGACCAGG No data
1104946215_1104946225 25 Left 1104946215 12:132415898-132415920 CCACTGGAGGACGGGGCTGCAGG No data
Right 1104946225 12:132415946-132415968 CGGTGGCGTCTCTGGGGACCAGG No data
1104946212_1104946225 30 Left 1104946212 12:132415893-132415915 CCACCCCACTGGAGGACGGGGCT No data
Right 1104946225 12:132415946-132415968 CGGTGGCGTCTCTGGGGACCAGG No data
1104946213_1104946225 27 Left 1104946213 12:132415896-132415918 CCCCACTGGAGGACGGGGCTGCA No data
Right 1104946225 12:132415946-132415968 CGGTGGCGTCTCTGGGGACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104946225 Original CRISPR CGGTGGCGTCTCTGGGGACC AGG Intergenic
No off target data available for this crispr