ID: 1104947679

View in Genome Browser
Species Human (GRCh38)
Location 12:132423874-132423896
Sequence CTGCTGTGACAGTAACTTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104947679_1104947688 22 Left 1104947679 12:132423874-132423896 CCTCTAAGTTACTGTCACAGCAG No data
Right 1104947688 12:132423919-132423941 CTGGATCCACAGAGAGAACATGG No data
1104947679_1104947684 3 Left 1104947679 12:132423874-132423896 CCTCTAAGTTACTGTCACAGCAG No data
Right 1104947684 12:132423900-132423922 CCTCCCCTGGGCGAGGCAACTGG No data
1104947679_1104947689 23 Left 1104947679 12:132423874-132423896 CCTCTAAGTTACTGTCACAGCAG No data
Right 1104947689 12:132423920-132423942 TGGATCCACAGAGAGAACATGGG No data
1104947679_1104947682 -4 Left 1104947679 12:132423874-132423896 CCTCTAAGTTACTGTCACAGCAG No data
Right 1104947682 12:132423893-132423915 GCAGAGACCTCCCCTGGGCGAGG No data
1104947679_1104947680 -10 Left 1104947679 12:132423874-132423896 CCTCTAAGTTACTGTCACAGCAG No data
Right 1104947680 12:132423887-132423909 GTCACAGCAGAGACCTCCCCTGG No data
1104947679_1104947681 -9 Left 1104947679 12:132423874-132423896 CCTCTAAGTTACTGTCACAGCAG No data
Right 1104947681 12:132423888-132423910 TCACAGCAGAGACCTCCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104947679 Original CRISPR CTGCTGTGACAGTAACTTAG AGG (reversed) Intergenic
No off target data available for this crispr