ID: 1104947687

View in Genome Browser
Species Human (GRCh38)
Location 12:132423905-132423927
Sequence TGGATCCAGTTGCCTCGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104947687_1104947694 23 Left 1104947687 12:132423905-132423927 CCTGGGCGAGGCAACTGGATCCA No data
Right 1104947694 12:132423951-132423973 CAGAAAGCACCTCCTGCCCGCGG No data
1104947687_1104947689 -8 Left 1104947687 12:132423905-132423927 CCTGGGCGAGGCAACTGGATCCA No data
Right 1104947689 12:132423920-132423942 TGGATCCACAGAGAGAACATGGG No data
1104947687_1104947696 25 Left 1104947687 12:132423905-132423927 CCTGGGCGAGGCAACTGGATCCA No data
Right 1104947696 12:132423953-132423975 GAAAGCACCTCCTGCCCGCGGGG No data
1104947687_1104947688 -9 Left 1104947687 12:132423905-132423927 CCTGGGCGAGGCAACTGGATCCA No data
Right 1104947688 12:132423919-132423941 CTGGATCCACAGAGAGAACATGG No data
1104947687_1104947695 24 Left 1104947687 12:132423905-132423927 CCTGGGCGAGGCAACTGGATCCA No data
Right 1104947695 12:132423952-132423974 AGAAAGCACCTCCTGCCCGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104947687 Original CRISPR TGGATCCAGTTGCCTCGCCC AGG (reversed) Intergenic
No off target data available for this crispr