ID: 1104947690

View in Genome Browser
Species Human (GRCh38)
Location 12:132423925-132423947
Sequence GGCAGCCCATGTTCTCTCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104947690_1104947696 5 Left 1104947690 12:132423925-132423947 CCACAGAGAGAACATGGGCTGCC No data
Right 1104947696 12:132423953-132423975 GAAAGCACCTCCTGCCCGCGGGG No data
1104947690_1104947695 4 Left 1104947690 12:132423925-132423947 CCACAGAGAGAACATGGGCTGCC No data
Right 1104947695 12:132423952-132423974 AGAAAGCACCTCCTGCCCGCGGG No data
1104947690_1104947698 12 Left 1104947690 12:132423925-132423947 CCACAGAGAGAACATGGGCTGCC No data
Right 1104947698 12:132423960-132423982 CCTCCTGCCCGCGGGGCACGCGG No data
1104947690_1104947694 3 Left 1104947690 12:132423925-132423947 CCACAGAGAGAACATGGGCTGCC No data
Right 1104947694 12:132423951-132423973 CAGAAAGCACCTCCTGCCCGCGG No data
1104947690_1104947700 18 Left 1104947690 12:132423925-132423947 CCACAGAGAGAACATGGGCTGCC No data
Right 1104947700 12:132423966-132423988 GCCCGCGGGGCACGCGGAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104947690 Original CRISPR GGCAGCCCATGTTCTCTCTG TGG (reversed) Intergenic
No off target data available for this crispr