ID: 1104947694

View in Genome Browser
Species Human (GRCh38)
Location 12:132423951-132423973
Sequence CAGAAAGCACCTCCTGCCCG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104947683_1104947694 28 Left 1104947683 12:132423900-132423922 CCTCCCCTGGGCGAGGCAACTGG No data
Right 1104947694 12:132423951-132423973 CAGAAAGCACCTCCTGCCCGCGG No data
1104947690_1104947694 3 Left 1104947690 12:132423925-132423947 CCACAGAGAGAACATGGGCTGCC No data
Right 1104947694 12:132423951-132423973 CAGAAAGCACCTCCTGCCCGCGG No data
1104947685_1104947694 25 Left 1104947685 12:132423903-132423925 CCCCTGGGCGAGGCAACTGGATC No data
Right 1104947694 12:132423951-132423973 CAGAAAGCACCTCCTGCCCGCGG No data
1104947686_1104947694 24 Left 1104947686 12:132423904-132423926 CCCTGGGCGAGGCAACTGGATCC No data
Right 1104947694 12:132423951-132423973 CAGAAAGCACCTCCTGCCCGCGG No data
1104947687_1104947694 23 Left 1104947687 12:132423905-132423927 CCTGGGCGAGGCAACTGGATCCA No data
Right 1104947694 12:132423951-132423973 CAGAAAGCACCTCCTGCCCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104947694 Original CRISPR CAGAAAGCACCTCCTGCCCG CGG Intergenic
No off target data available for this crispr