ID: 1104948239

View in Genome Browser
Species Human (GRCh38)
Location 12:132427039-132427061
Sequence CTGCAGGATTCATCAGCATC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104948239_1104948246 8 Left 1104948239 12:132427039-132427061 CCCGATGCTGATGAATCCTGCAG No data
Right 1104948246 12:132427070-132427092 AAGCAGGAGCGGCAGGGACACGG No data
1104948239_1104948243 -3 Left 1104948239 12:132427039-132427061 CCCGATGCTGATGAATCCTGCAG No data
Right 1104948243 12:132427059-132427081 CAGAGACAAATAAGCAGGAGCGG No data
1104948239_1104948245 2 Left 1104948239 12:132427039-132427061 CCCGATGCTGATGAATCCTGCAG No data
Right 1104948245 12:132427064-132427086 ACAAATAAGCAGGAGCGGCAGGG No data
1104948239_1104948248 12 Left 1104948239 12:132427039-132427061 CCCGATGCTGATGAATCCTGCAG No data
Right 1104948248 12:132427074-132427096 AGGAGCGGCAGGGACACGGGAGG No data
1104948239_1104948247 9 Left 1104948239 12:132427039-132427061 CCCGATGCTGATGAATCCTGCAG No data
Right 1104948247 12:132427071-132427093 AGCAGGAGCGGCAGGGACACGGG No data
1104948239_1104948244 1 Left 1104948239 12:132427039-132427061 CCCGATGCTGATGAATCCTGCAG No data
Right 1104948244 12:132427063-132427085 GACAAATAAGCAGGAGCGGCAGG No data
1104948239_1104948241 -8 Left 1104948239 12:132427039-132427061 CCCGATGCTGATGAATCCTGCAG No data
Right 1104948241 12:132427054-132427076 TCCTGCAGAGACAAATAAGCAGG No data
1104948239_1104948249 21 Left 1104948239 12:132427039-132427061 CCCGATGCTGATGAATCCTGCAG No data
Right 1104948249 12:132427083-132427105 AGGGACACGGGAGGAATCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104948239 Original CRISPR CTGCAGGATTCATCAGCATC GGG (reversed) Intergenic
No off target data available for this crispr