ID: 1104948245

View in Genome Browser
Species Human (GRCh38)
Location 12:132427064-132427086
Sequence ACAAATAAGCAGGAGCGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104948240_1104948245 1 Left 1104948240 12:132427040-132427062 CCGATGCTGATGAATCCTGCAGA No data
Right 1104948245 12:132427064-132427086 ACAAATAAGCAGGAGCGGCAGGG No data
1104948239_1104948245 2 Left 1104948239 12:132427039-132427061 CCCGATGCTGATGAATCCTGCAG No data
Right 1104948245 12:132427064-132427086 ACAAATAAGCAGGAGCGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104948245 Original CRISPR ACAAATAAGCAGGAGCGGCA GGG Intergenic
No off target data available for this crispr