ID: 1104951952

View in Genome Browser
Species Human (GRCh38)
Location 12:132445167-132445189
Sequence TGTTTGGCTGGGCCCGGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104951952_1104951966 19 Left 1104951952 12:132445167-132445189 CCTGGCCCGGGCCCAGCCAAACA No data
Right 1104951966 12:132445209-132445231 AGGGCTCCGCCCCCATCTCCAGG No data
1104951952_1104951958 -1 Left 1104951952 12:132445167-132445189 CCTGGCCCGGGCCCAGCCAAACA No data
Right 1104951958 12:132445189-132445211 ACCATCTTCTCCTCCACCCCAGG No data
1104951952_1104951960 0 Left 1104951952 12:132445167-132445189 CCTGGCCCGGGCCCAGCCAAACA No data
Right 1104951960 12:132445190-132445212 CCATCTTCTCCTCCACCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104951952 Original CRISPR TGTTTGGCTGGGCCCGGGCC AGG (reversed) Intergenic
No off target data available for this crispr