ID: 1104954361

View in Genome Browser
Species Human (GRCh38)
Location 12:132457231-132457253
Sequence GCCCCAGGAGTGGCCCGTCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 200}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104954361_1104954367 -8 Left 1104954361 12:132457231-132457253 CCCGGACGGGCCACTCCTGGGGC 0: 1
1: 0
2: 0
3: 23
4: 200
Right 1104954367 12:132457246-132457268 CCTGGGGCTGACGAGGCAGGCGG 0: 1
1: 1
2: 2
3: 70
4: 1699
1104954361_1104954372 22 Left 1104954361 12:132457231-132457253 CCCGGACGGGCCACTCCTGGGGC 0: 1
1: 0
2: 0
3: 23
4: 200
Right 1104954372 12:132457276-132457298 TCCCCAGGCCCCAGCAGAACCGG 0: 1
1: 0
2: 1
3: 62
4: 384
1104954361_1104954369 -4 Left 1104954361 12:132457231-132457253 CCCGGACGGGCCACTCCTGGGGC 0: 1
1: 0
2: 0
3: 23
4: 200
Right 1104954369 12:132457250-132457272 GGGCTGACGAGGCAGGCGGCGGG 0: 1
1: 0
2: 6
3: 93
4: 1836
1104954361_1104954368 -5 Left 1104954361 12:132457231-132457253 CCCGGACGGGCCACTCCTGGGGC 0: 1
1: 0
2: 0
3: 23
4: 200
Right 1104954368 12:132457249-132457271 GGGGCTGACGAGGCAGGCGGCGG 0: 1
1: 0
2: 2
3: 38
4: 471
1104954361_1104954370 7 Left 1104954361 12:132457231-132457253 CCCGGACGGGCCACTCCTGGGGC 0: 1
1: 0
2: 0
3: 23
4: 200
Right 1104954370 12:132457261-132457283 GCAGGCGGCGGGTCCTCCCCAGG 0: 1
1: 0
2: 1
3: 20
4: 213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104954361 Original CRISPR GCCCCAGGAGTGGCCCGTCC GGG (reversed) Intergenic
900162336 1:1230005-1230027 GTCCGAGGCGTGGCCAGTCCTGG + Intronic
900208601 1:1442130-1442152 GGCCCCGGAGTGCTCCGTCCAGG + Exonic
901004797 1:6166479-6166501 GCCCCAGGTGTGTACCGCCCCGG - Intronic
901438734 1:9264785-9264807 GCCCAAGAAGTGGCCCATCTCGG + Exonic
901641182 1:10694007-10694029 CCCGCAGGAGCGGCCCGTCCCGG + Intronic
902389648 1:16095675-16095697 GCCACAGGAAGGTCCCGTCCCGG + Intergenic
903186880 1:21634038-21634060 GCCCCAGAACTGCCCCCTCCCGG + Intronic
903225692 1:21893210-21893232 GGCCCAGGATTGGCCTGTGCTGG + Intronic
903353782 1:22734027-22734049 GCCGCAGGAGTGGCCCTGTCAGG + Intronic
903830246 1:26170190-26170212 GCCCCAGGCCGGGCTCGTCCGGG - Intronic
906803611 1:48758909-48758931 GCCGCAGGAGCAGCACGTCCTGG + Exonic
907465417 1:54632207-54632229 ACGCCATGAGGGGCCCGTCCCGG + Intronic
912496466 1:110095083-110095105 GCCCCAGGAGTGGGGAGGCCAGG - Intergenic
912637567 1:111312230-111312252 GCCCCAGGCCTGGCCGGTACTGG - Exonic
912710082 1:111943848-111943870 GGCCCAGGAGTGGCATGGCCAGG + Intronic
912955735 1:114153321-114153343 GCCCCAAGGGTGCCCCGTCCTGG + Intronic
913130801 1:115837675-115837697 GCCCCAGAAGTGGCTCATCTCGG + Exonic
914325311 1:146609127-146609149 TCCCCAGGAGTGGCAACTCCAGG + Intergenic
915954322 1:160209923-160209945 GGCCCAGCAGTGGCCCTGCCAGG - Intronic
919856484 1:201709653-201709675 GCCCCAGCAGTGGCCCCTGGTGG - Intronic
920578877 1:207085987-207086009 GCCCCAGGAGGACCCTGTCCTGG + Intronic
921689840 1:218135611-218135633 GCCCCAGGAGTTGCACATGCTGG - Intergenic
922818660 1:228469634-228469656 GCCCCAGGAGTCGCCCCTGATGG - Intergenic
924765236 1:247026038-247026060 ACACCATGAGGGGCCCGTCCCGG + Intergenic
1064003849 10:11684782-11684804 GACCCGGGAGTGGCCCTGCCTGG + Intergenic
1067284482 10:44897708-44897730 GCCCCAGAGGTGGCCCGTGTAGG - Intergenic
1071531310 10:86392058-86392080 CCCTCAGAAGTGGCCCCTCCGGG - Intergenic
1072335562 10:94395373-94395395 ACCTCATGATTGGCCCGTCCTGG + Intergenic
1072462342 10:95631194-95631216 GAGCCAAGAGTGGCCCCTCCAGG + Intronic
1074767207 10:116708092-116708114 GCCCCAGGAATGGGCCCCCCGGG + Intronic
1074989111 10:118686626-118686648 TCCCCAGGGGTGACCAGTCCCGG - Exonic
1075732919 10:124646952-124646974 TACCCAGGAATGGCCCGGCCAGG - Intronic
1076047048 10:127302371-127302393 GCCCCAGGAGTGGCCCCCCAGGG - Intronic
1076736636 10:132462028-132462050 GCCCAAGGAGGGGCCCGGCAGGG - Intergenic
1077635817 11:3840878-3840900 GCACCAGGTGAGGCCCGGCCGGG - Exonic
1077919149 11:6630341-6630363 GCGCCAGGAGCCGCCCGTGCCGG - Exonic
1079403599 11:20126188-20126210 GCCTCAGGAGAGGCTAGTCCTGG + Intergenic
1080746825 11:35115740-35115762 GACCCAGGAGTGCCCCGCACTGG + Intergenic
1081655329 11:44853427-44853449 GTCCCAGAAATGGCCCCTCCAGG - Intronic
1084946314 11:72640698-72640720 GCCCCTGCAGTGGCCCTTCCTGG + Intronic
1084978220 11:72814748-72814770 GGACCAGGAGGGGCTCGTCCAGG - Intronic
1085339522 11:75722136-75722158 GACCCAGGAGTGGGCCCTGCAGG - Intronic
1088888226 11:114024362-114024384 GCACCAGGAGTGGGCCCTGCAGG - Intergenic
1089287710 11:117418283-117418305 GCCCCAGCAGTGGCCCTACAGGG - Intergenic
1091805126 12:3350454-3350476 GCTTCAGGAGTGGCCCATTCAGG + Intergenic
1092513268 12:9180936-9180958 GCCTCTGGAATGGCCCTTCCTGG + Intronic
1093157023 12:15698589-15698611 GCCCCAGGAATAGCACGTACCGG + Intronic
1095953978 12:47796173-47796195 GCCCCAGGAGAGCCCAGTCTCGG + Intronic
1096405522 12:51341289-51341311 GCCCCAGGAGGGAGCCATCCTGG - Exonic
1097037033 12:56130796-56130818 GGCCCAGGTCTGGCCCTTCCTGG + Exonic
1097906265 12:64922458-64922480 GCCACAGGGCTGGCCCGTCAGGG + Intergenic
1104568204 12:129903676-129903698 GCCCAAGGAGGGGCGCCTCCAGG + Intergenic
1104873280 12:132015852-132015874 GGCCCAGGAGCGTCCTGTCCTGG + Intronic
1104954361 12:132457231-132457253 GCCCCAGGAGTGGCCCGTCCGGG - Intergenic
1105213401 13:18271087-18271109 TCTCCAGCAGTGGCCCTTCCTGG + Intergenic
1105429356 13:20323326-20323348 ACCCCAGGAGTGCTCCCTCCTGG - Intergenic
1106248669 13:27968326-27968348 GCGCCAGGAGGGGCACGGCCCGG - Intronic
1107556094 13:41517790-41517812 GACCCAGGAGTGTCTCTTCCTGG - Intergenic
1109936147 13:69287308-69287330 GCCCCAGGAGTGGAACATGCTGG - Intergenic
1113458471 13:110465486-110465508 CCCCCAGGACTGGGCCTTCCCGG + Exonic
1121557650 14:94850507-94850529 GACCCAGGAGTGGTCCTTTCTGG + Intergenic
1122791899 14:104187529-104187551 GCCCCAGGAGGGTGCTGTCCAGG + Intergenic
1122851050 14:104531344-104531366 GTCCCAGGAAGGGCCCGTCCAGG + Intronic
1123468442 15:20532906-20532928 CTCCCAGGGGTGGCCCTTCCAGG - Exonic
1123649673 15:22468157-22468179 CTCCCAGGGGTGGCCCTTCCAGG + Exonic
1123728759 15:23128116-23128138 CTCCCAGGGGTGGCCCTTCCAGG - Intergenic
1123740075 15:23276977-23276999 CTCCCAGGGGTGGCCCTTCCAGG + Intergenic
1123746923 15:23325581-23325603 CTCCCAGGGGTGGCCCTTCCAGG - Intergenic
1124279191 15:28348897-28348919 CTCCCAGGGGTGGCCCTTCCAGG - Intergenic
1124303507 15:28562711-28562733 CTCCCAGGGGTGGCCCTTCCAGG + Intergenic
1124370273 15:29100723-29100745 GGCCCAAGAGTGGCCTGGCCTGG - Intronic
1125729606 15:41885802-41885824 GCCCCAGGAGGGGCGCTTCCAGG - Exonic
1129261351 15:74369588-74369610 TCCCCAGAAGTGGCCCGGGCTGG + Intergenic
1132381541 15:101369861-101369883 GCACCAGCAGGGGCCTGTCCCGG - Intronic
1132580578 16:682961-682983 GCCCCTGGAGTGTACCATCCGGG - Exonic
1132603845 16:785534-785556 GGCCCAGGAGCAGCCCATCCTGG + Exonic
1132651228 16:1022227-1022249 CCCCCAGGAGGGGCCCCACCTGG - Intergenic
1132946655 16:2535365-2535387 CCCCCAGGAATGGCCCCTTCTGG + Intergenic
1132969047 16:2676246-2676268 CCCCCAGGAATGGCCCCTTCTGG - Intergenic
1133051439 16:3119476-3119498 GCCCCAGGAGTACCGCGTCCCGG + Exonic
1135544108 16:23354338-23354360 CCCCCAGGAGTGGGCTGGCCGGG + Intronic
1135975895 16:27108950-27108972 GTGCCAGGAGGGGCACGTCCAGG - Intergenic
1136608592 16:31352844-31352866 GACCCAGGAGTGGGCCATGCTGG - Intergenic
1137559255 16:49492499-49492521 GGAGCAGGAGTGGCCCGTCTCGG - Intronic
1137581048 16:49633733-49633755 GCCCCAGGAGGACCCCCTCCAGG - Intronic
1140008250 16:71101820-71101842 TCCCCAGGAGTGGCAACTCCAGG - Intronic
1142200399 16:88758358-88758380 GCCCCAGCAGTGGCCTGGCCTGG + Intronic
1142265889 16:89063832-89063854 GCCCCAGGTGTGGTCCAGCCAGG + Intergenic
1142474607 17:181497-181519 GCCCCGGGCGCGGCCCGGCCCGG + Exonic
1144704129 17:17356291-17356313 GCCCCAAGAGAGGTCCCTCCAGG - Intergenic
1144960838 17:19043075-19043097 GCCCCTGTATTGGCCCGCCCTGG - Intronic
1144974322 17:19131449-19131471 GCCCCTGTATTGGCCCGCCCTGG + Intronic
1145750780 17:27353842-27353864 GCCCCCAGCGTGGCCCGGCCGGG + Intergenic
1146445238 17:32927960-32927982 GCCCCCGCGGTGGCCCGTCCGGG - Exonic
1147311633 17:39599215-39599237 GCCCCTGGAGGGGCCCGCGCCGG - Intergenic
1148469770 17:47885663-47885685 GCTCCAGGAGTGGGCCGGGCTGG + Intergenic
1148755776 17:49972268-49972290 GATCCAGGAGTGGCCCCGCCGGG + Intronic
1148966283 17:51438662-51438684 ACCGCAGGAGTGGCAGGTCCAGG - Intergenic
1151518490 17:74612597-74612619 TCCCCAGGAGTGCCCCGTGCAGG - Exonic
1151661587 17:75521875-75521897 GCCCCAGCCCTGGCCCGGCCAGG + Exonic
1151799532 17:76369815-76369837 GTCCCAGGAGTAGTCAGTCCAGG - Intronic
1151911566 17:77086819-77086841 GCCCCAGGAGGGGAGCCTCCAGG - Intronic
1152538204 17:80962400-80962422 GCCCCATGAGGGGCCTGGCCAGG - Intronic
1154152016 18:11913779-11913801 GCTCCAGGACTGCCCCTTCCTGG + Intergenic
1154194388 18:12254878-12254900 GGCCCAGGCTTGGCCCCTCCTGG + Intronic
1155403756 18:25465578-25465600 GCCCTCGGAGTGGCCCCTGCGGG - Intergenic
1157478253 18:48036891-48036913 GCCCCAAGCGTGGTCTGTCCAGG - Intronic
1157719364 18:49912022-49912044 GCTCCAGGAGAGGCCTGACCAGG - Intronic
1160605944 18:80049389-80049411 TCCCCAGGAGTGGATCATCCAGG - Intronic
1160775378 19:852919-852941 GCCCCACGCGTGGCCCTTCATGG + Exonic
1160813777 19:1026337-1026359 CCCGCAGGAGTGCCACGTCCCGG + Intergenic
1160860417 19:1235174-1235196 GCGCCTGGCGTGGCCCGCCCGGG - Intronic
1160896185 19:1402972-1402994 GCCCCAGGACAGGCATGTCCTGG + Intergenic
1161345176 19:3765379-3765401 GCCCCAGGAGGACCCCTTCCCGG + Intronic
1161407393 19:4098246-4098268 GCCTCTGGACTGGCCTGTCCTGG - Intronic
1161579577 19:5073429-5073451 GCACCAGGAGGGGCCCGCCTGGG - Intronic
1162025023 19:7888785-7888807 GGCCCACGAGGTGCCCGTCCTGG + Intronic
1163008436 19:14410463-14410485 GCCGCGGGAGTGGCCAGTCCTGG + Intronic
1163410415 19:17150484-17150506 GCCCAAGGAGTGGCAGGGCCAGG - Intronic
1163713529 19:18861055-18861077 CCCCCAAGAGGGGCCCGTCCTGG + Intronic
1164739675 19:30566873-30566895 TCCCCGGGAGTGGCTTGTCCAGG + Intronic
1165991321 19:39816294-39816316 GTCTCAGGGGTGGCCCCTCCAGG - Intergenic
928167451 2:28981413-28981435 GCCCCAGGCCTGGCCCACCCTGG - Exonic
928251737 2:29686791-29686813 GCCTCAGGGGTGGACCTTCCAGG - Intronic
928309484 2:30197666-30197688 GCCCCAGGAGTGGCCTGCTCAGG + Intergenic
929943574 2:46353356-46353378 AACCCAGCAGGGGCCCGTCCAGG + Intronic
930029640 2:47050173-47050195 GCCCCAGAAGTTGCCCGAGCTGG - Intronic
931429646 2:62197750-62197772 GCCCCGGGACTGGCTCGGCCAGG - Intronic
932063511 2:68529738-68529760 GCCCCACGGGGGGCCCATCCAGG - Intronic
933715326 2:85355577-85355599 GCCCCAGGAGTGCTCCAGCCAGG + Intronic
933812168 2:86039660-86039682 GCACAAGGAGTGGGCCCTCCAGG - Intronic
933948617 2:87309088-87309110 GTCCCAGGAGAGGCCCACCCAGG - Intergenic
936331582 2:111552508-111552530 GTCCCAGGAGAGGCCCACCCAGG + Intergenic
936389150 2:112055773-112055795 GACCCAGGCGTGGCACGTCTCGG + Intronic
946310379 2:218879884-218879906 GCGCCCGGGGTGGCACGTCCTGG - Intergenic
947739542 2:232478868-232478890 CCCACGGGAGTGGCCAGTCCGGG - Intergenic
947800594 2:232927131-232927153 GCCCGAGGAGTGGCCGGCCCTGG - Exonic
948896368 2:240929784-240929806 GCCCCAGCAGGGGCCAGGCCTGG + Intronic
1168875855 20:1171751-1171773 TCCCCAAGAGTGGGCCATCCTGG - Intronic
1169403665 20:5305182-5305204 ACACCATGAGCGGCCCGTCCCGG + Intronic
1170447898 20:16448537-16448559 GGCTGAGGAGTGGCCTGTCCAGG - Intronic
1170622181 20:18005408-18005430 GCCCCAGGGTTGTCCCGTGCTGG - Intronic
1172312458 20:33929160-33929182 GCCCCAAGAGAGGCCAGCCCTGG - Intergenic
1174287672 20:49483944-49483966 GCCCCAGGAGGCGGCCGCCCTGG - Intergenic
1175268854 20:57719864-57719886 GCCCCAGGAGTAGACAGACCTGG - Intergenic
1178872182 21:36385738-36385760 GCCCGGGGAGGGGCCCGCCCCGG - Intronic
1180847486 22:18991892-18991914 ACCCCTGGAGAGGCCCGTCCTGG + Intergenic
1180866313 22:19122018-19122040 GCCCCAGGCGCGGCCCCTGCAGG + Intronic
1181051021 22:20238311-20238333 GCCGCCGCAGTGGCCCGCCCCGG + Intergenic
1181082529 22:20424629-20424651 GCCCCAGGATGGGCTCCTCCCGG - Exonic
1181438711 22:22924833-22924855 CCCCCAGGAGTGGCTCAGCCTGG - Intergenic
1182122725 22:27797884-27797906 GCCCCAGGAGCAGTCCCTCCTGG + Exonic
1182422766 22:30256563-30256585 GACCCAGGACTGGCCCACCCCGG + Intergenic
1183453919 22:37911212-37911234 GCCCCAGGAGTGGCCCAGTGGGG + Intronic
1183949388 22:41344262-41344284 CCCCTAGCAGTGGCCCGCCCAGG + Intronic
1184732933 22:46380858-46380880 ACCCCTGGAGAGGCCCGTCCTGG - Exonic
1184760097 22:46538770-46538792 GCCCCAGGAGAAGCCCTTCTAGG - Intergenic
1185339835 22:50286339-50286361 GCCCCAGGGGAGGCCCAGCCTGG - Intronic
949559268 3:5187588-5187610 GGCCCGGGATTGGCCCGGCCTGG - Intergenic
950091829 3:10301205-10301227 GCTCCAGGACTGCCCCTTCCTGG - Exonic
961044911 3:123701408-123701430 CCCCCAGGAGCTGCCCCTCCAGG - Intronic
961336014 3:126180218-126180240 GCGCCAGGACTGGCCCGCCGAGG - Intronic
964711630 3:159677299-159677321 GCCCAAGGAGTGGCCAGTGGAGG + Intronic
966496814 3:180590498-180590520 GCCCCAGGTGTGGTCTGTACGGG - Intergenic
969176536 4:5403129-5403151 GCCCTAGGATTGGCCAGCCCTGG - Intronic
969486564 4:7475475-7475497 GCCACAGGAGTGTCCCAGCCTGG + Intronic
969668299 4:8574956-8574978 GCCCCAGGGGTGGCCCACCCTGG - Intronic
977642045 4:99368143-99368165 GGCCCAGGACTGGCCCCTCATGG - Intergenic
977652904 4:99490337-99490359 ACACCAAGAGGGGCCCGTCCCGG - Intergenic
984776207 4:183483350-183483372 GCCCCAGAAGAGCCTCGTCCTGG + Intergenic
984956364 4:185049743-185049765 ACGCCATGAGGGGCCCGTCCCGG - Intergenic
985650218 5:1104092-1104114 GACCCAGGAGGGGCCTGGCCTGG + Intronic
993405975 5:87512280-87512302 ACACCATGAGGGGCCCGTCCTGG + Intergenic
996980784 5:129491290-129491312 CACTCAGGAGTGGCCCGGCCTGG - Intronic
998372857 5:141672377-141672399 GCCCCAGGTGTGGCCTGTGGTGG - Intronic
1001055304 5:168444606-168444628 GCCCCAGGAGCTGCCCTGCCTGG + Intronic
1002121229 5:177006333-177006355 GCACCAGTAATGGCCGGTCCCGG + Exonic
1002200495 5:177525094-177525116 GCTCTTGGAGTGGCCCGACCGGG - Exonic
1002872445 6:1179068-1179090 GCCCCAAGAGTGGCCTGGCTTGG - Intergenic
1005858238 6:29880539-29880561 ACACCATGAGGGGCCCGTCCCGG - Intergenic
1006193729 6:32224334-32224356 GCCCCAGGAGGGGCAGGACCTGG + Intergenic
1006276215 6:33007317-33007339 GCCTGAGGAGTGGCGCATCCAGG + Exonic
1006393521 6:33772570-33772592 GCCTCTGGAGTGGGCTGTCCTGG + Exonic
1007748793 6:44059278-44059300 GCCCTAGGAGGGGCCTGTCTGGG - Intergenic
1016408818 6:143760505-143760527 GCCCCAGCAGTGGCCCCTTTCGG - Exonic
1019168771 6:170117001-170117023 GGCCCAGGAGAGGCCAGTCCTGG + Intergenic
1019413309 7:916034-916056 GCCCCTGGAGTGGCCCTTCTGGG - Intronic
1019550879 7:1601984-1602006 GACCCAGGAGGGTCCCGTCGGGG + Intergenic
1023676603 7:42636484-42636506 ACACCATGAGGGGCCCGTCCTGG + Intergenic
1026074715 7:67156149-67156171 GCCCAAAGACTGGCCCGACCAGG - Intronic
1026702151 7:72656013-72656035 GCCCAAAGACTGGCCCGACCAGG + Intronic
1026984188 7:74544780-74544802 GCCCGAGGAGAGGCCCGTGGAGG + Exonic
1028966349 7:96805960-96805982 GTCCTAGGAGTGGCCCATGCAGG - Intergenic
1032020548 7:128405338-128405360 GCCCCAGGAGAGGCCCAGCCAGG - Intronic
1034902615 7:154916638-154916660 GCCCCAGGAGAGTCCCGGCTCGG + Intergenic
1035171587 7:157020347-157020369 GCTCCAGGAGTGCCGAGTCCTGG - Intergenic
1035204943 7:157289237-157289259 GGCCCAGGAGTGGTCAGTGCTGG + Intergenic
1035299307 7:157886967-157886989 GCCCCAGGACAGGCCCGTCATGG - Intronic
1035299332 7:157887069-157887091 GCCCCAGGACAGGCCTGTCATGG - Intronic
1035705500 8:1671510-1671532 GCTCCAGGAGGGTCCTGTCCCGG + Intronic
1035741009 8:1928743-1928765 GACTCAGGAGTAGCCCGTGCAGG + Intronic
1036477285 8:9104717-9104739 GCCCCAGGAGGGGATCTTCCTGG + Intronic
1040291427 8:46127543-46127565 CCCCCAGGTGTGTCCCGGCCTGG - Intergenic
1040609033 8:48964227-48964249 GCACCATGAGGGGCCCATCCGGG + Intergenic
1042446449 8:68890589-68890611 ACGCCATGAGGGGCCCGTCCTGG + Intergenic
1049099418 8:140568496-140568518 GCCCCAGGGAGGCCCCGTCCAGG - Intronic
1049285815 8:141774638-141774660 ACCCCATGAGTGCCCCCTCCCGG - Intergenic
1049536377 8:143184296-143184318 GCTCCTGGGGTGGCCCTTCCAGG - Intergenic
1049657714 8:143806072-143806094 AGCCCAGGAGCGGCCCCTCCTGG + Intronic
1049672967 8:143877915-143877937 GTCCCAGGGGTGGCCACTCCGGG - Intronic
1053157405 9:35791080-35791102 GCTGCTGGAGGGGCCCGTCCAGG + Intergenic
1053429462 9:38032605-38032627 TCCCCAGGTGTGGCCCGGGCAGG - Intronic
1053482256 9:38424299-38424321 GCCCCAAGTGTGGTCCGTGCCGG - Exonic
1055887850 9:81085784-81085806 ACCCCAGGAGTGGCCCCTGTGGG - Intergenic
1057088505 9:92234488-92234510 GACCCAGGAATGGCCAGTCCTGG + Intronic
1059433492 9:114263530-114263552 GCCCCACGTGTGTCCCCTCCAGG - Intronic
1061007229 9:127935130-127935152 GCCCCAGGGCTGGCCCGTTTGGG - Exonic
1061049071 9:128183462-128183484 CCTCCAGAAGTGGCCCGCCCTGG + Intronic
1061602715 9:131682316-131682338 ACGCCATGAGGGGCCCGTCCCGG + Intronic
1062451186 9:136616462-136616484 GCCCCTGGGGTGACTCGTCCAGG + Intergenic
1062560805 9:137141038-137141060 TCCCCAGGAATGGCCCCTCCTGG - Intronic
1189310014 X:40012396-40012418 GCCCCAGGATTAGCGCGGCCAGG + Intergenic
1191833678 X:65441887-65441909 ACGCCATGAGGGGCCCGTCCCGG - Intronic
1197853405 X:130889144-130889166 GCCCCAGGTGTGGCCACCCCAGG - Intronic