ID: 1104954956

View in Genome Browser
Species Human (GRCh38)
Location 12:132459825-132459847
Sequence CCCTGGCCTTGCCACCATGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 345
Summary {0: 1, 1: 0, 2: 0, 3: 35, 4: 309}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104954945_1104954956 8 Left 1104954945 12:132459794-132459816 CCCTTTCGCACCTCTATCCCAGG 0: 1
1: 0
2: 1
3: 14
4: 152
Right 1104954956 12:132459825-132459847 CCCTGGCCTTGCCACCATGCCGG 0: 1
1: 0
2: 0
3: 35
4: 309
1104954944_1104954956 9 Left 1104954944 12:132459793-132459815 CCCCTTTCGCACCTCTATCCCAG 0: 1
1: 0
2: 2
3: 11
4: 147
Right 1104954956 12:132459825-132459847 CCCTGGCCTTGCCACCATGCCGG 0: 1
1: 0
2: 0
3: 35
4: 309
1104954947_1104954956 7 Left 1104954947 12:132459795-132459817 CCTTTCGCACCTCTATCCCAGGC 0: 1
1: 0
2: 1
3: 17
4: 161
Right 1104954956 12:132459825-132459847 CCCTGGCCTTGCCACCATGCCGG 0: 1
1: 0
2: 0
3: 35
4: 309
1104954941_1104954956 22 Left 1104954941 12:132459780-132459802 CCGCCTGTCTCTCCCCCTTTCGC 0: 1
1: 0
2: 2
3: 68
4: 746
Right 1104954956 12:132459825-132459847 CCCTGGCCTTGCCACCATGCCGG 0: 1
1: 0
2: 0
3: 35
4: 309
1104954949_1104954956 -2 Left 1104954949 12:132459804-132459826 CCTCTATCCCAGGCAGGCCCTCC 0: 1
1: 0
2: 2
3: 45
4: 378
Right 1104954956 12:132459825-132459847 CCCTGGCCTTGCCACCATGCCGG 0: 1
1: 0
2: 0
3: 35
4: 309
1104954952_1104954956 -10 Left 1104954952 12:132459812-132459834 CCAGGCAGGCCCTCCCTGGCCTT 0: 1
1: 3
2: 6
3: 63
4: 593
Right 1104954956 12:132459825-132459847 CCCTGGCCTTGCCACCATGCCGG 0: 1
1: 0
2: 0
3: 35
4: 309
1104954942_1104954956 19 Left 1104954942 12:132459783-132459805 CCTGTCTCTCCCCCTTTCGCACC 0: 1
1: 0
2: 2
3: 21
4: 363
Right 1104954956 12:132459825-132459847 CCCTGGCCTTGCCACCATGCCGG 0: 1
1: 0
2: 0
3: 35
4: 309
1104954943_1104954956 10 Left 1104954943 12:132459792-132459814 CCCCCTTTCGCACCTCTATCCCA 0: 1
1: 0
2: 0
3: 10
4: 198
Right 1104954956 12:132459825-132459847 CCCTGGCCTTGCCACCATGCCGG 0: 1
1: 0
2: 0
3: 35
4: 309
1104954951_1104954956 -9 Left 1104954951 12:132459811-132459833 CCCAGGCAGGCCCTCCCTGGCCT 0: 1
1: 0
2: 7
3: 91
4: 592
Right 1104954956 12:132459825-132459847 CCCTGGCCTTGCCACCATGCCGG 0: 1
1: 0
2: 0
3: 35
4: 309

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104954956 Original CRISPR CCCTGGCCTTGCCACCATGC CGG Intergenic
900159798 1:1218131-1218153 CCTTGGACCTGCCTCCATGCTGG + Intronic
900521388 1:3106992-3107014 CCCTGGCCATGCTGCCATCCTGG - Intronic
900555734 1:3279488-3279510 GCCTGCCCCTGCCACCAGGCTGG + Intronic
900868421 1:5285031-5285053 CACTGGGTTTGGCACCATGCTGG + Intergenic
902057003 1:13609378-13609400 CCCAGGGCTTGGAACCATGCTGG + Intronic
902891535 1:19447800-19447822 CGGTGGCCTTGCCAGAATGCTGG + Intronic
903242157 1:21990283-21990305 CCCTGAACTTGCCACAAGGCAGG - Intronic
903245667 1:22013470-22013492 CCCTGAACTTGCCACAAGGCAGG - Intergenic
903969422 1:27109229-27109251 CCCTGGGCTTGCCTTCATGCAGG + Intronic
904100356 1:28021272-28021294 CCCTTGCCTTCCCAGCATGATGG + Intronic
904481346 1:30795723-30795745 AGCTGGCTTTGCCGCCATGCAGG - Intergenic
904614549 1:31742886-31742908 CGCAGGCCTTGCCGCCGTGCTGG + Exonic
906215066 1:44033867-44033889 CCATGCCCTTCCCACCCTGCAGG - Intergenic
907524575 1:55046704-55046726 CCCTGGCCTGGCCTCCCTGCTGG + Intronic
907745374 1:57207796-57207818 CCCAGGACTTGACACCTTGCTGG - Intronic
912996589 1:114537411-114537433 CTCGGGCCTTGCCAACATTCAGG - Intergenic
915249437 1:154577849-154577871 CCCTGGCCCTGCCTCCCTTCTGG + Exonic
915288006 1:154865041-154865063 CCCTGACCCTGCCATCATGTTGG - Intronic
915597863 1:156905563-156905585 CCCTGGCCTTGTCCCCAGGATGG + Intronic
916202297 1:162283720-162283742 CCCTGGCCTTTCCAGTCTGCAGG + Intronic
917791660 1:178503012-178503034 CCCAGGCCATGCCCCGATGCAGG - Intergenic
918218913 1:182417696-182417718 TCCTTGGCTTGCCAACATGCTGG + Intergenic
919808984 1:201397364-201397386 CCCTGGCCTGCCCTCCCTGCCGG - Intronic
921776928 1:219112056-219112078 CCCTGGCCATGCCTGCTTGCAGG + Intergenic
922179950 1:223225693-223225715 CCCTGGCCTAGACAACATGGAGG - Intronic
922798444 1:228353074-228353096 CCCTGTCCTCGCCACCAAGGCGG + Intronic
923513521 1:234674318-234674340 CTCTGGCCTGGGGACCATGCTGG - Intergenic
924420225 1:243902147-243902169 CCCTGGCCCTGCTACGTTGCTGG - Intergenic
1064299904 10:14114253-14114275 CTCTGGCCTTTCCACCAGCCAGG + Intronic
1064457281 10:15499568-15499590 TCCTTGCCTTTCCACCATCCAGG - Intergenic
1065131858 10:22630085-22630107 CCTTGGCCTTCCCAACATGCTGG - Intronic
1067415481 10:46098647-46098669 CCCTGGTGTTGTCAACATGCAGG - Intergenic
1067431590 10:46249289-46249311 CCCTGCCCAGGCCCCCATGCTGG - Intergenic
1067435520 10:46273722-46273744 CCCTGGTGTTGTCAACATGCAGG - Intergenic
1067441830 10:46312885-46312907 CCCTGCCCAGGCCCCCATGCTGG + Intronic
1069903148 10:71717337-71717359 CCATGGCCTTGCCACCCCTCTGG + Intronic
1071662509 10:87518867-87518889 CCCTGGGCATGCCACCCTCCAGG + Intronic
1072407758 10:95170542-95170564 GCTTGGCCTTGCCTCCATGAGGG - Intergenic
1072650364 10:97290547-97290569 CACTAGGCTTGCCACCATCCTGG + Intronic
1072922929 10:99591875-99591897 CCCTGGTATTCCCAGCATGCTGG + Intergenic
1074185759 10:111098374-111098396 CCCTTGCCTTGCCAGCACCCTGG + Intergenic
1074434672 10:113424064-113424086 GCCTGGCCTGGCCGCCATGGTGG + Intergenic
1074693700 10:116029250-116029272 CCCTTGCCTGGTCACCATTCTGG + Intergenic
1076026944 10:127123287-127123309 CCCTAGCACTGCCACCATTCTGG - Intronic
1076033414 10:127178177-127178199 GCCTGGTCTTGTCACCTTGCTGG + Intronic
1076278371 10:129224807-129224829 GGCTGGCCAGGCCACCATGCTGG + Intergenic
1077140280 11:1021166-1021188 CCCTGCCCCTGCCTGCATGCAGG - Intronic
1077147086 11:1051156-1051178 CACCGGACTTGCCAACATGCAGG + Intergenic
1078557920 11:12345694-12345716 CTCTGGCCTTTCCACAATGGTGG - Intronic
1080896153 11:36450150-36450172 CCCTGGGATTGCCAACATGCAGG + Intronic
1081989591 11:47330629-47330651 CCCTGGCCCTGACACCTTTCTGG + Intergenic
1082087338 11:48060938-48060960 TCCTGGCTCTGCCACCATGGCGG + Intronic
1084325455 11:68397382-68397404 CGCTGGCCGTGCCCTCATGCTGG + Intronic
1084519826 11:69656347-69656369 CCCTGGCTGTGCCACAATGGGGG + Intronic
1084519838 11:69656388-69656410 CCCTGGCTGTGCCACGATGGGGG + Intronic
1084519853 11:69656429-69656451 CCCTGGCTGTGCCACGATGGGGG + Intronic
1084639770 11:70418250-70418272 GCCTGGCCTTGCCTTCCTGCCGG + Intronic
1085623916 11:78057599-78057621 CCCTGGCCTGCCCACCACACTGG + Intronic
1085757727 11:79215556-79215578 ACCTTGCCCTCCCACCATGCTGG + Intronic
1086518330 11:87640645-87640667 CCATGTCCTTTCCACCATGGTGG + Intergenic
1088889275 11:114032003-114032025 CCCTGGCCCTGGCAGCCTGCTGG + Intergenic
1089214422 11:116827227-116827249 CCATGCCCTTCCCACCAGGCTGG - Intergenic
1091324029 11:134670804-134670826 GCCTGGGCTTTCCACCAAGCTGG - Intergenic
1091639929 12:2228711-2228733 CCCTGGCCCTGGAACCATGCTGG - Intronic
1093925064 12:24902071-24902093 CCCTGCACTTCCCACCCTGCCGG + Intronic
1094249761 12:28346696-28346718 CCCTGGGATTGCCACCCTCCAGG + Intronic
1098504333 12:71231897-71231919 CCCCACCCTTGCCACCATGAAGG - Intronic
1099171161 12:79366443-79366465 CCCTGACCTTGCCAAGAGGCAGG + Intronic
1101772849 12:107767460-107767482 CCCTGGGCGTGCCACCCTCCAGG + Intergenic
1101997331 12:109534518-109534540 CCCTGGCCTTGGCATCAGCCTGG + Intronic
1102463716 12:113115710-113115732 CCAGGACCTTGCCACCAAGCTGG - Exonic
1104363633 12:128156543-128156565 CCCTTGCATGGTCACCATGCTGG - Intergenic
1104596555 12:130124264-130124286 ACATGGCCTCGCCAGCATGCTGG + Intergenic
1104946515 12:132417114-132417136 CCGTGGCCATGCCACCAACCTGG + Intergenic
1104954956 12:132459825-132459847 CCCTGGCCTTGCCACCATGCCGG + Intergenic
1106039731 13:26078225-26078247 CGCTGGCCTTGCCTCCACCCAGG + Intergenic
1106249456 13:27972523-27972545 CCCTGCCCTTGCCACCAGCCAGG - Intergenic
1106838209 13:33658986-33659008 TCCTGGGCTTGCCACCCTCCAGG - Intergenic
1107559504 13:41546942-41546964 CCCTGGGCCTGCCTCAATGCGGG - Intergenic
1108291554 13:48967086-48967108 CCCTGGCCCTGCTGCCCTGCAGG - Intergenic
1112288420 13:98124236-98124258 CTTGGGCCATGCCACCATGCTGG + Intergenic
1112319477 13:98394094-98394116 TTCTGGCCTTGGCACCAGGCAGG - Intronic
1113072024 13:106431376-106431398 TCCTGGCATTGCCTCCGTGCTGG - Intergenic
1115105488 14:29756750-29756772 CCTTGGCTTTGCAACCATGCAGG - Intronic
1115963700 14:38863757-38863779 ACCTGGCAATGCAACCATGCAGG - Intergenic
1117236923 14:53787750-53787772 CCCTGGGCATGCCACCCTCCAGG - Intergenic
1117452481 14:55865164-55865186 CCCTGCCCTCTCCACCAGGCAGG - Intergenic
1117802568 14:59460140-59460162 GCCTGGCCCTTCCACCCTGCTGG - Intronic
1118325167 14:64775429-64775451 GCAGGGCCTTCCCACCATGCGGG + Intronic
1118847854 14:69561464-69561486 CCCTGGAGCTGCCACCATGAAGG - Intergenic
1119390490 14:74288236-74288258 CTCTGTCCTTGCCACCAAGTTGG + Exonic
1119444143 14:74649433-74649455 CACTGGCCTGCCCTCCATGCAGG - Intergenic
1121798763 14:96756145-96756167 CCCTGGCCCTGCCAGCACACGGG + Intergenic
1122133627 14:99620335-99620357 CCCTGGCCTCTCCAACCTGCTGG + Intergenic
1122685145 14:103500761-103500783 CACAGGCACTGCCACCATGCTGG + Intronic
1124400301 15:29342087-29342109 CCTTGGCCAGGCCGCCATGCAGG + Intronic
1125760840 15:42094486-42094508 CCCAGCCCTTGCCAAGATGCTGG + Exonic
1126507038 15:49417140-49417162 ACCTGGGCTTCCCAACATGCTGG - Intronic
1126908834 15:53397626-53397648 CCCTATCCTAGCCACCATGAAGG - Intergenic
1128512995 15:68325163-68325185 CCCTGACCATGGCCCCATGCTGG - Exonic
1128749176 15:70136487-70136509 CACAGGCCTTGGCACCAGGCTGG - Intergenic
1130139840 15:81215992-81216014 CCCATGCCTAGCCACCCTGCAGG - Intronic
1130943308 15:88530061-88530083 CCCTGACCTTGCCCACATGCTGG - Intronic
1130983555 15:88829496-88829518 CCCTGGCCTTTTCCCTATGCTGG + Intronic
1131061864 15:89409418-89409440 CCCTGGCGGTGCCATCATGCCGG + Intergenic
1131139123 15:89963024-89963046 CCTTGGCCTTCCCAACATGCTGG - Intergenic
1132180906 15:99752305-99752327 CCCTGGCCCTGCCATTCTGCAGG - Intergenic
1132373570 15:101313755-101313777 CACTGGCCGTGCCACGATGATGG + Intronic
1132852279 16:2030195-2030217 CCCAGGCCTTCCCAGCATGCAGG - Intronic
1132986722 16:2771144-2771166 CCCTGGCCCTGACTCCAGGCTGG - Exonic
1133206504 16:4237346-4237368 CCCTGGCCTGGCTCCCAAGCTGG + Intronic
1136025943 16:27469239-27469261 GCCTGGCCTCGCCATCATCCAGG - Intronic
1136152357 16:28359364-28359386 GCCTGGCCATGCCTCCATGAGGG - Intronic
1136194388 16:28641827-28641849 GCCTGGCCATGCCTCCATGAGGG + Intronic
1136210724 16:28755917-28755939 GCCTGGCCATGCCTCCATGAGGG + Intronic
1136255441 16:29035887-29035909 GCCTGGCCATGCCTCCATGAGGG + Intergenic
1136309873 16:29400350-29400372 GCCTGGCCATGCCTCCATGAGGG - Intronic
1136412896 16:30087100-30087122 CCCTGGCCTTGCCACTGGGAAGG - Intronic
1138528767 16:57623600-57623622 GCCTGGCCTAGCCAAGATGCGGG - Intronic
1139150890 16:64381064-64381086 CCCTGGCCTCTCCCTCATGCTGG + Intergenic
1139657527 16:68397930-68397952 CCCTGGCCTTGCCTGTCTGCAGG - Intronic
1139857558 16:69992740-69992762 GCCTGGCCATGCCTCCATGAGGG - Intergenic
1140365118 16:74375191-74375213 GCCTGGCCATGCCTCCATGAGGG + Intergenic
1140898683 16:79348683-79348705 CCCTGACCATGTCGCCATGCAGG - Intergenic
1141774979 16:86117156-86117178 CCCAGGACTTGCCACCATTTGGG - Intergenic
1142849140 17:2695906-2695928 CCCCAGCCATGCCACCATCCAGG + Intronic
1144187752 17:12812082-12812104 CCCTGACCTTGGCACAAAGCAGG - Intronic
1145294201 17:21575090-21575112 CGCTGGCCATGCCACCCTCCAGG - Intergenic
1145369631 17:22298096-22298118 CGCTGGCCATGCCACCCTCCAGG + Intergenic
1145811288 17:27765700-27765722 CCCCAGCCGTGCCACCATCCTGG - Exonic
1145939497 17:28735190-28735212 CCCTGGTCTTCCCTCCCTGCAGG + Intronic
1146016992 17:29241588-29241610 CCCTGGCCTTGCCTCTAGGCCGG - Intergenic
1146671811 17:34742916-34742938 CCCTGGGTTCTCCACCATGCTGG + Intergenic
1146785215 17:35714166-35714188 CCCTTACCTAGCCCCCATGCTGG - Intronic
1148063104 17:44850066-44850088 CCCTGGCCTGCCTACCTTGCAGG + Exonic
1148350503 17:46938616-46938638 CCTTGACATTGCCAACATGCTGG + Exonic
1149078748 17:52629481-52629503 CCCCAGCCTGGCCACCCTGCAGG + Intergenic
1149426590 17:56560573-56560595 CCCTGGGCATGCCACCCTCCAGG - Intergenic
1150626781 17:66847030-66847052 CTCTGGCTCTGCCACCAAGCAGG - Intronic
1150628774 17:66861582-66861604 CCCTGGCCTGGCTTCCTTGCAGG + Intronic
1151342931 17:73483190-73483212 CCCAGGCCTTGCCTTGATGCAGG + Intronic
1151895055 17:76974608-76974630 GCCTGGCGCTGCCATCATGCTGG + Intergenic
1152008969 17:77699084-77699106 CCCTGGCCTTGGCAGGATCCAGG + Intergenic
1152360844 17:79832403-79832425 CCTTGGCCTTGCCACCCTAAGGG + Intergenic
1152434861 17:80270218-80270240 CCCTGGCTCTGCCACCCAGCAGG + Intronic
1153773496 18:8433625-8433647 CCCTGGCCCTGCCACCTTGGAGG + Intergenic
1154065721 18:11105143-11105165 CCCAGGCCTTGCCATGATGGAGG + Intronic
1154119001 18:11635993-11636015 GCCTGGCCATGCCTCCATGAGGG - Intergenic
1154414931 18:14171500-14171522 CCCTGGTCCTGCCCTCATGCAGG - Intergenic
1157595980 18:48863852-48863874 CCCTGGCCTGGCTACAATGGCGG + Intergenic
1157783250 18:50458635-50458657 CCTTGGCCTTTCCAGCAAGCAGG - Intergenic
1159899833 18:74035871-74035893 GCCTTGCTTTTCCACCATGCTGG - Intergenic
1160455342 18:78995276-78995298 CCCGGGCCTGGCGCCCATGCTGG + Exonic
1161775816 19:6261489-6261511 CCCCAGCGTTGCCTCCATGCCGG + Intronic
1161822041 19:6535518-6535540 CCCTAGCCTGGGCACAATGCTGG - Exonic
1162344172 19:10110195-10110217 CGCTGGCCGTGGCAACATGCGGG + Exonic
1162772355 19:12956912-12956934 CCCGAGCCTGGCGACCATGCAGG - Exonic
1163168921 19:15517369-15517391 CCCTGGCTCTGCCCCCAGGCAGG - Intronic
1164741097 19:30576132-30576154 CCCTGGCTTTTCCACCAGGCAGG + Intronic
1165825591 19:38703982-38704004 CCCAGGCCCTGCCATCCTGCTGG - Intronic
1166041248 19:40204400-40204422 CCCTGCCCTTGGTCCCATGCAGG - Intronic
1166722845 19:45007239-45007261 ACGTGGACTTGCCACCATTCAGG - Intronic
1166996161 19:46720568-46720590 CCCTGCCCTGGCCGCCACGCTGG - Exonic
1168210763 19:54888336-54888358 CCAGGGCCTTGCCACCGGGCAGG + Intronic
1168225716 19:54993592-54993614 CCCTGGCCTCCCTAACATGCTGG - Intronic
1168266763 19:55227672-55227694 CCCTGGCCGAGCCTCCTTGCAGG + Intronic
925217487 2:2110077-2110099 CCCTGGACTTGGCACCATGGAGG - Intronic
925289736 2:2739436-2739458 CCCAGGCCTCAGCACCATGCAGG + Intergenic
925310112 2:2875994-2876016 ACCGGCCCTTGCCACCCTGCTGG - Intergenic
925926929 2:8677480-8677502 CCCCTGCCCTGCCACCATTCAGG - Intergenic
926210308 2:10864386-10864408 CCCTGGCCTGGCTACTATGAGGG - Intergenic
928177856 2:29047110-29047132 GCCTGGCCTTGCCTCTATGCAGG + Intronic
928883371 2:36122313-36122335 CTCTGGCCTTTCCAGCGTGCTGG - Intergenic
929362460 2:41109881-41109903 GTCTGGCCTTGTCACCAGGCTGG - Intergenic
930025649 2:47027737-47027759 CCCTGGCCCTTGCACCCTGCTGG - Intronic
930872491 2:56183680-56183702 CACCGGCCTTGTCACCAGGCAGG - Intergenic
931501608 2:62875064-62875086 CCCTGCCCCTGCCAGCATGTAGG + Intronic
932082479 2:68727556-68727578 CCCTGGCCATGGCACAAAGCCGG - Intronic
932337442 2:70939076-70939098 CCCCGGGCTTGCCCCCATCCCGG + Intronic
932632264 2:73355113-73355135 TCCTGGCCATGCCACCCTCCAGG + Intergenic
933199685 2:79434821-79434843 AGCTCTCCTTGCCACCATGCAGG - Intronic
933212357 2:79585684-79585706 CCCTGGCCTGCACTCCATGCTGG + Intronic
933748247 2:85585926-85585948 CCCTATACTTGTCACCATGCTGG - Intronic
934655557 2:96115328-96115350 CCCGGGCCTTGCCACCCAGTTGG - Exonic
934779439 2:96960433-96960455 CCCTTGCCTTGCCAGGATGCTGG - Exonic
934886232 2:98027953-98027975 CACTGTCCTTGCCAGCCTGCTGG - Intergenic
936634078 2:114235418-114235440 CCTTGGCCTTTCCACCTTACTGG - Intergenic
937323894 2:120977628-120977650 TCCTGGCCTCGCCACCAGGCTGG + Intronic
937327641 2:121001008-121001030 CCCTGGCCTTGCCTCCTTAAGGG - Intergenic
937982849 2:127625197-127625219 CCCTGACTGGGCCACCATGCAGG - Intronic
938954950 2:136288710-136288732 CCCTGTCCTTGCCATCATTGTGG + Intergenic
940830834 2:158463556-158463578 TCCTGGCTTTGCCACTATGCAGG + Intronic
941790477 2:169547256-169547278 CCCTGACCATGCCACCCTCCAGG + Intronic
944535677 2:200707315-200707337 CCCTGGGCACGCCACCCTGCAGG + Intergenic
946330355 2:219005589-219005611 GCCTGGGCAAGCCACCATGCTGG + Intronic
947854560 2:233314397-233314419 CGCAGGCCCAGCCACCATGCAGG + Intronic
948380421 2:237546744-237546766 CCGTGGACTTGCCACACTGCTGG - Intronic
948643901 2:239392074-239392096 TCCTGCCCGGGCCACCATGCCGG + Intronic
948909001 2:240993711-240993733 CCTTGGCCTTGCCTCCATGAAGG - Intergenic
948915580 2:241033658-241033680 CCCTGCCCTGTCCACCATCCTGG - Intronic
1168733007 20:103634-103656 CCCCTGCCTAGCCACCCTGCAGG + Intergenic
1168892737 20:1305535-1305557 GCCTGACCTTGACACCATCCTGG + Exonic
1169751871 20:9002929-9002951 GCCTGGCCTTGGTAGCATGCAGG + Intergenic
1171185085 20:23119285-23119307 CCCTGGGCTTTCCCACATGCTGG + Intergenic
1172129853 20:32648277-32648299 CCCTGCCCTTCCCATCATTCAGG + Intergenic
1172516059 20:35534371-35534393 CACTGGCCTGCCCACCAGGCAGG + Intergenic
1172793915 20:37524259-37524281 GCCTGGCCTTGCTACTCTGCAGG + Intronic
1173688331 20:44939565-44939587 CCCTGGCTTGGGCACCCTGCAGG + Intronic
1173847807 20:46199180-46199202 CCCTTGACTTGCAACCCTGCTGG + Intronic
1175192068 20:57218039-57218061 CCCTGGCCTTGCCATCTCCCTGG - Intronic
1175890273 20:62312876-62312898 CCCTGGCCCTACCGCCTTGCTGG + Exonic
1176020795 20:62961478-62961500 CCCTGGCCTGGCCTCGATCCAGG - Intronic
1176264189 20:64200142-64200164 CCGTGTCCTTGCCATGATGCTGG - Intronic
1176866064 21:14055898-14055920 CCCTGGTCCTGCCCTCATGCAGG - Intergenic
1178000646 21:28158730-28158752 CCCTGGGCTTGCCACCCTCTAGG + Intergenic
1180061742 21:45388757-45388779 CCCTGGCCCTGCCTTCCTGCTGG - Intergenic
1181182817 22:21079328-21079350 CCCAGGCCCTGCCCCCATGGGGG + Intergenic
1181584604 22:23846261-23846283 TCCTGGCTTTGCCACCATAACGG + Intergenic
1181621108 22:24091836-24091858 CCCTGGAGGTGACACCATGCTGG + Exonic
1182041470 22:27241911-27241933 CCCTGGCCTTGGCTCGGTGCCGG - Intergenic
1182108178 22:27704198-27704220 CCCTGCCCGTACCACCATGGGGG + Intergenic
1182651036 22:31851470-31851492 CCCTGTGCTTGCCAGCATCCTGG + Intronic
1184022180 22:41828169-41828191 CCCAGGTCTTGCCACCACACTGG - Intergenic
1184775059 22:46618966-46618988 CCCTGACCTGGCCTCCCTGCAGG - Intronic
1185091651 22:48778893-48778915 CCCACGCCCTGCCGCCATGCCGG - Intronic
1185228793 22:49668397-49668419 TCCAGGCCTTGCCACCATGGTGG + Intergenic
949125165 3:438442-438464 CCCTGGGCTTGCAATCAGGCTGG - Intergenic
949424703 3:3904552-3904574 AACTGTCCATGCCACCATGCTGG + Intronic
950583049 3:13875209-13875231 CCCAGGCCATGCCCCCTTGCTGG - Intronic
952330258 3:32358081-32358103 TCCTGGCTCTGGCACCATGCTGG + Intronic
952838105 3:37621417-37621439 CCCTGGCCCTGCCTGGATGCCGG + Intronic
953533514 3:43759102-43759124 CCCTGGCCCTCCTACCCTGCTGG - Intergenic
953642558 3:44722898-44722920 CCCTGACCATGCTACCATGGGGG + Exonic
954807262 3:53227786-53227808 CACTGATCTGGCCACCATGCTGG + Intronic
954885091 3:53866143-53866165 CCTTGGCCTTGCCAAAGTGCTGG - Intergenic
955216738 3:56990294-56990316 CCATGGCCCAGCCACCTTGCAGG - Intronic
958462696 3:94418929-94418951 CCCTGGCCCTGCCAACATGTGGG + Intergenic
961625326 3:128258323-128258345 CCCTGTCCTTCCCACGGTGCTGG - Intronic
961644688 3:128386534-128386556 GCCTGGCTGTGCCACCATGAAGG - Intronic
962200910 3:133400353-133400375 CTCAGGCCTGGCCACCGTGCCGG + Exonic
962353350 3:134672671-134672693 CCCTTGCCTTCTCTCCATGCTGG + Intronic
964454031 3:156841135-156841157 CTCTGGCCATCCCACCATGCAGG - Intronic
966916271 3:184585738-184585760 CCGTGGCCTTGAAACCATCCAGG - Intronic
969619092 4:8269953-8269975 CGCCGGCCCTGCCGCCATGCAGG + Exonic
971514472 4:27469156-27469178 CCCTGGGCGTGCCACCCTCCAGG - Intergenic
975208949 4:71676863-71676885 CTCTAGCCTTGCCACGAGGCTGG - Intergenic
981633674 4:146850415-146850437 GCCTGACAATGCCACCATGCAGG + Intronic
985911567 5:2887798-2887820 ATGTGGCCTTGCCACCATGTGGG + Intergenic
987030794 5:13974895-13974917 CCCTGGCCTTACCAGCCTCCTGG - Intergenic
992099076 5:73389042-73389064 CCATGGCTGTGCCACCAGGCAGG + Intergenic
992434190 5:76739577-76739599 GACTGGCCCTGCCACCATGCAGG - Intergenic
997159466 5:131592382-131592404 CCATGGTCTTGCCTCCTTGCAGG - Exonic
997461284 5:134054243-134054265 CCCCGCCCTAGCCACCATGCTGG - Intergenic
997524351 5:134542872-134542894 ACCGGCACTTGCCACCATGCCGG + Intronic
999156310 5:149459941-149459963 CCCTGCCCTGGACACCTTGCTGG - Intergenic
999217443 5:149947073-149947095 CCCTGGGCTTGCCACCTTCTAGG - Intergenic
999798770 5:155013662-155013684 CCCTCCCCTTCCCACCGTGCTGG + Intergenic
1001121561 5:168985146-168985168 CCCTGGGCTTTGCACCTTGCAGG + Intronic
1002197651 5:177509911-177509933 CCCTGGCCCTGCCTCCACCCAGG + Intronic
1003117831 6:3295147-3295169 GCCTGGCCTTGCCGCTCTGCAGG + Intronic
1003270079 6:4600797-4600819 CCCTACCCTTGCAACCGTGCAGG - Intergenic
1003312060 6:4977939-4977961 CTCTAGCCTGGACACCATGCAGG - Intergenic
1004040593 6:11971129-11971151 CCCTGGACTTGCCATCTTCCAGG + Intergenic
1004535565 6:16497668-16497690 GCATGGCCCTGCCACCAGGCTGG - Intronic
1004857055 6:19761948-19761970 CCCTGGGCTTGAAATCATGCTGG + Intergenic
1005197732 6:23308943-23308965 CCCTGCCCTGACCACAATGCTGG - Intergenic
1007744361 6:44034449-44034471 CCCTGGCCTTCACACCCTGAAGG - Intergenic
1007922318 6:45621436-45621458 CCCTGAGCATGCCACCATTCAGG - Intronic
1008598468 6:53065785-53065807 CCCTGGCCAGGTTACCATGCTGG - Intronic
1009927280 6:70135187-70135209 CCCTGGTCATGCCACCCTCCAGG + Intronic
1013494919 6:110688947-110688969 CCCTGGCTTTGCCAGCAGACTGG + Intronic
1013656663 6:112253924-112253946 CCCTGCCATTGCCACCCTGCTGG - Intronic
1014952523 6:127573976-127573998 CCCTGGCTTTGACATCAGGCAGG + Intronic
1016327434 6:142918514-142918536 CCCTGGCTTTGCGACGCTGCAGG + Intronic
1017054230 6:150423698-150423720 CCCTGCCCCTTCTACCATGCGGG - Intergenic
1017082645 6:150683919-150683941 CACTGCCCTTGCCACCACCCTGG - Intronic
1017750545 6:157487167-157487189 CCCGGCCCTGGCCACCTTGCCGG + Intronic
1018235158 6:161716792-161716814 CTCTGGCCATGCCACCTTGGGGG - Intronic
1018462055 6:164007730-164007752 CCCTGCCCTCTCCACCATGCTGG - Intergenic
1018808254 6:167277919-167277941 CCCTGGCAGAGCCACCAGGCGGG + Intronic
1019338680 7:497115-497137 CCCTGGACCTGCCTCCATGGTGG - Intergenic
1019523578 7:1471043-1471065 GCCTGGTCTGGCCACCAGGCGGG + Intronic
1020513198 7:9085098-9085120 TCCTTGCCTTGCCACCATGGTGG + Intergenic
1021564548 7:22004095-22004117 TCCAGGCCCTGCCACAATGCCGG - Intergenic
1021746296 7:23744820-23744842 GCCTGGCATTGCCACCATTGGGG - Intronic
1023980775 7:45068768-45068790 CCCAGGCATTGCCCCCATCCTGG + Intronic
1024064154 7:45718826-45718848 TCCTGGCCTGCCCTCCATGCAGG - Exonic
1024226288 7:47328691-47328713 ATCTGGCCTGGCCACCAGGCTGG + Intronic
1026947860 7:74327813-74327835 CCGTGGCCAGGCCACCAGGCAGG - Intronic
1027803197 7:82781881-82781903 CCCTGGGCATGCCACCCTCCAGG - Intronic
1028192449 7:87868706-87868728 TCCTGGGCATGCCACCCTGCAGG + Intronic
1030853682 7:114523495-114523517 TCCTTGCCTTGGTACCATGCAGG + Intronic
1031479147 7:122257355-122257377 CCCTGGCCACGCCACCCTTCAGG - Intergenic
1034266625 7:149784100-149784122 CCCTGGCAGTGCCACCATGAAGG + Intergenic
1034348490 7:150401571-150401593 CACTGCCCCTGCCACAATGCAGG - Intronic
1035225071 7:157428297-157428319 GCCTGGCCCTGACTCCATGCGGG - Intergenic
1036747543 8:11420532-11420554 CCAGGGCCTTTCCACCCTGCCGG - Intronic
1037026710 8:14047406-14047428 CAGTTGCCTTGCCACCATTCAGG + Intergenic
1037189259 8:16101544-16101566 CCCTGGGCATGCCACCCTCCAGG + Intergenic
1037416050 8:18650942-18650964 TCCTGGCCTTCCCACCATACTGG + Intronic
1037627258 8:20618935-20618957 GCCTGGCCTGGCAACCCTGCTGG - Intergenic
1039536929 8:38324899-38324921 CTCTGGCCATGCCACCCTACAGG - Intronic
1044098722 8:88102447-88102469 CCCTGGGCATGCCACCCTTCAGG + Intronic
1044445015 8:92265418-92265440 CCCTGGGCATGCCACCCTCCAGG + Intergenic
1045246119 8:100443041-100443063 CCATGGCCTTGCAATCAGGCAGG - Intergenic
1047760366 8:127949854-127949876 GCCTGGCCTGGCCCCCATTCAGG - Intergenic
1048583558 8:135751026-135751048 CGCTGGGCTTGCCACCAGGCAGG - Intergenic
1049220299 8:141425901-141425923 CCCCAGCCTTGCGACCCTGCAGG + Intronic
1049252714 8:141597741-141597763 CCCCGCCCCAGCCACCATGCCGG - Intergenic
1049468955 8:142766816-142766838 CATTGGCCTTGTCACCCTGCAGG - Intronic
1049782140 8:144433977-144433999 CCCAGGCCAAGCCACCTTGCAGG - Exonic
1051564902 9:18486414-18486436 TCCTGGCCTAGCCAGCATGGTGG + Intronic
1051602209 9:18886644-18886666 CCTTGGCCCTTCCACCATGTGGG - Intronic
1053007749 9:34615184-34615206 CCAAGGCTTGGCCACCATGCTGG + Intronic
1053163600 9:35829584-35829606 CCCTGGCCTGGCCCCCATCCCGG + Exonic
1053605886 9:39658339-39658361 CCCCTGCCTGGCCACCCTGCAGG - Intergenic
1053863803 9:42414963-42414985 CCCCTGCCTGGCCACCCTGCAGG - Intergenic
1054247660 9:62684077-62684099 CCCCTGCCTGGCCACCCTGCAGG + Intergenic
1054561775 9:66718602-66718624 CCCCTGCCTGGCCACCCTGCAGG + Intergenic
1054707110 9:68473887-68473909 CCCTGGCCTTGCTCACATGGGGG - Intronic
1055605811 9:77969205-77969227 CTCTGGCCTTTCCACCTGGCAGG + Intronic
1056485423 9:87052075-87052097 CCCTGCCCTTGTCAGAATGCAGG - Intergenic
1056768090 9:89457337-89457359 CCATGGCTTTGCTACGATGCAGG - Intronic
1056881283 9:90396074-90396096 CCCCAGCCTTGCCAGCAGGCAGG + Intergenic
1059284400 9:113160286-113160308 CCCTGGGCTTGCCACCTTCCAGG + Intronic
1059299269 9:113299155-113299177 CTCTGGCCTTGGCTCCAAGCAGG - Exonic
1059658833 9:116381271-116381293 AACTGCCCTTGCCACTATGCCGG + Intronic
1059820202 9:117964019-117964041 CCCTGGGCTTGCAGCTATGCTGG + Intergenic
1060219929 9:121759106-121759128 CTCGGGCCCTGCCTCCATGCAGG - Intronic
1060891681 9:127193187-127193209 CACTGGCCTTCCCACCAGGCCGG - Intronic
1061008313 9:127941097-127941119 GCCTGGCCTTGTCCCCATGTGGG - Exonic
1062016281 9:134292835-134292857 CCCTGTCCTTGTCACCATCTGGG + Intergenic
1062543409 9:137051472-137051494 CCCTGGCCCTGTCCCCATGATGG - Intronic
1062605971 9:137349016-137349038 CAGTGGCCTTGTCTCCATGCAGG + Intronic
1062634955 9:137485844-137485866 CCATGTCCTTGCCACTGTGCTGG - Intronic
1185579416 X:1198514-1198536 CCATAGCCTTGTCACCAGGCTGG - Intronic
1186387044 X:9120571-9120593 CTCTGGCCTTGCAATCATGCGGG - Intronic
1187189449 X:17019683-17019705 CCAGGTGCTTGCCACCATGCTGG - Intronic
1187442036 X:19329249-19329271 CCCTGGCCTTCCCTGCAAGCTGG - Intergenic
1189278481 X:39804306-39804328 CCAAGGCCTTGCCACCCTGAAGG - Intergenic
1193960070 X:87914473-87914495 ACCTGGCCATGCCTGCATGCAGG + Intergenic
1195111639 X:101656700-101656722 CCTTGCCCTTGCCCCCATTCCGG + Exonic
1196937831 X:120747068-120747090 CCCAGACCTTGCCAGCCTGCAGG - Intergenic
1197967169 X:132077627-132077649 ACCTTGCCTTGCCACAGTGCTGG + Exonic
1198549759 X:137732820-137732842 GCCTGGCCTTTGCCCCATGCTGG - Intergenic