ID: 1104955869

View in Genome Browser
Species Human (GRCh38)
Location 12:132465549-132465571
Sequence CAGGTGGCCGAGAGGCCCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104955869_1104955878 29 Left 1104955869 12:132465549-132465571 CCCCAGGGCCTCTCGGCCACCTG No data
Right 1104955878 12:132465601-132465623 GTGCTCAGGAGAGCACTGACAGG No data
1104955869_1104955876 15 Left 1104955869 12:132465549-132465571 CCCCAGGGCCTCTCGGCCACCTG No data
Right 1104955876 12:132465587-132465609 AGTTTAATCCTTGTGTGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104955869 Original CRISPR CAGGTGGCCGAGAGGCCCTG GGG (reversed) Intergenic
No off target data available for this crispr