ID: 1104955878

View in Genome Browser
Species Human (GRCh38)
Location 12:132465601-132465623
Sequence GTGCTCAGGAGAGCACTGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104955872_1104955878 27 Left 1104955872 12:132465551-132465573 CCAGGGCCTCTCGGCCACCTGGA No data
Right 1104955878 12:132465601-132465623 GTGCTCAGGAGAGCACTGACAGG No data
1104955873_1104955878 21 Left 1104955873 12:132465557-132465579 CCTCTCGGCCACCTGGAGTGCTT No data
Right 1104955878 12:132465601-132465623 GTGCTCAGGAGAGCACTGACAGG No data
1104955868_1104955878 30 Left 1104955868 12:132465548-132465570 CCCCCAGGGCCTCTCGGCCACCT No data
Right 1104955878 12:132465601-132465623 GTGCTCAGGAGAGCACTGACAGG No data
1104955875_1104955878 10 Left 1104955875 12:132465568-132465590 CCTGGAGTGCTTGCTGCTCAGTT No data
Right 1104955878 12:132465601-132465623 GTGCTCAGGAGAGCACTGACAGG No data
1104955874_1104955878 13 Left 1104955874 12:132465565-132465587 CCACCTGGAGTGCTTGCTGCTCA No data
Right 1104955878 12:132465601-132465623 GTGCTCAGGAGAGCACTGACAGG No data
1104955870_1104955878 28 Left 1104955870 12:132465550-132465572 CCCAGGGCCTCTCGGCCACCTGG No data
Right 1104955878 12:132465601-132465623 GTGCTCAGGAGAGCACTGACAGG No data
1104955869_1104955878 29 Left 1104955869 12:132465549-132465571 CCCCAGGGCCTCTCGGCCACCTG No data
Right 1104955878 12:132465601-132465623 GTGCTCAGGAGAGCACTGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104955878 Original CRISPR GTGCTCAGGAGAGCACTGAC AGG Intergenic
No off target data available for this crispr