ID: 1104956652 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 12:132469815-132469837 |
Sequence | AATACCCCCGCCTCCCCCTG GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1104956652_1104956655 | 0 | Left | 1104956652 | 12:132469815-132469837 | CCCCAGGGGGAGGCGGGGGTATT | No data | ||
Right | 1104956655 | 12:132469838-132469860 | TGCAATCCATGTATATGATGAGG | No data | ||||
1104956652_1104956657 | 24 | Left | 1104956652 | 12:132469815-132469837 | CCCCAGGGGGAGGCGGGGGTATT | No data | ||
Right | 1104956657 | 12:132469862-132469884 | GTTAATTTGCAAATTGTAGAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1104956652 | Original CRISPR | AATACCCCCGCCTCCCCCTG GGG (reversed) | Intergenic | ||