ID: 1104956652

View in Genome Browser
Species Human (GRCh38)
Location 12:132469815-132469837
Sequence AATACCCCCGCCTCCCCCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104956652_1104956657 24 Left 1104956652 12:132469815-132469837 CCCCAGGGGGAGGCGGGGGTATT No data
Right 1104956657 12:132469862-132469884 GTTAATTTGCAAATTGTAGAAGG No data
1104956652_1104956655 0 Left 1104956652 12:132469815-132469837 CCCCAGGGGGAGGCGGGGGTATT No data
Right 1104956655 12:132469838-132469860 TGCAATCCATGTATATGATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104956652 Original CRISPR AATACCCCCGCCTCCCCCTG GGG (reversed) Intergenic
No off target data available for this crispr