ID: 1104956654

View in Genome Browser
Species Human (GRCh38)
Location 12:132469817-132469839
Sequence CAAATACCCCCGCCTCCCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104956654_1104956655 -2 Left 1104956654 12:132469817-132469839 CCAGGGGGAGGCGGGGGTATTTG No data
Right 1104956655 12:132469838-132469860 TGCAATCCATGTATATGATGAGG No data
1104956654_1104956657 22 Left 1104956654 12:132469817-132469839 CCAGGGGGAGGCGGGGGTATTTG No data
Right 1104956657 12:132469862-132469884 GTTAATTTGCAAATTGTAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104956654 Original CRISPR CAAATACCCCCGCCTCCCCC TGG (reversed) Intergenic
No off target data available for this crispr