ID: 1104956656 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 12:132469844-132469866 |
| Sequence | TTAACTCCTCATCATATACA TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1104956656_1104956657 | -5 | Left | 1104956656 | 12:132469844-132469866 | CCATGTATATGATGAGGAGTTAA | No data | ||
| Right | 1104956657 | 12:132469862-132469884 | GTTAATTTGCAAATTGTAGAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1104956656 | Original CRISPR | TTAACTCCTCATCATATACA TGG (reversed) | Intergenic | ||