ID: 1104956657

View in Genome Browser
Species Human (GRCh38)
Location 12:132469862-132469884
Sequence GTTAATTTGCAAATTGTAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104956654_1104956657 22 Left 1104956654 12:132469817-132469839 CCAGGGGGAGGCGGGGGTATTTG No data
Right 1104956657 12:132469862-132469884 GTTAATTTGCAAATTGTAGAAGG No data
1104956653_1104956657 23 Left 1104956653 12:132469816-132469838 CCCAGGGGGAGGCGGGGGTATTT No data
Right 1104956657 12:132469862-132469884 GTTAATTTGCAAATTGTAGAAGG No data
1104956656_1104956657 -5 Left 1104956656 12:132469844-132469866 CCATGTATATGATGAGGAGTTAA No data
Right 1104956657 12:132469862-132469884 GTTAATTTGCAAATTGTAGAAGG No data
1104956652_1104956657 24 Left 1104956652 12:132469815-132469837 CCCCAGGGGGAGGCGGGGGTATT No data
Right 1104956657 12:132469862-132469884 GTTAATTTGCAAATTGTAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104956657 Original CRISPR GTTAATTTGCAAATTGTAGA AGG Intergenic
No off target data available for this crispr