ID: 1104959410

View in Genome Browser
Species Human (GRCh38)
Location 12:132481088-132481110
Sequence CTGCACTTTGCTATGGAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104959410_1104959418 28 Left 1104959410 12:132481088-132481110 CCAGGCTCCATAGCAAAGTGCAG No data
Right 1104959418 12:132481139-132481161 TGTAATCCTAACAATTTGAGAGG No data
1104959410_1104959416 -3 Left 1104959410 12:132481088-132481110 CCAGGCTCCATAGCAAAGTGCAG No data
Right 1104959416 12:132481108-132481130 CAGTGGAAGGCTGGGTGCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104959410 Original CRISPR CTGCACTTTGCTATGGAGCC TGG (reversed) Intergenic
No off target data available for this crispr