ID: 1104959410 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 12:132481088-132481110 |
| Sequence | CTGCACTTTGCTATGGAGCC TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1104959410_1104959418 | 28 | Left | 1104959410 | 12:132481088-132481110 | CCAGGCTCCATAGCAAAGTGCAG | No data | ||
| Right | 1104959418 | 12:132481139-132481161 | TGTAATCCTAACAATTTGAGAGG | No data | ||||
| 1104959410_1104959416 | -3 | Left | 1104959410 | 12:132481088-132481110 | CCAGGCTCCATAGCAAAGTGCAG | No data | ||
| Right | 1104959416 | 12:132481108-132481130 | CAGTGGAAGGCTGGGTGCAGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1104959410 | Original CRISPR | CTGCACTTTGCTATGGAGCC TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||