ID: 1104960733

View in Genome Browser
Species Human (GRCh38)
Location 12:132487558-132487580
Sequence AGCCGCCGTCTCTGGAGTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 1, 2: 0, 3: 10, 4: 139}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104960733_1104960743 20 Left 1104960733 12:132487558-132487580 CCAGAACTCCAGAGACGGCGGCT 0: 1
1: 1
2: 0
3: 10
4: 139
Right 1104960743 12:132487601-132487623 GCCCAGAACTCCAGCATCGGCGG 0: 1
1: 0
2: 2
3: 18
4: 132
1104960733_1104960742 17 Left 1104960733 12:132487558-132487580 CCAGAACTCCAGAGACGGCGGCT 0: 1
1: 1
2: 0
3: 10
4: 139
Right 1104960742 12:132487598-132487620 TGAGCCCAGAACTCCAGCATCGG 0: 1
1: 0
2: 3
3: 78
4: 498
1104960733_1104960746 24 Left 1104960733 12:132487558-132487580 CCAGAACTCCAGAGACGGCGGCT 0: 1
1: 1
2: 0
3: 10
4: 139
Right 1104960746 12:132487605-132487627 AGAACTCCAGCATCGGCGGCTGG 0: 1
1: 0
2: 0
3: 11
4: 257

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104960733 Original CRISPR AGCCGCCGTCTCTGGAGTTC TGG (reversed) Intergenic
900776282 1:4587831-4587853 AGAGGCCGACTCTGGAGTCCAGG - Intergenic
905975575 1:42171426-42171448 AGCCGCCTTCTCTGGGCTGCTGG - Intergenic
906622449 1:47294601-47294623 AGCCTCAATCTCTGGGGTTCAGG - Intronic
910813105 1:91257827-91257849 AACCGCCGCCTCCGGGGTTCAGG - Intergenic
918149808 1:181788614-181788636 GGCCGCCATGTCTGGAGTTCAGG + Intronic
919795831 1:201320933-201320955 TGCTGCCCTCTCTGGACTTCTGG + Intronic
921207175 1:212858623-212858645 CGCTGCCGCCTCGGGAGTTCTGG + Exonic
922757697 1:228105639-228105661 AGCCCCCGTCTCTGAAGTTGTGG - Intergenic
1071604461 10:86975413-86975435 AGCCTCCGTCTCCTGGGTTCAGG + Intronic
1072166941 10:92822828-92822850 AACCTCCGGCTCTGGGGTTCAGG + Intergenic
1072424732 10:95320459-95320481 AACCTCCGTCTCGGGAGTTCAGG + Intronic
1073498843 10:103918207-103918229 TGAGGTCGTCTCTGGAGTTCCGG + Intergenic
1075690627 10:124391691-124391713 AACCTCCGCCTCTTGAGTTCAGG + Intergenic
1077364118 11:2154681-2154703 AGCAGCCATCGCTGGAGTTGGGG + Intronic
1077874666 11:6294090-6294112 TGCCTCCTTCTCTTGAGTTCAGG - Intergenic
1078257846 11:9675203-9675225 AGCCTCCATCTCCTGAGTTCAGG - Intronic
1081640265 11:44748314-44748336 AACCGCCGCCTCTGGGGTTCAGG - Intronic
1084914048 11:72414464-72414486 AGCCACCTTCTGTGAAGTTCAGG + Intronic
1090840861 11:130486699-130486721 AGCGACCGTCACTGGAGGTCAGG - Intergenic
1090966288 11:131600155-131600177 AGCAGCCCTCTCTGGGGATCTGG + Intronic
1094525074 12:31226131-31226153 AGGGGCCGTCTGTGGAGGTCAGG - Intergenic
1095162011 12:38929366-38929388 AGCCTCTGCCTCTGGGGTTCAGG - Intergenic
1095700384 12:45185193-45185215 AACCTCCGTCTCCCGAGTTCAGG - Intergenic
1097193296 12:57230488-57230510 AGTTGCCCTCTCTGGAGTTGGGG + Intronic
1103459201 12:121090197-121090219 AGCGGCCATCTCTGGATTCCTGG + Intergenic
1104960733 12:132487558-132487580 AGCCGCCGTCTCTGGAGTTCTGG - Intergenic
1104960745 12:132487603-132487625 AGCCGCCGATGCTGGAGTTCTGG - Intergenic
1104960756 12:132487648-132487670 AGCCGCCATCTCTGGAGTTCTGG - Intergenic
1104967992 12:132517994-132518016 TGCCGCCAGCTCTGGAGTTGGGG - Intronic
1111992549 13:95131545-95131567 AGCCTCCGCCTCTGGGGTTCAGG - Intronic
1116456631 14:45127193-45127215 AACCTCCGCCTCTGGGGTTCAGG + Intronic
1119178899 14:72590856-72590878 AGCCGCTGTCTCTGAGGATCAGG + Intergenic
1119295092 14:73526491-73526513 AGCTGCCCTGTCTGGAGTTGGGG - Intronic
1121033453 14:90679298-90679320 AGCTGCCCTCTCATGAGTTCTGG + Intronic
1122411246 14:101527223-101527245 CCCCGCGCTCTCTGGAGTTCTGG + Intergenic
1122889405 14:104725448-104725470 AGCCCTCCTCTCTGGAGCTCAGG - Intronic
1126026472 15:44450676-44450698 AACCTCCGCCTCTGGGGTTCAGG + Intronic
1129742457 15:77996031-77996053 AGCCGCCCTCTCTTGCCTTCTGG + Exonic
1129843026 15:78755446-78755468 AGCCGCCCTCTCTTGCCTTCTGG - Intergenic
1130118091 15:81023057-81023079 AACCTCCGCCTCTGGGGTTCAGG - Intronic
1131645415 15:94336906-94336928 AGGCACCGTCTCTGGACTCCTGG + Intronic
1132501754 16:287597-287619 AGCCGCCGGCTGTGCAGTCCTGG - Exonic
1133927952 16:10209007-10209029 AACCTCCGCCTCCGGAGTTCAGG + Intergenic
1135777150 16:25266828-25266850 GGCCTTTGTCTCTGGAGTTCTGG + Intergenic
1139348010 16:66316907-66316929 AGCCTCTGTCACTGGAGTTTTGG - Intergenic
1141465890 16:84205619-84205641 AACCTCCGTCTCTCAAGTTCAGG - Intergenic
1141521244 16:84581058-84581080 AGCCTCCGTCTCCTGGGTTCAGG - Intronic
1141561044 16:84867946-84867968 AGCCGCCGTTTCTGCAGGCCGGG + Intronic
1141633901 16:85303717-85303739 GGCCGCCGCCTCCCGAGTTCTGG + Intergenic
1147653207 17:42073521-42073543 AGGCACTGTCTCTGGAGGTCAGG + Intergenic
1148078382 17:44953173-44953195 GGCAGCAGTCTCTGGAGTTCGGG + Intergenic
1148909794 17:50935293-50935315 AACCCCCGTCTCGGGAGCTCAGG + Intergenic
1149533061 17:57411084-57411106 AGCCTCAGTCTCTGGGGCTCAGG + Intronic
1151908297 17:77064035-77064057 AGCCTCCACCTCTGGGGTTCAGG - Intergenic
1152370617 17:79886441-79886463 AGCAGCTGTCTCTGGAGAACAGG - Intergenic
1152659742 17:81536755-81536777 AGGCGCCGTCGCTGAAGCTCAGG - Exonic
1155335164 18:24756067-24756089 AGCCTCCGCCTCCCGAGTTCAGG - Intergenic
1157427763 18:47598703-47598725 AGCCCCTGGCTCTGGAGGTCTGG + Intergenic
1160503150 18:79412068-79412090 AGCCGGCGTCTCTGGGGAGCAGG - Intronic
1160991621 19:1862656-1862678 AGCATCCGGCTCTGGGGTTCTGG - Intronic
1161292063 19:3499688-3499710 AACCTCCGCCTCTCGAGTTCAGG - Intronic
1161940790 19:7402335-7402357 AACCTCCGTCTCTGGGGTTCAGG - Intronic
1162067522 19:8135357-8135379 AGCCTCCGTCTCCTGGGTTCAGG + Intronic
1165701336 19:37940660-37940682 AACCTCCGTCTCCCGAGTTCAGG + Intronic
1168716171 19:58528810-58528832 AACCTCCGCCTCTCGAGTTCAGG - Intronic
925971748 2:9111073-9111095 CGCTGCCTTCCCTGGAGTTCTGG - Intergenic
926200669 2:10794362-10794384 AGCCTCCGTCTCCTGGGTTCAGG - Intronic
931340625 2:61397815-61397837 AGCCTCCGTCTCCTGGGTTCAGG - Intronic
932571821 2:72942260-72942282 AGCCGACTTCTTTGGTGTTCTGG - Exonic
932778597 2:74545122-74545144 AGCAGCCATCTCTGGGCTTCAGG - Intronic
933689585 2:85169320-85169342 AGCAGGCGAATCTGGAGTTCAGG - Intronic
934528889 2:95072686-95072708 AGCCGCCAGTTCTGGAGTCCAGG + Intergenic
934623859 2:95832738-95832760 AGCCACCCTCACTGGTGTTCTGG - Intergenic
934809767 2:97268857-97268879 AGCCACCCTCGCTGGTGTTCTGG + Intergenic
934827928 2:97439128-97439150 AGCCACCCTCGCTGGTGTTCTGG - Intergenic
943081713 2:183264852-183264874 AGCCTCCGCCTCTTGGGTTCAGG + Intergenic
944173362 2:196802867-196802889 AGCCTCCGCCTCCGGGGTTCAGG + Intergenic
944767350 2:202877871-202877893 AGCAGGCATCTCTGGTGTTCTGG + Exonic
1174341838 20:49902036-49902058 AACCTCCGTCTCTCGGGTTCAGG + Intergenic
1175172699 20:57091420-57091442 AGCCGCTGGCTCTGGATTACTGG + Intergenic
1175725661 20:61316745-61316767 AGCCGCCGCCTCTGCTTTTCGGG + Intronic
1176952668 21:15064961-15064983 CGCCGCCGCCTCCCGAGTTCGGG + Exonic
1178424802 21:32470838-32470860 AACCTCCGTCTCTAGGGTTCAGG + Intronic
1178998880 21:37435325-37435347 AGCCGCTGTTGCTGGGGTTCAGG + Intronic
1180695708 22:17750253-17750275 AGCCGCCATTTCTGGAGCACAGG - Intronic
1183071981 22:35402633-35402655 AGCCTCCACCTCTGGGGTTCAGG + Intronic
1184074328 22:42166525-42166547 AACCTCCATCTCTGGGGTTCAGG - Intronic
1185294336 22:50045965-50045987 CGCCACTGTCTCTGGAGATCGGG - Exonic
949970629 3:9399928-9399950 AGCTGCTGGCTCTGGAGCTCTGG + Intronic
950217557 3:11170042-11170064 AGGCACCGTCTGTTGAGTTCTGG - Intronic
954240573 3:49290330-49290352 AGCCTCAGTCTCTTGGGTTCAGG - Intronic
954559820 3:51547292-51547314 AGCCTCTATCTCTGGAGTTCAGG - Intronic
957674885 3:83353827-83353849 AGCCTCCGCCTCTGGGGTTTAGG - Intergenic
966711107 3:182973723-182973745 AGCCTCTGTCTCCGGGGTTCAGG - Intronic
969241926 4:5904607-5904629 AGAGTCCGTCTCTGGATTTCCGG + Intronic
969663217 4:8542495-8542517 AGCCACCGTCCCTGCAGCTCTGG - Intergenic
971253417 4:24992322-24992344 AGCCACCCTCTCTGGAGCTTAGG - Intergenic
971918758 4:32909817-32909839 GGCCGCCATCTCTGTGGTTCAGG + Intergenic
973304934 4:48635795-48635817 AAGGGCAGTCTCTGGAGTTCAGG - Intronic
973851608 4:54966532-54966554 AGTCGCCTTCTCTGGACTTTAGG + Intergenic
977020059 4:91747232-91747254 TGCCCCCCTCCCTGGAGTTCTGG + Intergenic
982360290 4:154512221-154512243 AGCAGCCGTCCCTGGAGGGCTGG + Intergenic
987709511 5:21490762-21490784 AACCTCCACCTCTGGAGTTCAGG - Intergenic
988750102 5:34183410-34183432 AACCTCCACCTCTGGAGTTCAGG + Intergenic
991738363 5:69646610-69646632 AACCTCCACCTCTGGAGTTCAGG + Intergenic
991759830 5:69909816-69909838 AACCTCCACCTCTGGAGTTCAGG - Intergenic
991787501 5:70208299-70208321 AACCTCCACCTCTGGAGTTCAGG + Intergenic
991789939 5:70226349-70226371 AACCTCCACCTCTGGAGTTCAGG + Intergenic
991814687 5:70501445-70501467 AACCTCCACCTCTGGAGTTCAGG + Intergenic
991817823 5:70522726-70522748 AACCTCCACCTCTGGAGTTCAGG + Intergenic
991839060 5:70784882-70784904 AACCTCCACCTCTGGAGTTCAGG - Intergenic
991879947 5:71208668-71208690 AACCTCCACCTCTGGAGTTCAGG + Intergenic
991882387 5:71226692-71226714 AACCTCCACCTCTGGAGTTCAGG + Intergenic
994366369 5:98922068-98922090 AGCCTCCGTCTCCTGTGTTCTGG - Intronic
994461207 5:100068480-100068502 AACCTCCACCTCTGGAGTTCAGG + Intergenic
994485357 5:100381926-100381948 AACCTCCACCTCTGGAGTTCAGG + Intergenic
1005071647 6:21867312-21867334 AACCTCCGTCTCTACAGTTCAGG - Intergenic
1005548166 6:26889727-26889749 AACCTCCACCTCTGGAGTTCAGG + Intergenic
1005871178 6:29975293-29975315 GGCCGCAGTCCCTGGAGTTGGGG - Intergenic
1007090587 6:39182146-39182168 AGAAGCAGTCTCTGGATTTCAGG - Intergenic
1007885797 6:45228728-45228750 AGCCGCCGCCCCCAGAGTTCAGG + Intronic
1009018927 6:57930834-57930856 AACCTCCACCTCTGGAGTTCAGG + Intergenic
1011602900 6:89076435-89076457 AGCCTCCACCTCTGGCGTTCAGG - Intergenic
1013011162 6:106121708-106121730 AACCTCTGTCTCTGGGGTTCAGG - Intergenic
1013313814 6:108922352-108922374 AGCCTCAGCCTCTGGGGTTCAGG + Intronic
1014599875 6:123398084-123398106 AACCTCCGCCTCCGGAGTTCAGG + Intronic
1016672368 6:146723621-146723643 TGCCTCAGTCTCTGGAGTACCGG - Intronic
1019466575 7:1192860-1192882 AGCCTCAACCTCTGGAGTTCAGG - Intergenic
1019883113 7:3880771-3880793 AGCCGCAGCCTCTGGAGGCCCGG - Intronic
1022794744 7:33722911-33722933 AGTGGCTGTCCCTGGAGTTCAGG - Intergenic
1023844305 7:44112411-44112433 AGCCTCAGCGTCTGGAGTTCAGG - Intronic
1033200705 7:139367056-139367078 AACCTCCGCCTCTCGAGTTCAGG + Intronic
1035179481 7:157078587-157078609 ATCCCCCGCCTCTGGAGCTCGGG - Intergenic
1035398333 7:158549431-158549453 AGGCGCCATCCCTGGGGTTCAGG - Intronic
1036772964 8:11591737-11591759 AGCCCCAGTCACTGGAGTCCAGG + Intergenic
1037651481 8:20842800-20842822 AGCCTCCGTCTCCCGGGTTCAGG - Intergenic
1047736819 8:127772865-127772887 AGCTGCAGTGTGTGGAGTTCTGG + Intergenic
1047756963 8:127926366-127926388 AGCCGCCGTCTCGGCAGCTGGGG - Intergenic
1048546868 8:135395699-135395721 AACCTCCGCCTCTGGGGTTCAGG + Intergenic
1049342227 8:142119280-142119302 AGGAGGAGTCTCTGGAGTTCCGG - Intergenic
1052925679 9:34014243-34014265 AACCTCCGCCTCTGGGGTTCAGG - Intronic
1061881988 9:133573262-133573284 AGCAGATGTCTCTGGTGTTCTGG + Intronic
1062609237 9:137366547-137366569 AGCAGCCTCCTCTGGAGGTCCGG + Exonic
1203653593 Un_KI270752v1:2254-2276 TGCCTCTGCCTCTGGAGTTCTGG + Intergenic
1190320534 X:49177004-49177026 AGCCGCCGCAGCTGGAGTGCCGG - Exonic
1192493269 X:71595176-71595198 AGCCTCCGCCTCCTGAGTTCTGG + Intronic
1193073654 X:77332900-77332922 AGCTGTCATCTCTGCAGTTCAGG - Intergenic
1193625862 X:83819451-83819473 AGCCGCCATCTCTGAGGTTCTGG - Intergenic
1195662695 X:107396672-107396694 AGCTGTGCTCTCTGGAGTTCGGG + Intergenic
1197780233 X:130151955-130151977 AGCCGCCACCTCAGGGGTTCAGG - Intronic
1201333888 Y:12858410-12858432 AACCTCCGCCTCTGGGGTTCAGG + Intronic