ID: 1104962683

View in Genome Browser
Species Human (GRCh38)
Location 12:132495682-132495704
Sequence TGGGACTCTGTGGGAGGAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 383
Summary {0: 1, 1: 0, 2: 2, 3: 39, 4: 341}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104962683_1104962696 11 Left 1104962683 12:132495682-132495704 CCTGTTCCTCCCACAGAGTCCCA 0: 1
1: 0
2: 2
3: 39
4: 341
Right 1104962696 12:132495716-132495738 AAGGGCTGCTCCCTCCGGGGAGG 0: 1
1: 0
2: 1
3: 14
4: 170
1104962683_1104962689 -8 Left 1104962683 12:132495682-132495704 CCTGTTCCTCCCACAGAGTCCCA 0: 1
1: 0
2: 2
3: 39
4: 341
Right 1104962689 12:132495697-132495719 GAGTCCCACAGCTGTGGGCAAGG 0: 1
1: 0
2: 6
3: 26
4: 240
1104962683_1104962697 14 Left 1104962683 12:132495682-132495704 CCTGTTCCTCCCACAGAGTCCCA 0: 1
1: 0
2: 2
3: 39
4: 341
Right 1104962697 12:132495719-132495741 GGCTGCTCCCTCCGGGGAGGTGG 0: 1
1: 1
2: 0
3: 36
4: 368
1104962683_1104962695 8 Left 1104962683 12:132495682-132495704 CCTGTTCCTCCCACAGAGTCCCA 0: 1
1: 0
2: 2
3: 39
4: 341
Right 1104962695 12:132495713-132495735 GGCAAGGGCTGCTCCCTCCGGGG 0: 1
1: 0
2: 1
3: 26
4: 249
1104962683_1104962690 -7 Left 1104962683 12:132495682-132495704 CCTGTTCCTCCCACAGAGTCCCA 0: 1
1: 0
2: 2
3: 39
4: 341
Right 1104962690 12:132495698-132495720 AGTCCCACAGCTGTGGGCAAGGG 0: 1
1: 0
2: 3
3: 27
4: 230
1104962683_1104962694 7 Left 1104962683 12:132495682-132495704 CCTGTTCCTCCCACAGAGTCCCA 0: 1
1: 0
2: 2
3: 39
4: 341
Right 1104962694 12:132495712-132495734 GGGCAAGGGCTGCTCCCTCCGGG 0: 1
1: 0
2: 5
3: 37
4: 355
1104962683_1104962700 23 Left 1104962683 12:132495682-132495704 CCTGTTCCTCCCACAGAGTCCCA 0: 1
1: 0
2: 2
3: 39
4: 341
Right 1104962700 12:132495728-132495750 CTCCGGGGAGGTGGACTCAGAGG 0: 1
1: 0
2: 1
3: 17
4: 224
1104962683_1104962693 6 Left 1104962683 12:132495682-132495704 CCTGTTCCTCCCACAGAGTCCCA 0: 1
1: 0
2: 2
3: 39
4: 341
Right 1104962693 12:132495711-132495733 TGGGCAAGGGCTGCTCCCTCCGG 0: 1
1: 3
2: 0
3: 22
4: 283

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104962683 Original CRISPR TGGGACTCTGTGGGAGGAAC AGG (reversed) Intronic
900339531 1:2181419-2181441 TCGGACGCTGTGGCAGTAACAGG - Intronic
901682328 1:10920402-10920424 AGGGAGCCTGTGTGAGGAACTGG - Intergenic
902251606 1:15157127-15157149 TGGGGCTGTCTGGGAGGGACAGG - Intronic
902413628 1:16226474-16226496 CAGGAATCTGTGAGAGGAACAGG + Intergenic
902816991 1:18922228-18922250 AGGAACTCTGTTGGAGGAGCTGG - Intronic
903696475 1:25211040-25211062 AGCAACTCTGTGGCAGGAACTGG + Intergenic
904256391 1:29257562-29257584 TGGGTCTCTGGGGAAGGGACAGG + Intronic
904259498 1:29280232-29280254 TGGGAGACTGAGGGAGGAAAAGG - Intronic
905033402 1:34902450-34902472 TGGTACCCAGTGGGAGAAACAGG + Intronic
905134371 1:35787248-35787270 TGGAATTCTGTGGCAGGAAATGG - Intergenic
906100706 1:43258926-43258948 TGGGACACACTTGGAGGAACTGG - Intronic
907387732 1:54136810-54136832 TGGGAATCGGAGGGAGGAGCTGG + Intronic
908502466 1:64757986-64758008 TGGGTATCTGTGGGGGGAATGGG - Intronic
908957253 1:69648323-69648345 TGGGAGTCTATAAGAGGAACAGG + Intronic
910617407 1:89214915-89214937 TGGGACACAGTTGGAGGAACTGG + Intergenic
912325211 1:108751294-108751316 AGGGGCTCTGTGCTAGGAACAGG + Intronic
915111208 1:153565684-153565706 TGGCACTCTCTGGGAGGGAGGGG - Exonic
916724347 1:167509544-167509566 ATGGACACTGTGGGAAGAACTGG + Intronic
918808790 1:189087591-189087613 AGGGACCTTGTGGGAGGAAATGG + Intergenic
919091603 1:192984201-192984223 AAGGACACTGTGGGAAGAACAGG + Intergenic
920127277 1:203703369-203703391 TGGGACTCTGAGGTAGTACCAGG + Intronic
920365038 1:205443855-205443877 GGGGACTCTGAGGGAGGAGTGGG - Intronic
920452314 1:206068869-206068891 TGACACTCTGTGGGAAGAGCTGG + Intronic
921265823 1:213419891-213419913 TGCCACCCTGTGGGAGGAAGAGG + Intergenic
922237177 1:223731063-223731085 TGGGAGTCAGTGTGAGGATCTGG + Intronic
924483303 1:244455754-244455776 TGGGACTCCTTGGGAAAAACAGG + Intronic
1063377462 10:5562517-5562539 TGAGACTCTGAGGGAGGAGGAGG - Intergenic
1063457352 10:6193470-6193492 TCGGACACTGTGGTAGGATCTGG + Intronic
1064706852 10:18081854-18081876 TGACACTGTGTGGGAGGAACTGG - Intergenic
1065728010 10:28684922-28684944 TAGGCCTCTCTGGGAGGAAGGGG - Intergenic
1066374354 10:34844064-34844086 GGGGGCTCTGTGTCAGGAACTGG - Intergenic
1067528062 10:47050223-47050245 TGGGACTGAGTGTGAGGACCAGG + Intergenic
1068609807 10:59046535-59046557 TGTGACTCCGTGTGAGGAATTGG - Intergenic
1068812241 10:61269237-61269259 TGGGAGTCTGTGGGAGTTGCTGG + Intergenic
1069091724 10:64207570-64207592 TGGAAGTGTGTGGGAGGAAAAGG - Intergenic
1069942301 10:71964222-71964244 CGGGCCTCTGGGGGAGGAAGGGG - Intergenic
1070838050 10:79463694-79463716 TGCGAATCTGTAGGAGGTACTGG - Intergenic
1073571051 10:104581483-104581505 TGGGATGCTCTGTGAGGAACAGG + Intergenic
1075448077 10:122527754-122527776 TGGGGCTATGTGAGAGGCACAGG + Intergenic
1076816477 10:132917466-132917488 TGAGCCTGCGTGGGAGGAACAGG + Intronic
1076860056 10:133136103-133136125 TGGGTCTCTGTGGGGGGGTCTGG + Intergenic
1076860341 10:133136882-133136904 TGGGTCTCTGTGGGGGGGTCTGG + Intergenic
1076860395 10:133137045-133137067 TGGGTCCCTGTGGGGGCAACTGG + Intergenic
1076860422 10:133137126-133137148 TGGGTCCCTGTGGGGGGATCTGG + Intergenic
1076860484 10:133137288-133137310 TGGGTCTCTGTGGGGGGGTCTGG + Intergenic
1076993582 11:288189-288211 GGGGACCCTGTGGGAGCAGCAGG + Intergenic
1077226275 11:1440304-1440326 TGGGCCTCTGTGGGGGGAACAGG - Intronic
1077674236 11:4183036-4183058 GGGGACTCTGGGGGAGGAGGAGG - Intergenic
1077701037 11:4442898-4442920 TGTGTCTCTGTGGGAAGAAAGGG + Intergenic
1077994498 11:7441825-7441847 TGGGACTGTGTGGGCCCAACAGG + Intronic
1078329053 11:10403632-10403654 TGGGTATCTGTGGGAGGTCCTGG - Intronic
1079294323 11:19218816-19218838 AGGGACTGTGCGGGAGGAGCTGG + Intergenic
1079563009 11:21846402-21846424 AGGGACTCAGTGGGAGGTAATGG - Intergenic
1080810677 11:35701295-35701317 TGGGACTCCTTGGGAAAAACAGG - Intronic
1081981301 11:47268991-47269013 TGGGGCCCTGTGGGAAAAACAGG - Intronic
1083001541 11:59296851-59296873 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1083527486 11:63383015-63383037 TGACACACTGTGTGAGGAACTGG + Intronic
1085026764 11:73240859-73240881 TGGGACTCAGTGGGGAGAAAGGG - Intergenic
1085070726 11:73542322-73542344 TGGGAAACAGTGGGAGGAGCAGG - Intronic
1085795628 11:79536998-79537020 TGGGAGACTATGGGAGGACCAGG + Intergenic
1088598333 11:111455957-111455979 TGGGTGTCTGGGGGTGGAACTGG - Intronic
1088626693 11:111734852-111734874 CCTAACTCTGTGGGAGGAACAGG + Intronic
1089315804 11:117590540-117590562 AAGGACGGTGTGGGAGGAACAGG - Intronic
1089799504 11:121013647-121013669 AGGGACCTGGTGGGAGGAACTGG - Intergenic
1090398154 11:126432599-126432621 TGTCACTCTGTGGGTGGAGCTGG - Intronic
1090627049 11:128616783-128616805 AGGGACGCTGTGGCAGGGACTGG - Intergenic
1090634736 11:128683868-128683890 TGGAACTCTGGGGGAGGGATGGG + Intergenic
1090923456 11:131229353-131229375 AGTGGCTCTCTGGGAGGAACTGG + Intergenic
1091651746 12:2315587-2315609 CGGGACTCTGTGGGAGGCACGGG - Intronic
1091679506 12:2516696-2516718 GGGAAGTCTGTGAGAGGAACGGG + Intronic
1091691725 12:2601763-2601785 AGGGATGCTGTGGGAGGAAGGGG + Intronic
1094239899 12:28210568-28210590 TGGGACTCCTTGGGAAAAACAGG - Intronic
1095782110 12:46071753-46071775 TGGGACTTAGTGGGAGGAGGAGG - Intergenic
1095989902 12:48027462-48027484 CCGGGCTCTGTGGGAGGAAGGGG - Intergenic
1096969953 12:55657658-55657680 AGGGATCCTGGGGGAGGAACAGG + Intergenic
1097007704 12:55931160-55931182 AGGGACTCACTGGCAGGAACTGG - Exonic
1098435090 12:70460280-70460302 TGGGACACAGTTGGAGGAACTGG - Intergenic
1099105045 12:78486560-78486582 GGGGACTCTGTGGGTGGGAGGGG + Intergenic
1100294475 12:93248021-93248043 AGGGACTATGTGGAAGGAACAGG + Intergenic
1101848966 12:108387229-108387251 GGGGACTGTGTGGGAGGCAGGGG - Intergenic
1102984241 12:117265504-117265526 TGTCACTCTGTGGGAGGAGAGGG + Exonic
1103394484 12:120597386-120597408 TGTGGCTCTGTGGGAGGTACAGG + Intergenic
1103850192 12:123928095-123928117 AGCGACTGTGTGGGAGGAGCTGG + Exonic
1103995822 12:124829359-124829381 TTGGATTCTGTGGGGAGAACGGG - Intronic
1104101920 12:125620874-125620896 AGGGACTCAGTGGGAGGCAATGG - Intronic
1104897980 12:132173559-132173581 AGGGGCACTGTGGGAAGAACAGG + Intergenic
1104962683 12:132495682-132495704 TGGGACTCTGTGGGAGGAACAGG - Intronic
1105451017 13:20500410-20500432 TGGGACACAGTTGAAGGAACTGG + Intronic
1105773235 13:23632697-23632719 TGGGACTCTGTGGGGAGACCTGG - Intronic
1108708003 13:53007289-53007311 TGGGACACCTTGGGAGGCACAGG - Intergenic
1111975067 13:94957673-94957695 TGGGACCCAGTGGAAGGTACTGG - Intergenic
1112205904 13:97322981-97323003 TGGGACTCTGGAGGAGGCACTGG + Intronic
1112806287 13:103167004-103167026 TGGGGTTCAGTGGGAGGAATGGG + Intergenic
1113729993 13:112634462-112634484 AGGGGCTCTGTGCCAGGAACTGG + Intergenic
1114450954 14:22825099-22825121 TGGAACTCTGTTGGAGGGAGGGG - Intronic
1114452376 14:22835930-22835952 TGGAACTCGCTGGGAGGAAAAGG - Intergenic
1114540788 14:23456788-23456810 AGCTACTCTGTGTGAGGAACTGG - Intergenic
1114572692 14:23684670-23684692 GTGAACTCTATGGGAGGAACAGG + Intergenic
1116990290 14:51268919-51268941 AGGAACTCTGTGTCAGGAACTGG - Intergenic
1118316907 14:64731182-64731204 TGGGACGCTGGGGGAGGGGCAGG + Intronic
1118981236 14:70718683-70718705 GGGGTCTCAGTGGGAGGCACTGG - Intergenic
1119305512 14:73604990-73605012 TGGGACTCATTGGGAAAAACAGG - Intergenic
1119507661 14:75186872-75186894 TGAGACTCTATGGGAGAAAGAGG + Intergenic
1119638321 14:76294416-76294438 CAGGGCTCTGTGGGAGGCACAGG - Intergenic
1119676164 14:76556578-76556600 TGGGAAGCTGTGGCAGGAAGAGG - Intergenic
1122245914 14:100403417-100403439 TGGGACTCCTGGGAAGGAACTGG + Intronic
1122867994 14:104617933-104617955 TGGGCATCTGTGGGAGAAGCAGG - Intergenic
1123752857 15:23372336-23372358 TGGGACTCTGTCTCAGGAAAAGG - Intergenic
1123975680 15:25552379-25552401 TGTGACTATGGGGGAGAAACTGG + Intergenic
1124322806 15:28727408-28727430 CGGGACTCTGTGGCAGGAAAAGG + Intronic
1124441281 15:29687996-29688018 TGGGACTTCCTGGGAGGAAGGGG + Intergenic
1124523725 15:30427973-30427995 CGGGACTCTGTGGCAGGAAAAGG + Intergenic
1124534942 15:30538242-30538264 CGGGACTCTGTGGCAGGAAAAGG - Intergenic
1124574380 15:30895396-30895418 CGGGACTCTGTGGCAGGAAAAGG - Intergenic
1124713182 15:32031336-32031358 TGGGACTCAGTAGCAAGAACAGG + Intronic
1124763707 15:32469359-32469381 CGGGACTCTGTGGCAGGAAAAGG + Intergenic
1124774920 15:32579692-32579714 CGGGACTCTGTGGCAGGAAAAGG - Intergenic
1124856644 15:33395831-33395853 TTGGAATCTGTGGGAGGTCCTGG - Intronic
1125198846 15:37080646-37080668 TGGGGCTCTGGGGAAGTAACTGG - Intronic
1125600671 15:40913991-40914013 TGGGCCTTTGGGGTAGGAACTGG - Intergenic
1125747312 15:42005636-42005658 TGGGACTCTGAGGGAAGAAAAGG + Intronic
1125752834 15:42041735-42041757 TGGGTCTCTTTGAGGGGAACTGG + Intronic
1126066334 15:44828899-44828921 GGGCGCTCTGGGGGAGGAACAGG - Intergenic
1126093548 15:45071967-45071989 GGGCGCTCTGGGGGAGGAACAGG + Intronic
1129168968 15:73796454-73796476 TGGGTATCTGTGGGAGGAGGGGG - Intergenic
1132362171 15:101225486-101225508 TGGGTCCTGGTGGGAGGAACTGG + Intronic
1132620709 16:866990-867012 TTGCACTTAGTGGGAGGAACAGG + Intronic
1132692269 16:1186954-1186976 TGGGAGTCAGTGGGTGGTACAGG - Intronic
1132869461 16:2109344-2109366 GGGGAAGCTGTGGGAGAAACGGG + Exonic
1132904520 16:2275622-2275644 TGGGGCTGTGTGGGAAGCACAGG - Intergenic
1132995483 16:2820356-2820378 TGGCACTCTGAGGCAGGAATTGG + Intronic
1133278940 16:4654311-4654333 GAGGACTCTGTGTCAGGAACTGG + Intronic
1133491080 16:6268815-6268837 TTGTTCTCTGTTGGAGGAACAGG - Intronic
1134717952 16:16366255-16366277 GGGGAAGCTGTGGGAGAAACGGG - Intergenic
1134956799 16:18385904-18385926 GGGGAAGCTGTGGGAGAAACGGG + Intergenic
1135096467 16:19568642-19568664 AGGAGCTCTGTGGGAGGAACTGG + Intronic
1135173024 16:20203252-20203274 TGGAGCTCAGTGGGAGGAATGGG + Intergenic
1138206857 16:55131557-55131579 TGGGTCTCAGTGGGGTGAACAGG + Intergenic
1138394265 16:56691992-56692014 TGAGACTCTGAGGGCGGAACTGG + Intronic
1139412117 16:66771522-66771544 TGGGTATCTGTGGGAGGTCCTGG + Intronic
1139549280 16:67664550-67664572 AGGGACTCAGTAGGAGGAGCAGG - Intronic
1139896165 16:70289441-70289463 GGGGACTCTGAGGGAGGAGCTGG - Exonic
1140533732 16:75690137-75690159 TGGGACACAGTTTGAGGAACTGG + Intronic
1140706106 16:77631899-77631921 AGGGACTCAGTGGGAGGTAATGG + Intergenic
1140908237 16:79428434-79428456 TGGGACTCCAAGGGAGCAACAGG - Intergenic
1141052906 16:80788535-80788557 TGGGATTCTGTGGAAAGCACAGG + Intronic
1141392311 16:83675135-83675157 TGGGCCTCTGTGTCAGGGACAGG - Intronic
1141470523 16:84235253-84235275 TGGAAATCTGTAAGAGGAACAGG + Intronic
1143364223 17:6395306-6395328 TGGGATAATGTGGGAGGACCTGG + Intronic
1145932837 17:28698272-28698294 TGTCACTCTGTGGGAGGGAGAGG - Intronic
1146314481 17:31796440-31796462 AGGGATTCTTGGGGAGGAACTGG - Intergenic
1146956838 17:36940904-36940926 TGGGCCTCTGTGGGATGGAGAGG - Intronic
1147038012 17:37696069-37696091 TGGGGCTCAGTGGGAGGTAATGG + Intronic
1147057284 17:37844345-37844367 TGAGCCTCAGTGGGTGGAACAGG + Intergenic
1147157636 17:38552230-38552252 TGGGATGCTGTGGGAGGGCCTGG + Intronic
1147181844 17:38691381-38691403 TGGGCCCCTGTGGGAGGGGCAGG + Intergenic
1147589962 17:41676345-41676367 TAGGGCTCTGTGCCAGGAACTGG - Intergenic
1148284428 17:46374971-46374993 TGGGAATCTGAGGGAGGGAGAGG + Intergenic
1148306649 17:46592892-46592914 TGGGAATCTGAGGGAGGGAGAGG + Intronic
1148437642 17:47695546-47695568 TGGGATCCTGCGGGAGGAAGTGG + Exonic
1148440241 17:47708478-47708500 GAGGACTCTGTTGCAGGAACAGG + Exonic
1148861403 17:50606181-50606203 TGGGGCACTGTGGGATGGACTGG - Intronic
1152599905 17:81257000-81257022 CGGTGCTCTGTGGAAGGAACTGG - Intronic
1152739126 17:82011400-82011422 TGGAGTGCTGTGGGAGGAACAGG + Intronic
1153926128 18:9836740-9836762 GGAGACTCAGTGTGAGGAACAGG + Intronic
1155773141 18:29725437-29725459 TGGAACTGGGTGAGAGGAACTGG - Intergenic
1156034838 18:32754662-32754684 TGAGGCTCTTTCGGAGGAACTGG + Intronic
1156858316 18:41808676-41808698 TGGGACTCAGTGGAGGCAACAGG + Intergenic
1157137044 18:45066417-45066439 TGTGATACTGAGGGAGGAACTGG - Exonic
1158264183 18:55641500-55641522 AGGGACTCGGTGGGAGGAGGCGG - Intronic
1158509710 18:58079692-58079714 GGGGAGTATGTGTGAGGAACCGG + Intronic
1160516091 18:79480002-79480024 AGGGGCACTGTGGCAGGAACAGG + Intronic
1161290478 19:3491223-3491245 TGGGACTCTGCGGGAGGCTCTGG - Exonic
1161869839 19:6861752-6861774 TGTGACTCTGGGGGAGTCACGGG - Intergenic
1162312872 19:9917581-9917603 AGGGACCCTTGGGGAGGAACTGG - Intronic
1162514431 19:11139362-11139384 TGTGGCTCTGTGGGAGGCCCAGG - Intronic
1163349000 19:16763601-16763623 TGGGACTTTCTGGGAGGAATAGG - Intronic
1163568143 19:18063983-18064005 TGGGTCTCTGTGGGCTGCACGGG + Exonic
1164590709 19:29505324-29505346 TGTGTCTCTGGGGGAGGGACAGG + Intergenic
1164821216 19:31252504-31252526 TGGGACCAGGTGGGAGTAACTGG + Intergenic
1165330889 19:35140694-35140716 TGGGACTCTGGGGGAGGGCGAGG - Intronic
1165664773 19:37618839-37618861 TTGTACTTAGTGGGAGGAACAGG - Intronic
1166234244 19:41444068-41444090 GGGGGCGCTGCGGGAGGAACTGG + Exonic
1166309799 19:41956640-41956662 TGGGTCTCTATGGGTGGAGCTGG - Intergenic
1166329523 19:42070021-42070043 TGGGCCTCAGTGGGAGGGCCTGG + Intronic
1166402564 19:42494204-42494226 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1166907321 19:46120351-46120373 TGGGGCACTGTGATAGGAACAGG - Exonic
1167129028 19:47572621-47572643 TGGGACTATGGAGGAGGAAGGGG + Intergenic
1168027610 19:53654353-53654375 TGGGACTCCTTGGGAAAAACAGG + Intergenic
925341426 2:3140565-3140587 TGGTAGTCTGTGGGTGGAAATGG - Intergenic
925731512 2:6922314-6922336 TGGGAGCCTGTGGGAGCAAAAGG + Intronic
926659705 2:15450993-15451015 TGGGACTGTTTGGGAGAAAAAGG + Intronic
928180120 2:29062840-29062862 TGGGACACAGTGGGTGAAACTGG - Exonic
928404881 2:31007069-31007091 TGGGACTCTGTGGGGGCTGCTGG + Intronic
928575822 2:32653999-32654021 TGGGACCCTTGGGGAAGAACTGG - Intronic
929554521 2:42917296-42917318 TGGGACTTTTTGGGCAGAACTGG + Intergenic
929823170 2:45289671-45289693 TGGCACTGTGTGGGAGGAAAGGG - Intergenic
930063592 2:47310843-47310865 TGGGACATGGTAGGAGGAACAGG - Intergenic
931084273 2:58811763-58811785 TGGAACTCTGTGGGTGGAAGTGG + Intergenic
932234960 2:70113422-70113444 TGAGCCTCTGTGCCAGGAACTGG - Intergenic
933531277 2:83515809-83515831 TAGAACTTTGGGGGAGGAACTGG + Intergenic
933969036 2:87455288-87455310 TGGGTCTCTCTGAGAGGATCAGG + Intergenic
935962304 2:108437740-108437762 TGGGACACAGTTGGAGGAACTGG - Intergenic
936119024 2:109725534-109725556 TGGGGCTCTGTGGGAAGTAGTGG + Intergenic
936258562 2:110937318-110937340 AGGAACTCTGTGTCAGGAACTGG + Intronic
936324755 2:111495219-111495241 TGGGTCTCTCTGAGAGGATCAGG - Intergenic
936832797 2:116669522-116669544 TGGGAGTCTGTGGGGAGCACTGG - Intergenic
937315917 2:120932035-120932057 TGGGACACTGGGGGCGGAAGAGG - Intronic
937917321 2:127105619-127105641 TAGGACTCTGAGGGAGGTATGGG + Intronic
940720909 2:157280733-157280755 TGAGACTTGGTGGGAGGTACTGG + Intronic
941639588 2:167972750-167972772 TGGGACTCCTTGGGAAAAACAGG + Intronic
942814922 2:180041819-180041841 AGGAACTCTGTGTCAGGAACTGG - Intergenic
942883986 2:180899888-180899910 TGGGACTCACTGTGAGGGACTGG - Intergenic
945026109 2:205621356-205621378 TGGGAATGTGTAGGAGGAAGGGG - Intergenic
945245368 2:207712161-207712183 GGGGACTCTGGGGGAGGAGGCGG - Intronic
945639386 2:212404368-212404390 AGGGACACTGTGGGAACAACGGG - Intronic
946148364 2:217747879-217747901 TGTGACTCTATGGTAGGAACAGG - Intronic
946168466 2:217879506-217879528 TGGGCCCCTGGGGGAGGAAAAGG + Intronic
946434490 2:219642726-219642748 TTGGTCTCCGCGGGAGGAACTGG - Intergenic
947100969 2:226620927-226620949 GGGGACTCTGTGCCATGAACAGG + Intergenic
947484520 2:230535956-230535978 TGAGACACAGTTGGAGGAACTGG + Intronic
947510379 2:230747519-230747541 TGAGACTCTGTAGAAGGAAAAGG + Intronic
948061476 2:235045777-235045799 TGTGACTCTCTGGGAGGGGCAGG - Intronic
948301872 2:236913828-236913850 TGGGTCTCTGTGGCAGGAGCTGG + Intergenic
1168892331 20:1303067-1303089 TGGGTTCCTGTGGGAGTAACAGG - Intronic
1169172181 20:3473706-3473728 TGGGACACTGTGGTAGGCAGTGG + Intronic
1169745581 20:8939278-8939300 TGGGGCTTTGTGGGAGGTAATGG - Intronic
1170595158 20:17799831-17799853 TGGGACTCTGTGCCATGGACTGG - Intergenic
1171191359 20:23161790-23161812 TGAGCCTGTGTGGGAGGAAATGG - Intergenic
1171400316 20:24868895-24868917 TGGGATTCTGCTGGAGGACCAGG - Intergenic
1171433930 20:25104644-25104666 TGGGACTCAGCAAGAGGAACCGG + Intergenic
1171484939 20:25479654-25479676 TGGTACCCTGACGGAGGAACTGG + Intronic
1172461737 20:35124028-35124050 TGAGGCTCTGTGGGAGAAAGTGG + Exonic
1172508087 20:35479055-35479077 GGGGGCTCTGTGGGCGGATCAGG + Intronic
1173210534 20:41028626-41028648 TGGGACGCCGTGGGAGGAGTCGG + Intergenic
1173247725 20:41347909-41347931 TGGGCCCCTGTGGGATGAAAAGG + Intronic
1173398141 20:42700309-42700331 TGAGGCTCAGTGGGAGGGACAGG - Intronic
1174845377 20:53938249-53938271 TGGGACTCAGGGGAAGGCACTGG - Intronic
1174895778 20:54448695-54448717 TGGGAGCATGTGGGAGGAAGAGG + Intergenic
1175381723 20:58568500-58568522 GGGCTCTCTGGGGGAGGAACGGG - Intergenic
1175917438 20:62433281-62433303 GGGGACCCTGTGTGTGGAACTGG + Intergenic
1177756923 21:25359729-25359751 TGGGGATATGTGGTAGGAACGGG - Intergenic
1178259653 21:31087185-31087207 TTGGACTCAGTGGTAGCAACAGG - Intergenic
1178395867 21:32242766-32242788 TGGGACTCTGATGGATGGACAGG + Intergenic
1179902890 21:44402972-44402994 TGGGGCCCTGGGGGAGGCACCGG + Intronic
1180184473 21:46132677-46132699 GGGGACCCCGTGGGAGGAGCTGG - Exonic
1180215561 21:46321797-46321819 TTGCACTCTTTGGGAGGAAGTGG + Intronic
1181637502 22:24181261-24181283 TGGGACCCTGTGGGAGGGTGAGG - Exonic
1183160570 22:36110432-36110454 TGGGACCCTGGAGGAGGAAGGGG + Intergenic
1183184848 22:36285947-36285969 TGGGTCTTTGTGGCAGGAACTGG - Exonic
1183361399 22:37385004-37385026 TGGGACCCTGGGGGAGGAGCAGG - Intronic
1184267982 22:43360168-43360190 TGGGATTTTGTGGGATGAGCAGG + Intergenic
1185060585 22:48604463-48604485 AGGGACTTTGTGGGAAGACCTGG + Intronic
1185269797 22:49924114-49924136 TGGAACTCTTTGGGAGAAACTGG - Intronic
1185370426 22:50458451-50458473 AGGGACTCTGTGGGAAGCACAGG + Intronic
949556560 3:5158338-5158360 TGGTATTCAGTGGAAGGAACAGG + Intronic
949894739 3:8760717-8760739 TGGGAATCCGTGGAAGAAACTGG + Intronic
950205055 3:11073619-11073641 TGGGACACAGTTGGAGTAACTGG + Intergenic
950523296 3:13509009-13509031 TGGGCCTCTGCAGGTGGAACAGG - Intergenic
952920781 3:38282490-38282512 GGGGAATCTGTGGAAGGAGCGGG + Intronic
953277394 3:41515742-41515764 TGGGACTAGGTGGAAGTAACTGG - Intronic
953617885 3:44508332-44508354 TGGGGCCCTATGGGAAGAACTGG - Intronic
953802864 3:46041222-46041244 TGGGACACAGTTGGAGGAATTGG + Intergenic
953877439 3:46674287-46674309 GGGGACTCTGGGAGAGGAGCTGG + Intronic
953982506 3:47419720-47419742 GGGTACTCAGTGGGAGGAATGGG + Intronic
954376222 3:50195429-50195451 TGGGATACTGTGGGAGGTATGGG - Exonic
957991528 3:87633419-87633441 TGTGACTCTGAGGCAGAAACTGG - Intergenic
958482846 3:94666199-94666221 TGGGACTCTTTGGGAAGGACAGG - Intergenic
959730192 3:109592261-109592283 TGTGACTCTATGGATGGAACTGG + Intergenic
961572910 3:127813274-127813296 GGAGAAACTGTGGGAGGAACAGG - Intronic
961595805 3:128015332-128015354 TGGGACTCCTTGGGAAAAACAGG + Intergenic
961804817 3:129481856-129481878 TGTGCCTGTGTGGGAGGAGCAGG - Intronic
962680995 3:137800283-137800305 TGGGGCTCTGTGTCAGGAACTGG + Intergenic
963046226 3:141104548-141104570 TGGAAGTCTGTGGGAGGAGATGG + Intronic
963059424 3:141212839-141212861 GAGGCCTCTGTGGGAGGAGCTGG + Intergenic
963698614 3:148595706-148595728 TTGGAATCTGTGGGAGGTCCTGG - Intergenic
965321864 3:167261346-167261368 TGGTAGTATGGGGGAGGAACTGG + Intronic
967290513 3:187915237-187915259 TGGCACTCAGAGGAAGGAACAGG - Intergenic
967577007 3:191106391-191106413 TGGGACTTAGTGGGAGGTGCTGG + Intergenic
967844681 3:194034364-194034386 TGGGACTCTGAGGGTGGGCCCGG - Intergenic
967844943 3:194035815-194035837 AGAGACCCTGTGGGAGGAACAGG + Intergenic
967965652 3:194958140-194958162 TGGGACTGTGTGGAGGGACCTGG - Intergenic
968654264 4:1771845-1771867 TGGGCCTCTGTGGGCTGAGCTGG - Intergenic
968848855 4:3063918-3063940 AGGAGCTCTGTGGCAGGAACTGG - Intergenic
969252294 4:5976072-5976094 GGGGACTCAGTGCCAGGAACAGG + Intronic
970043762 4:11826431-11826453 TGGGACAATATGGAAGGAACTGG - Intergenic
971179992 4:24320988-24321010 TGGGACTCGGTGAGAGAAAACGG - Intergenic
972702479 4:41507582-41507604 AGGGACTCTGTGCCAGGAGCTGG + Intronic
974297377 4:60019156-60019178 TGGGACTCTATGGGAGAATCGGG + Intergenic
974610123 4:64206114-64206136 TGGCTCTCATTGGGAGGAACGGG + Intergenic
976735275 4:88302665-88302687 AGGTACTCTGTGACAGGAACTGG - Intergenic
978581202 4:110232858-110232880 TGGGATTCTGTTGGAGAACCAGG + Intergenic
978725917 4:111969136-111969158 TGGTTGTCTGTGGGATGAACTGG + Intergenic
981106840 4:140891426-140891448 AGGACCACTGTGGGAGGAACTGG + Intronic
981288858 4:143050806-143050828 TGGGAGTCTGAGAGAGGAAGAGG - Intergenic
984905183 4:184619885-184619907 GGGAACTCTGTGCCAGGAACAGG - Intergenic
985722138 5:1494959-1494981 TCGGAGTCTGTGTGAGGCACAGG + Intronic
989575671 5:42985915-42985937 TGGGACTTGGTGGGAGATACAGG + Intergenic
991044844 5:62211712-62211734 AGGGATACTGTGGGAGGAAGGGG - Intergenic
991917050 5:71615725-71615747 AGGAACTCTGTCGGAGGAACTGG - Intronic
992758349 5:79930225-79930247 AGGAAGTCTGTGGGAGGAACTGG + Intergenic
994035691 5:95197801-95197823 TTGGTATCTGTGGGAGGAACTGG - Intronic
994420234 5:99522510-99522532 TGGGAATATGTGGCAGGAAGGGG + Intergenic
996216047 5:120867581-120867603 TGGGACTCTTTGCAAGGAAGAGG - Intergenic
997109205 5:131056279-131056301 AGGGACTCAGTGGGAGGTAATGG - Intergenic
999234931 5:150084876-150084898 TGGGACTCTCTGAGATGAAGGGG + Intronic
999243938 5:150143518-150143540 TGGGAGTCTGTGGGGGCAAGAGG + Intronic
999772891 5:154788637-154788659 TGGGTTTCTGGGGGAGGAAGGGG + Intronic
1000812012 5:165874750-165874772 GGGAACACTGTGGGAGGAACAGG + Intergenic
1002617286 5:180463858-180463880 TGGGCCTGGGTGGGAGGAGCTGG - Intergenic
1003085098 6:3054286-3054308 TGGGACTCTGTGCGGGGAGGAGG + Intergenic
1003411861 6:5871974-5871996 TGAGAAGCTGTGGAAGGAACTGG - Intergenic
1004235773 6:13873533-13873555 TGGGACTTCGTGGGAGGGACGGG - Intergenic
1005818614 6:29578356-29578378 AGGAACTCTGTGCCAGGAACTGG - Intronic
1006080212 6:31560699-31560721 TGGGATTCAATTGGAGGAACAGG + Intergenic
1006452566 6:34113591-34113613 TGGGACTCGGAGGGAGGATGGGG + Intronic
1006719106 6:36138716-36138738 TGGGGGTCTGTGGCAGGGACTGG - Exonic
1006836455 6:37001896-37001918 TGGGACTCTGGAGGACGGACAGG + Intergenic
1007052323 6:38844797-38844819 AGAGACTCTCTGGGAGGAAGAGG - Intronic
1007308140 6:40923257-40923279 TGGGGCTTTGTGGGAGACACTGG - Intergenic
1007632249 6:43278993-43279015 TGGGACTGAGTGGGAGACACTGG + Intronic
1008009056 6:46444536-46444558 TGGGACTTTGTGGGCTGACCTGG - Intronic
1008493446 6:52109204-52109226 TAGGACTCAGTGGAAGGAAGAGG + Intergenic
1008568275 6:52790603-52790625 TGGGACTCTGTGGAGGGCAGAGG + Intergenic
1008877449 6:56345054-56345076 TGGACCTCTGTGGGATGCACAGG + Intronic
1010023807 6:71192835-71192857 TGGAGCTCTGTGTCAGGAACTGG - Intergenic
1012131630 6:95500380-95500402 AGAAACTCTGTGGGAGGAGCAGG + Intergenic
1012841603 6:104335422-104335444 TGGGCCTCTGTGTCAGGAGCAGG - Intergenic
1013338527 6:109190575-109190597 AGGGACTCGGTGGGAGGTAATGG + Intergenic
1015377524 6:132527684-132527706 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1015735322 6:136393363-136393385 TGGAACTGTGTGGGGGGAAGGGG + Intronic
1019330379 7:457971-457993 TGGGAGTCTGCGGGAGGACAAGG - Intergenic
1019336631 7:485886-485908 GGGGACGCTGTGGGAGGGAGGGG + Intergenic
1022125226 7:27349780-27349802 TGGAACTCAGGAGGAGGAACAGG - Intergenic
1022473001 7:30693167-30693189 AGGGATTCTGTGTCAGGAACTGG - Intronic
1022511162 7:30935627-30935649 TGGTACCCTCTGGGAGGACCTGG - Intergenic
1024111716 7:46154031-46154053 TGTGACACTGTGGAAGGAGCGGG - Intergenic
1029811058 7:103049652-103049674 TGGGACTCCTTGGGAAAAACAGG - Intronic
1032177227 7:129640679-129640701 TGGGACTCTGATGGAGCAGCTGG + Intronic
1033118337 7:138645736-138645758 TGTGCCTCTCTGGGTGGAACAGG + Intronic
1035031354 7:155863137-155863159 CAGGCCTCTGTGGGAGGAACAGG - Intergenic
1037014184 8:13881963-13881985 TGGGTCACTGTGGTAGAAACAGG + Intergenic
1038007287 8:23443055-23443077 TGGGGCTCTGAGGGAGGGGCAGG - Intronic
1038473769 8:27847072-27847094 TGCTCCTCTGTGGCAGGAACAGG + Intergenic
1039384639 8:37123494-37123516 TGGTACTCTGGGTGAGAAACTGG + Intergenic
1039574509 8:38612628-38612650 TGGGAGGCTGTGGCAAGAACAGG - Intergenic
1040288650 8:46113168-46113190 TGGGACTCAGGGGGATGAGCGGG - Intergenic
1041177009 8:55207283-55207305 TGTCCCACTGTGGGAGGAACAGG - Intronic
1041241694 8:55853837-55853859 TGGAAGTCTCTTGGAGGAACTGG + Intergenic
1043395217 8:79828867-79828889 TGGGAGTCTGAGGGAGGTGCGGG - Intergenic
1043867848 8:85395940-85395962 AGGCACTCTCTGTGAGGAACAGG - Intronic
1045266020 8:100619208-100619230 AGGAACTCTGTGCCAGGAACTGG + Intronic
1047670799 8:127143907-127143929 TGAGACACAGTTGGAGGAACTGG - Intergenic
1048354374 8:133641385-133641407 TTGGCCTCTGTGGGAAGAGCAGG + Intergenic
1049214976 8:141403335-141403357 TGGGATTCTGGGGGAGGCTCTGG + Intronic
1049489338 8:142885889-142885911 TGGGACCTGGTGGGAGGTACTGG + Intronic
1051194352 9:14547024-14547046 GGGGACTCTGTGTGGGGAATAGG + Intergenic
1051294738 9:15583616-15583638 GGGGACTCTGTGGAAAGGACGGG + Intronic
1055459554 9:76505353-76505375 TGGGAGTCTGTTGGAGCAAGAGG + Exonic
1057095224 9:92300963-92300985 TGGAACCCTGGGTGAGGAACAGG + Intronic
1058355754 9:104081966-104081988 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1058672143 9:107368689-107368711 AGGAACTCTGTGTCAGGAACTGG - Intergenic
1058849533 9:108997639-108997661 AGGAACTCTGAGGGAGGAGCAGG - Intronic
1058878942 9:109269886-109269908 TATGACTGTGTGGGAGGAAGGGG + Intronic
1059624048 9:116041812-116041834 TGGAACTCTGAGGGAGTAATCGG - Intergenic
1060552747 9:124493213-124493235 TGGGTCTCAGTGGGAGGAGAAGG - Intronic
1061264704 9:129498162-129498184 TGAGACAGTGTGGGAGGTACAGG + Intergenic
1061287409 9:129631937-129631959 GGGGACTCTGTGCCAGGCACCGG - Intronic
1187287248 X:17917336-17917358 TGGGGCTCTGAGGGAGGCAGTGG + Intergenic
1187435581 X:19265983-19266005 TGGGACTCTGAAGGAAGAATAGG - Intergenic
1188839415 X:34997173-34997195 TTGTACTTGGTGGGAGGAACAGG + Intergenic
1188858715 X:35230359-35230381 TGGGACACAGTTGGAGGAACTGG + Intergenic
1189637894 X:43031783-43031805 AGGGGCTCTGTGTCAGGAACTGG - Intergenic
1189872396 X:45397655-45397677 TGTGACACTGTGGAAGGAAGAGG + Intergenic
1191617244 X:63182421-63182443 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1191619054 X:63196502-63196524 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1191938634 X:66453771-66453793 GGAGACTCTTTGGGAGGAAGCGG - Intergenic
1193023647 X:76821105-76821127 TGGGCCTCTGTGGGCAGACCCGG + Intergenic
1193997576 X:88385003-88385025 TGGGGCTCTGTAGGAAGAGCCGG - Intergenic
1194131474 X:90087737-90087759 TGGGACTCCATGGGAAAAACAGG - Intergenic
1196463582 X:115952114-115952136 TGGGTCTCTGAGGGAGAATCGGG - Intergenic
1197761374 X:130030702-130030724 TGAGTGTCTGGGGGAGGAACAGG - Intronic
1201603871 Y:15763819-15763841 TGGGACTTGGTGACAGGAACAGG - Intergenic