ID: 1104965682

View in Genome Browser
Species Human (GRCh38)
Location 12:132507919-132507941
Sequence CCCTTCGATGGCTGAGCCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 152}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104965676_1104965682 7 Left 1104965676 12:132507889-132507911 CCTGCTGGACTAAGCTTTTTCTC 0: 1
1: 0
2: 1
3: 16
4: 258
Right 1104965682 12:132507919-132507941 CCCTTCGATGGCTGAGCCCTGGG 0: 1
1: 0
2: 0
3: 14
4: 152
1104965673_1104965682 30 Left 1104965673 12:132507866-132507888 CCTGTGAAGCTTACTGGAGACTC 0: 1
1: 0
2: 1
3: 26
4: 172
Right 1104965682 12:132507919-132507941 CCCTTCGATGGCTGAGCCCTGGG 0: 1
1: 0
2: 0
3: 14
4: 152
1104965675_1104965682 8 Left 1104965675 12:132507888-132507910 CCCTGCTGGACTAAGCTTTTTCT 0: 1
1: 0
2: 0
3: 40
4: 422
Right 1104965682 12:132507919-132507941 CCCTTCGATGGCTGAGCCCTGGG 0: 1
1: 0
2: 0
3: 14
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104965682 Original CRISPR CCCTTCGATGGCTGAGCCCT GGG Intronic
900590627 1:3457894-3457916 ACCTCCCATGGCTGAGCCCTGGG - Intronic
901094591 1:6667964-6667986 CCATCCGATGGCTCAGGCCTGGG + Intronic
901640672 1:10691517-10691539 CCCTTCGAGGCCTGCGCCCCTGG + Intronic
903377582 1:22876438-22876460 CCCTTCCTTGGCTGAGACTTGGG - Intronic
904117802 1:28175331-28175353 CCCTTAGATGACTGGGTCCTGGG - Intronic
905225291 1:36474764-36474786 CCCTCAGATGGCTGAGGACTTGG + Intronic
907185613 1:52606978-52607000 CCCTTAGCTGGCTGAGGCCATGG + Intronic
907252938 1:53155107-53155129 CCCTTCTCTGGCTGATCCCAGGG - Intergenic
911370833 1:96993100-96993122 CTCTTCCAGGGCTCAGCCCTTGG - Intergenic
913453682 1:119009236-119009258 CCCTTTGATAGCTTGGCCCTTGG - Intergenic
915691782 1:157697544-157697566 CCCTCCCATGGCTGAGCCATAGG + Intronic
916648818 1:166816499-166816521 CCCTGCTCTGGCTGAGCCCTGGG + Intergenic
920269577 1:204752659-204752681 CCCTGCTCTGGCTGAGCCCAGGG - Intergenic
921902350 1:220463634-220463656 CCCTACTCTGGCTGAGCCCAGGG - Intergenic
922764493 1:228150118-228150140 CCCTCCTATGGCTGGGCCCTAGG - Intronic
922861329 1:228818823-228818845 CCCTGCTCTGGCTGAGCCCAGGG - Intergenic
1067577889 10:47419475-47419497 CCCTGGCCTGGCTGAGCCCTAGG + Intergenic
1068954252 10:62806968-62806990 CCCTAAAATGACTGAGCCCTGGG + Exonic
1069732051 10:70623169-70623191 CCCCACTCTGGCTGAGCCCTGGG - Intergenic
1073260717 10:102188431-102188453 CCCTGCTGTGGCTGAGCCCAGGG + Intergenic
1074357604 10:112799848-112799870 CCCTGCTGTGGCTAAGCCCTGGG - Intronic
1077232048 11:1462165-1462187 CCCTCTGAGGGCTGCGCCCTGGG - Intronic
1077375023 11:2201705-2201727 CCCTACCATGGCTAAGCCCCAGG - Intergenic
1081691855 11:45083659-45083681 CCCTCTGCTGGCTGAGCCCGGGG - Intergenic
1083334931 11:61916970-61916992 CCCTTCGCTGGATGAACTCTTGG - Intronic
1089505759 11:118961158-118961180 CCCTGCTCTGGCTGAGCCCAGGG + Intergenic
1090236104 11:125148558-125148580 TCATTTGAAGGCTGAGCCCTTGG + Intergenic
1090780316 11:130001999-130002021 GCCATCGATGGCTGGGCCCCCGG - Intronic
1092447078 12:8567898-8567920 CCCTTCTCTGGCTGAGCCCAGGG + Intergenic
1094144496 12:27214384-27214406 CCCTGCTCTGGCTGAGCCCAGGG - Intergenic
1096602167 12:52737070-52737092 CCCTGCTCTGGCTGTGCCCTGGG + Intergenic
1097709512 12:62902607-62902629 CCCCTTGTTGGCTGAGGCCTTGG + Intronic
1102229187 12:111250578-111250600 GCCTTCGGAGGCTGAGCCTTGGG + Intronic
1104965682 12:132507919-132507941 CCCTTCGATGGCTGAGCCCTGGG + Intronic
1106125207 13:26895518-26895540 CCCTTCCTCGCCTGAGCCCTGGG - Intergenic
1106572041 13:30935445-30935467 CCCTGCTCTGGCTGAGCCCAGGG - Intronic
1112740899 13:102472127-102472149 CCCTGCTCTGGCTGAGCCCAGGG + Intergenic
1113339170 13:109404883-109404905 CCCTGCTCTGGCTGAGCCCAGGG - Intergenic
1113664471 13:112131749-112131771 GCCCTTGAAGGCTGAGCCCTGGG + Intergenic
1113741875 13:112716712-112716734 CCCGTCACTGGCTGAGACCTGGG - Intronic
1117684336 14:58238044-58238066 TCCATCGATGGGTGAGTCCTTGG - Intronic
1118921125 14:70150867-70150889 CTTTTCGATGGCTGAACTCTAGG - Intronic
1119618208 14:76112318-76112340 CCCTGCTCTGGCTGAGCCCAGGG - Intergenic
1119724447 14:76913709-76913731 CCCCACACTGGCTGAGCCCTCGG - Intergenic
1120745520 14:88147575-88147597 CCCTACTCTGGCTGAGCCCTGGG - Intergenic
1122955738 14:105070066-105070088 CCCTTCCCTGGCTGAGACCTGGG - Intergenic
1122970986 14:105152117-105152139 CACTTCGATGGCAGAGCATTAGG + Intronic
1123946473 15:25241216-25241238 TCCTTCGTTGGCTGTGACCTGGG + Intergenic
1124937602 15:34187001-34187023 CCCTGCTGTGGCTGAGCCCAGGG - Intronic
1125238869 15:37550303-37550325 CCCTGCTCTGGCTGAGCCCAGGG + Intergenic
1128765010 15:70246092-70246114 CCCTGTGAGGGCTGGGCCCTGGG - Intergenic
1128790682 15:70431675-70431697 CCCTGCTCTGGCTGAGCCCAGGG + Intergenic
1129045291 15:72728781-72728803 CCCTTGGATACCTGGGCCCTGGG - Intronic
1129274259 15:74434720-74434742 GCCTGAGATAGCTGAGCCCTAGG - Intergenic
1132959397 16:2613566-2613588 TCCTTCTGAGGCTGAGCCCTAGG + Intergenic
1132971713 16:2692544-2692566 CCCTGCTCTGGCTGAGCCCAGGG + Intronic
1132972458 16:2695541-2695563 TCCTTCTGAGGCTGAGCCCTAGG + Intronic
1137238234 16:46633269-46633291 CCCTACTCTGGCTGAGCCCAGGG + Intergenic
1137256413 16:46778563-46778585 CCCTGCTCTGGCTGAGCCCAGGG - Intronic
1140479061 16:75252780-75252802 CGCTGCGTAGGCTGAGCCCTGGG - Intronic
1142228281 16:88887969-88887991 CCCCTCTATGGCAGAGCCCACGG - Intronic
1144665087 17:17096931-17096953 CCCTGCGATGGCTGGCCCCTTGG - Intronic
1146761525 17:35482932-35482954 CCCTGCTCTGGCTGAGCCCAGGG - Intronic
1147202964 17:38815997-38816019 CCCCTAGATGGCTGAGACCAGGG - Intronic
1147585578 17:41652511-41652533 GCTTTCTTTGGCTGAGCCCTGGG - Intergenic
1148135740 17:45290536-45290558 GCCTTCCTTGGCTGTGCCCTTGG + Exonic
1149482903 17:57017989-57018011 CCCTGCTCTGGCTGAGCCCCGGG + Intergenic
1151426113 17:74032166-74032188 CCCTCCCAGGGCTGAGCCCCAGG + Intergenic
1152395808 17:80032308-80032330 CCCTTCTGTTGCTGAGCCTTGGG - Intronic
1152709621 17:81864574-81864596 CCCTTCGAGGAGTGTGCCCTTGG + Intergenic
1155120678 18:22816307-22816329 CCCTGCTCTGGCTGAGCCCAGGG + Intronic
1156950134 18:42885890-42885912 CACTTCTATGGCTAGGCCCTTGG - Intronic
1158773861 18:60553355-60553377 CCCTGCTCTGGCTGAGCCCAGGG - Intergenic
1160043416 18:75365730-75365752 CCCTGAGATGGCTGAATCCTGGG + Intergenic
1161127697 19:2567886-2567908 CCCTTCCATGCCTGAGCGCGTGG - Intronic
1162057127 19:8071489-8071511 CCCTTCCCTGTCTGAGCCTTGGG - Intronic
1162231632 19:9271223-9271245 CCCTGCTCTGGCTGAGCCCGGGG - Intergenic
1165936992 19:39395435-39395457 TCCTGCCATGGCTGCGCCCTTGG - Intronic
925361346 2:3282658-3282680 CACTTCAATGGCTGTTCCCTGGG - Intronic
931239209 2:60437628-60437650 TCCTTTGAAGGGTGAGCCCTGGG - Intergenic
932485340 2:72081107-72081129 CCCTTCTCTGACTGAGCCCCAGG - Intergenic
934035900 2:88088301-88088323 CCCTTCCATTTCTGAGCCCAGGG + Intronic
935714586 2:105928799-105928821 TCCTGCGGTGGCTGTGCCCTTGG + Intergenic
937849781 2:126621797-126621819 CCCTAATATGGCTGAGCCCAGGG + Intergenic
938194873 2:129318803-129318825 CCTTGCGCTGGCTGAGCCCAGGG + Intergenic
942104023 2:172614418-172614440 CCCTGCTCTGGCTGAGCCCAGGG - Intergenic
943526299 2:189021003-189021025 CCCTGCTCTGGCTGAGCCCAGGG - Intergenic
944586682 2:201179044-201179066 CCCTGCTCTGGCTGAGCCCAGGG - Intergenic
947075206 2:226335487-226335509 CCCCTCGATTGCTGTGCTCTAGG - Intergenic
948835718 2:240625117-240625139 CCCTGGGAGGGCTGGGCCCTGGG + Intronic
1170607347 20:17883912-17883934 CCCCTGGAAGGCTGAGCCCTAGG + Intergenic
1170796142 20:19548596-19548618 TCCTTTGATGGCTGACACCTTGG - Intronic
1172676714 20:36677474-36677496 CCCTGCGCTGGCTGAGCCCAAGG - Intronic
1173132513 20:40408092-40408114 CCCTGGGAATGCTGAGCCCTGGG + Intergenic
1173893861 20:46534658-46534680 CCCTGCTCTGGCTGAGCCCAGGG - Intergenic
1175990363 20:62785537-62785559 CCCTGCGCTGGGTGGGCCCTGGG + Intergenic
1179452903 21:41477820-41477842 CCCTTTGATGCCTGAGTTCTTGG - Intronic
1179607482 21:42526597-42526619 CCTGCCGGTGGCTGAGCCCTGGG + Intronic
1180077006 21:45468072-45468094 CCGTTGGGTGGCTGAGCCCAGGG + Intronic
1180145363 21:45915698-45915720 CCCTTTGAGAGCTGGGCCCTGGG + Intronic
1181404509 22:22673203-22673225 TCCTTTGGGGGCTGAGCCCTGGG - Intergenic
1181413101 22:22738766-22738788 TCCTTTGGGGGCTGAGCCCTGGG - Intronic
1181421132 22:22799774-22799796 CCCTTCCATGCCTGCCCCCTCGG - Intronic
1182554335 22:31120918-31120940 GCCCTAGATGGCTGAGCCTTAGG + Intergenic
1184098367 22:42328825-42328847 CCCTTCCCTGGCTAAGACCTGGG - Intronic
1185270444 22:49927117-49927139 CCCTTGGATGGCTGCGTCCGGGG + Intronic
950485039 3:13268158-13268180 CCCTCCTCTGGCTGAGCTCTTGG - Intergenic
952269355 3:31817047-31817069 CCCTGCTCTGGCTGAGCCCAGGG + Intronic
953805718 3:46065775-46065797 CACTTAGAGGACTGAGCCCTGGG + Intergenic
957705165 3:83770619-83770641 CCCTGTTTTGGCTGAGCCCTGGG - Intergenic
959354063 3:105303404-105303426 CCCTTGGATGTCAGAACCCTGGG - Intergenic
959531653 3:107440453-107440475 TCCTTCAAGGACTGAGCCCTGGG + Intergenic
961390686 3:126550744-126550766 CCCTGCTGTGGCTGGGCCCTGGG + Intronic
962534776 3:136317864-136317886 CTCTTCCATGGCTGTGCTCTGGG + Intronic
967283804 3:187849497-187849519 CACTTGGATGGCTGAGCTGTGGG + Intergenic
967621694 3:191642050-191642072 CCCTTCTCTGACTGAGCGCTTGG + Intergenic
967937301 3:194739225-194739247 CCCTTCTATAGTTAAGCCCTAGG - Intergenic
969517419 4:7655347-7655369 CCCTTCCAGCCCTGAGCCCTCGG - Intronic
970522066 4:16895336-16895358 TCCTTCCATGGCTGATCCCAGGG - Intronic
975913695 4:79298000-79298022 CTCTGCTCTGGCTGAGCCCTGGG - Intronic
976815821 4:89148103-89148125 CCCTGCTCTGGCTGAGCCCAGGG + Intergenic
990322170 5:54640695-54640717 CCCTTCTATTGAAGAGCCCTAGG - Intergenic
991585648 5:68199078-68199100 CCCTCTGATGTCTGAGCTCTAGG - Intergenic
999859934 5:155633926-155633948 CCCTGCTCTGGCTGAGCCCAGGG - Intergenic
1001228184 5:169963557-169963579 CCCTGTGATGGCTGGTCCCTGGG - Intronic
1002523383 5:179803401-179803423 CCCAGCAATGGGTGAGCCCTGGG - Intronic
1002564401 5:180101661-180101683 GACTTCGAGGGCTGAGCCCCAGG - Intronic
1002818265 6:698444-698466 CCCTGTGAGGTCTGAGCCCTTGG - Intergenic
1005043461 6:21620370-21620392 CCCTGCTCTGGCTGAACCCTGGG + Intergenic
1006500949 6:34458338-34458360 CCCTGCTCTGGCTGAGCCCAGGG - Intergenic
1006753773 6:36396724-36396746 CCCTGCTCTGGCTGAGCCCAAGG - Intronic
1007340991 6:41191559-41191581 CCCTGGGGTGGCTGAGACCTTGG - Exonic
1015455631 6:133424184-133424206 CCCTGCTCTGGCTGAGCCCAGGG + Intronic
1016200026 6:141395195-141395217 CCCTGCTTTGGCTGAGCCCGGGG - Intergenic
1018962682 6:168459553-168459575 CCCTGGGGTGGGTGAGCCCTGGG + Intronic
1018962688 6:168459569-168459591 CCCTGGGGTGGATGAGCCCTGGG + Intronic
1018962731 6:168459679-168459701 CCCTGGGGTGGGTGAGCCCTGGG + Intronic
1019266067 7:118081-118103 CCATTTCTTGGCTGAGCCCTGGG - Intergenic
1019339217 7:500650-500672 CCCTGCTATGGCTGGGCCCTGGG - Intronic
1019460292 7:1154572-1154594 CCCTGCTGTGGCTGTGCCCTGGG - Intronic
1019615160 7:1956139-1956161 TCCTTCAATGGCACAGCCCTGGG + Intronic
1020225126 7:6273439-6273461 CCCTTTGAGAGCTGAGCCCCAGG - Intergenic
1022113046 7:27243161-27243183 CCCGTGGTTGCCTGAGCCCTCGG + Exonic
1023789144 7:43737870-43737892 CCCTGCTCTGGCTGAGCCCAGGG - Intergenic
1023790424 7:43749590-43749612 CCCTCCTCTGGCTGAGCCCAGGG + Intergenic
1024227275 7:47335558-47335580 GCCCTGGGTGGCTGAGCCCTGGG - Intronic
1024574689 7:50754235-50754257 CCCTTCCATGCCTGAGACCCAGG - Intronic
1026359593 7:69591414-69591436 CCCTGCTCTGGCTGAGCCCAGGG + Intergenic
1027333708 7:77126739-77126761 CCCTGCTCTGGCTGAGCCCAGGG + Intronic
1035239846 7:157522345-157522367 CCCCTCCATGGCTGCTCCCTGGG - Intergenic
1035434533 7:158849790-158849812 CCCTGCTCTGGCTGAGCCCAGGG + Intergenic
1035546109 8:483545-483567 TCCTTCCATGGCTGAGCACTGGG - Intergenic
1044008671 8:86966014-86966036 CCCTTCTCTGGCTGAGCCCAGGG + Intronic
1056381893 9:86063317-86063339 CCCTCAGGTGGCTCAGCCCTGGG - Intronic
1056518720 9:87380389-87380411 CCCTTCTATGCCTCATCCCTGGG - Intergenic
1060055220 9:120407290-120407312 TCCTTCGATGGCTGACCCTTTGG - Intronic
1060147653 9:121266616-121266638 CTCTTCTATGCCTGAGTCCTTGG - Intronic
1060447773 9:123707422-123707444 CCCTTCCAGGGCTCAGTCCTTGG - Intronic
1061927250 9:133812005-133812027 CCCTTCGGTGGCTCAGACATGGG + Intronic
1189125162 X:38437983-38438005 TCCTGAGATGTCTGAGCCCTTGG - Intronic
1190054965 X:47175988-47176010 CCCATGGATGGCTGGGTCCTGGG - Intronic
1192181377 X:68917893-68917915 CCCTGCCTGGGCTGAGCCCTGGG + Intergenic
1193919349 X:87406782-87406804 CCCTGCTCTGGCTGAGCCCAGGG + Intergenic
1194205039 X:91002554-91002576 CCCTGCTCTGGCTGAGCCCAGGG + Intergenic
1198026379 X:132711654-132711676 CTCTTCGAAGGCTGTGCTCTGGG - Intronic
1198750138 X:139931509-139931531 CCGCCCGCTGGCTGAGCCCTAGG + Intronic
1200550865 Y:4577697-4577719 CCCTGCTCTGGCTGAGCCCAGGG + Intergenic