ID: 1104967158

View in Genome Browser
Species Human (GRCh38)
Location 12:132513535-132513557
Sequence AGAGGTGACCAGAGGGCTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 489
Summary {0: 1, 1: 0, 2: 6, 3: 43, 4: 439}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104967158_1104967167 9 Left 1104967158 12:132513535-132513557 CCATCAGCCCTCTGGTCACCTCT 0: 1
1: 0
2: 6
3: 43
4: 439
Right 1104967167 12:132513567-132513589 TCTGCCCACCTTGTTGTTGTTGG 0: 1
1: 0
2: 1
3: 10
4: 137
1104967158_1104967172 19 Left 1104967158 12:132513535-132513557 CCATCAGCCCTCTGGTCACCTCT 0: 1
1: 0
2: 6
3: 43
4: 439
Right 1104967172 12:132513577-132513599 TTGTTGTTGTTGGCACAGGCAGG 0: 1
1: 0
2: 4
3: 57
4: 377
1104967158_1104967173 23 Left 1104967158 12:132513535-132513557 CCATCAGCCCTCTGGTCACCTCT 0: 1
1: 0
2: 6
3: 43
4: 439
Right 1104967173 12:132513581-132513603 TGTTGTTGGCACAGGCAGGCTGG 0: 1
1: 0
2: 1
3: 26
4: 259
1104967158_1104967170 15 Left 1104967158 12:132513535-132513557 CCATCAGCCCTCTGGTCACCTCT 0: 1
1: 0
2: 6
3: 43
4: 439
Right 1104967170 12:132513573-132513595 CACCTTGTTGTTGTTGGCACAGG 0: 1
1: 0
2: 0
3: 7
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104967158 Original CRISPR AGAGGTGACCAGAGGGCTGA TGG (reversed) Intronic
900823073 1:4905053-4905075 AGAGGTCAAGAGAGGGGTGAGGG - Intergenic
902978349 1:20105629-20105651 AGAGCAGCCCAGAGGGCTGCTGG - Intergenic
903226388 1:21896292-21896314 ACAGGTGACCCATGGGCTGAGGG - Exonic
904432831 1:30476193-30476215 ACAAGTGACCAGAGCGCTGTGGG - Intergenic
904484656 1:30816678-30816700 AAAGGTGACCAGAGGAGGGAAGG - Intergenic
904488860 1:30845815-30845837 AGAGCTGCCCGGAGGGCTGCTGG - Intergenic
904588900 1:31596641-31596663 AGAGGTCACCAGAACTCTGAAGG + Intergenic
905004599 1:34699534-34699556 AGTGGAGACCAGAGTGCAGAGGG + Intergenic
906724011 1:48030504-48030526 AGAGGTGGGCAGGGGGCAGAGGG - Intergenic
908542852 1:65137956-65137978 AGATCTGATGAGAGGGCTGAAGG - Intergenic
909023717 1:70460408-70460430 AGCTGTGAGAAGAGGGCTGAAGG + Intergenic
909882099 1:80892459-80892481 AGAGGTGACCAAAGGGTCAAAGG + Intergenic
912285585 1:108365131-108365153 AGTGGTGACAAAAAGGCTGAAGG - Intergenic
912342980 1:108935916-108935938 AGAGGTGACCAGAGAGGTAGTGG + Intronic
912418612 1:109528782-109528804 AGAGGTGTACAAAGGGCAGAAGG - Intergenic
912752962 1:112300710-112300732 AGAGGAGAAAAGAGGGTTGAAGG + Intergenic
913094940 1:115507464-115507486 AGAGGGAAGAAGAGGGCTGAGGG - Intergenic
913471452 1:119191483-119191505 AGAAGAGACCCGAGGGCTGCTGG + Intergenic
914412250 1:147441603-147441625 AGAGGTTACCAGGGGCTTGAAGG - Intergenic
914676943 1:149913089-149913111 AGATGTTCCCAGAGGGCTCAGGG - Intronic
915311748 1:155008751-155008773 AGGGGTTACCGGAGGGCTGGCGG - Intronic
915580836 1:156812351-156812373 AGATGAGATCAGAGGGGTGAGGG - Intronic
915608914 1:156974677-156974699 AGTGGTTGCCAGAGGGTTGAAGG - Intronic
915773687 1:158458500-158458522 AGAATTGACCACAGGGCTGGAGG + Intergenic
916056453 1:161071996-161072018 AGAGGCCACCAGAGGGCAGAGGG + Exonic
918471644 1:184881624-184881646 AGAGCAGCCCAGAGGGCTGCTGG + Intronic
918645478 1:186899346-186899368 AGAGGTGAAGACAGGGCTGGGGG + Intronic
920147947 1:203878945-203878967 ACAGGAGAAAAGAGGGCTGAAGG - Intergenic
920689232 1:208133054-208133076 AGAGGAGATGAGAGGTCTGAGGG - Intronic
920847562 1:209606765-209606787 AGAGATCAGCAGAGAGCTGAGGG + Intronic
921011681 1:211148132-211148154 AGAGGTGGGCAGAGGCCTTAAGG + Intergenic
921183013 1:212646156-212646178 AGAGGGACCCAGAGGGCAGAAGG + Intergenic
922142776 1:222906752-222906774 AGAGGAGCCCAGAGGGCTGCTGG - Intronic
922618007 1:226974461-226974483 TGAGGTGTCCTGAGGGCTGTGGG + Intronic
922719972 1:227895353-227895375 AGAGGAGACAGCAGGGCTGAGGG + Intergenic
924787336 1:247210647-247210669 CGAGGTGGGCAGGGGGCTGATGG - Intergenic
1062979347 10:1708886-1708908 GTATGTGAGCAGAGGGCTGAGGG + Intronic
1062996655 10:1872578-1872600 AGAAATGACCAAAGGGCTGTGGG + Intergenic
1064222724 10:13455530-13455552 AGGGGAGACAGGAGGGCTGAGGG + Intronic
1064328454 10:14372522-14372544 AGAGGAGGCCAGAGGGCCCAGGG - Intronic
1064368657 10:14730920-14730942 AGAGGTGACTTTAGGGGTGAGGG + Intronic
1064622162 10:17228175-17228197 AGAGGAGACCAGAGGGACGGGGG + Intergenic
1066052593 10:31649011-31649033 AGAGGTGACCTGAGGGCCACAGG - Intergenic
1067337774 10:45378771-45378793 AGAGGTGAACAAGGGGCAGAGGG - Intronic
1068563554 10:58545500-58545522 AGAGTTTACCAGAGGCCTAATGG + Intronic
1069172171 10:65245692-65245714 AAAGGTGAACAGAAGGCTGTTGG - Intergenic
1069422609 10:68260647-68260669 AGAGGTCACCTGAGAGCTGGGGG + Intergenic
1069755926 10:70774468-70774490 CGAGGGGACCTGAGGGCAGAAGG - Intronic
1069932133 10:71890029-71890051 GGAGGGGAGCAGAGGGCAGAGGG - Intergenic
1070666475 10:78348638-78348660 AGAAGAGCCCAGAGGGCTGAAGG - Intergenic
1070967349 10:80537707-80537729 AGAGGGGCTGAGAGGGCTGAGGG + Intergenic
1071660143 10:87492661-87492683 AGAGGTTACCAGAGGCTGGAAGG - Intergenic
1072668632 10:97413006-97413028 AGAGTTGACCAGGAAGCTGAGGG + Intronic
1073152880 10:101323687-101323709 AGAGGGGGCAAGAGGGCTCATGG - Intergenic
1073222215 10:101884424-101884446 AGAGGGGACAAGGGGCCTGAAGG + Intronic
1073539275 10:104305254-104305276 AGACATCACCAGAGGGCTGGCGG + Intergenic
1075224013 10:120609020-120609042 AGAGCTGGCCCGAGGGCTGATGG - Intergenic
1075440099 10:122473287-122473309 TGAGGTGACCTGAAGGCTGGAGG + Intronic
1076641913 10:131923155-131923177 AGTGGTTACCAGAGGGCAGAGGG - Intronic
1076756383 10:132574566-132574588 AGGGGTGAACAGAGGTCTTAGGG + Intronic
1076858407 10:133128379-133128401 ACAGGTGACCAGGGTGATGATGG - Exonic
1077397700 11:2332932-2332954 AGACGGGCCCAGAGGGCAGAGGG - Intergenic
1078437854 11:11340230-11340252 ACAGGTGACCAGAGGGATAGAGG + Intronic
1080064001 11:27988404-27988426 AGAGGTGACCAGAGGCCAGGTGG + Intergenic
1081667112 11:44923147-44923169 AGAGGTGTCCAGTGGGCAGCTGG + Intronic
1083347184 11:62001673-62001695 AGGGGTGAATAGAGGGGTGAGGG + Intergenic
1083680479 11:64349455-64349477 AGAGGTGGGGACAGGGCTGAGGG + Exonic
1084336454 11:68460691-68460713 AGAGGCGGCCAGAGGGCGGGCGG + Intergenic
1084526034 11:69698541-69698563 TGAGGTGGGCAGAGGGCTGGTGG + Exonic
1084930744 11:72553760-72553782 ACAGATGACCACATGGCTGATGG + Intergenic
1084967216 11:72751074-72751096 AGAGGCCACCAGAGCCCTGATGG - Intronic
1085010722 11:73140494-73140516 AGAGGTGAGCAGAGTGTGGATGG + Intronic
1085045259 11:73349020-73349042 AGAGGTGGCCAGGTGGCTGCAGG + Intronic
1085440710 11:76560010-76560032 AGAGGTGACCACGGAGATGATGG - Intergenic
1085752929 11:79177794-79177816 AAAGGTGACCCAAGGACTGAGGG + Intronic
1087505001 11:99009548-99009570 AAAGGTGACAAGATGGATGATGG + Intergenic
1088539703 11:110901114-110901136 AGAGGTAAGAAGAGGCCTGAGGG + Intergenic
1088688314 11:112303742-112303764 AGAGAGGACCTGAGGGCTGTGGG - Intergenic
1089167833 11:116490819-116490841 AGAGGTGAGCAAAGTGATGAAGG - Intergenic
1089302544 11:117507395-117507417 AGGGGTGCCCTGAGGGCGGAGGG - Intronic
1089429112 11:118406517-118406539 AGAGGTGAAGAAAGGGATGAAGG - Intronic
1089515103 11:119027226-119027248 AGAGGAGAGCAGTGGGGTGAGGG - Intronic
1089554775 11:119310356-119310378 AGCGGTGACAAGAGGGCTCCGGG - Exonic
1089788104 11:120922514-120922536 AGGGATGGCCAGAGGGCAGAGGG - Intronic
1089909195 11:122078816-122078838 AGAGGGGACCATGGGGCTTAAGG + Intergenic
1090236832 11:125154567-125154589 AGACATGAGCAGAGGGGTGATGG - Intergenic
1090941217 11:131389900-131389922 AAAGGAGACCAGAAGGGTGAGGG + Intronic
1091449353 12:562841-562863 GGAGGTGAGCACAGGGCTGGGGG + Exonic
1092367482 12:7889205-7889227 AGAGTAGCCCAGAGGGCTGCTGG + Intronic
1092672325 12:10877892-10877914 AGAGATTACCAAAGAGCTGAAGG + Intronic
1092705632 12:11281375-11281397 AGAGGTTACCAAAGAACTGAAGG + Intergenic
1092709920 12:11325164-11325186 AGAGGTTACCAAAGAACTGAAGG + Intergenic
1092710406 12:11330712-11330734 AGAGGTTACCAAAGAACTGAAGG + Intergenic
1092713689 12:11365658-11365680 AGAGGTTACCAAAGAACTGAAGG + Intronic
1092714494 12:11374855-11374877 AGAGGTTACCAAAGAACTGATGG + Intronic
1092717392 12:11404843-11404865 AGAGGTTACCAAAGAACTGAAGG + Intronic
1092718204 12:11413889-11413911 AGAGGTTACCAAAGAACTGATGG + Intronic
1092813774 12:12295164-12295186 AGAGCAGCCCAGAGGGCTGCTGG + Intergenic
1093323423 12:17742350-17742372 ATAGGTTACCAGAGGGCTTATGG + Intergenic
1095038523 12:37419563-37419585 TGAGGGAAGCAGAGGGCTGATGG - Intergenic
1097373669 12:58815330-58815352 AGTGGGGAACAGAGGGCAGATGG + Intergenic
1098640666 12:72835222-72835244 AGAGCAGCCCAGAGGGCTGCTGG + Intergenic
1099060822 12:77905972-77905994 AGAAGTGACCAGAGGGAGCAAGG - Intronic
1100226483 12:92561624-92561646 AGAGGTGGCAAGTGGGCGGAGGG - Intergenic
1100343921 12:93708568-93708590 ACAGTTGACCAGAGATCTGATGG - Intronic
1101235558 12:102785657-102785679 AGAGGTGATGACTGGGCTGACGG + Intergenic
1101736367 12:107466280-107466302 AGAGGTTAGAAGAGGGCAGAGGG + Intronic
1101853899 12:108426350-108426372 AGAGATGACAAGAGGGTTCAAGG + Intergenic
1102439013 12:112947304-112947326 AGAGGGGACCAGTGGGGTGCTGG - Intronic
1102744558 12:115239002-115239024 AGAGGATGCCAGAGGGCTAATGG - Intergenic
1103363013 12:120364821-120364843 AGAGAGGTCCTGAGGGCTGAAGG - Intronic
1104967158 12:132513535-132513557 AGAGGTGACCAGAGGGCTGATGG - Intronic
1105302716 13:19150503-19150525 AGAGGGGACCTGAGGGCTGGCGG + Intergenic
1105323231 13:19347026-19347048 AGAGGTGACCAGATGGTTAGGGG - Intergenic
1105409714 13:20161346-20161368 AGAGGAGAGCCGAGGGCTGTTGG + Intergenic
1105874160 13:24538843-24538865 AGAGGTGACCAGATGGTTAGGGG + Intergenic
1105968364 13:25404977-25404999 AGAAGTGGCCAGAGCGCTGGGGG + Intronic
1106214266 13:27680443-27680465 AAATGAGACCAGAGGGATGAAGG + Intergenic
1108186373 13:47892376-47892398 AGACGTGAGCAGAGCGCTGTGGG + Intergenic
1108568925 13:51730272-51730294 CGAGGTGACCAGTGGCCTGCTGG + Intronic
1113239978 13:108326789-108326811 AGAGGTGAGAAGAGAGGTGACGG - Intergenic
1113354515 13:109565807-109565829 AGAGATGACCAGAATGCAGATGG - Intergenic
1114266385 14:21074808-21074830 GGAGGAGGCCAGGGGGCTGAAGG + Exonic
1114527840 14:23377476-23377498 AGAGGTGTCCAGAGGGCTTGGGG - Intronic
1115336301 14:32246874-32246896 AGAACTGCCCTGAGGGCTGAAGG - Intergenic
1115441734 14:33443581-33443603 AGAGGGGACCAGTGGGCCAAAGG + Intronic
1116497156 14:45574931-45574953 AGCGTTGACCAAAGGGATGAGGG - Intergenic
1118228033 14:63921326-63921348 AGAGATGACAACTGGGCTGAAGG + Intronic
1119948128 14:78716072-78716094 AGAGGGGACCAAAGAGATGAGGG + Intronic
1120590165 14:86364921-86364943 AGGGGTGAGCAGAGTGGTGAGGG - Intergenic
1121238718 14:92412546-92412568 AGAGGGGACAGGAGGGCTGTGGG - Intronic
1121919829 14:97870279-97870301 AGGGGTGACCAGTGGACTGCTGG + Intergenic
1122299156 14:100722329-100722351 AGAGGGGACCTGGGGGCAGAGGG - Intergenic
1122480051 14:102041394-102041416 AGGCGTGTCCAGAGGGCTCACGG + Intronic
1122687719 14:103518013-103518035 CGAGGTGAACACAGGGCTGAGGG - Intergenic
1122861230 14:104583210-104583232 AGAGGGGACCTCAGGGCTCAGGG + Intronic
1122911167 14:104828227-104828249 AGAGCGGGCCAGAGGGCTGCTGG + Intergenic
1123155209 14:106218313-106218335 AGAGGAAGCCACAGGGCTGACGG + Intergenic
1124877107 15:33605358-33605380 AGAGGAGACAGGAGGGATGAGGG - Intronic
1125506881 15:40272315-40272337 CGAAGTGGTCAGAGGGCTGAAGG - Exonic
1125766737 15:42141403-42141425 CGAGGAGACCAGAAGGCAGAAGG + Exonic
1126730224 15:51674819-51674841 AGAGGTCTCCACAGGGCAGAAGG - Intergenic
1126796266 15:52262530-52262552 AGAGGTGACGAGAGGCCTGGGGG - Intronic
1128426088 15:67543244-67543266 AGAGGTGACAAGGGGAGTGACGG - Exonic
1129105577 15:73305054-73305076 GGAGGGGCCCAGAGGGCTGCTGG + Exonic
1129682402 15:77665239-77665261 AGAGCCCACCAGAAGGCTGAGGG - Intronic
1129702167 15:77774323-77774345 AGAGGTGGGCAGAGGGCTGAGGG - Intronic
1130964419 15:88686327-88686349 AGAGGTGCCCGCAGGGCTTAAGG + Intergenic
1131814634 15:96209430-96209452 AGAGCTGCTCAGATGGCTGAAGG - Intergenic
1132525773 16:413797-413819 AGTGGGGACCGCAGGGCTGAGGG - Intergenic
1132689605 16:1176655-1176677 AGCAGTGAGCAGGGGGCTGATGG + Intronic
1133961545 16:10497816-10497838 AGTGGTGACCACAGGGTTGACGG - Intergenic
1134998843 16:18759905-18759927 AGAGTTGATTTGAGGGCTGAAGG - Intergenic
1135060463 16:19267064-19267086 GGAGGTGACCTGAGGGCTGCAGG + Exonic
1135323770 16:21513196-21513218 AGCAGTGACCAGAGAGCAGAGGG - Intergenic
1135873003 16:26169535-26169557 AGAGATGAGCTGGGGGCTGAAGG + Intergenic
1136182453 16:28563159-28563181 AGGGGTGACCAGAGTGCTCTGGG + Intronic
1136335253 16:29606461-29606483 AGCAGTGACCAGAGAGCAGAGGG - Intergenic
1136428003 16:30182191-30182213 AGGGGTGACCTGTAGGCTGAGGG - Intergenic
1136549372 16:30974466-30974488 AGCGGTGACCAGAGGCGAGAAGG + Intronic
1138113511 16:54342564-54342586 GAATGTGACCAGATGGCTGAGGG - Intergenic
1138137438 16:54535671-54535693 GTAGGTGCCCAGAGGGGTGAGGG + Intergenic
1138432127 16:56975715-56975737 TGAGGTGACCAGAAAGCTGAGGG - Intronic
1138632788 16:58312335-58312357 AGAGCAGACCCGAGGGCTGTTGG + Intronic
1139144590 16:64308335-64308357 GGAGGTGAGCAGAGGGCAGCAGG + Intergenic
1139504568 16:67392532-67392554 GGGTGTGGCCAGAGGGCTGAGGG - Intronic
1140670445 16:77272502-77272524 AGAGGTAACTAGATGGGTGATGG - Intronic
1140716686 16:77733004-77733026 ACAGGTGAAAAGAAGGCTGATGG - Intronic
1141750735 16:85956287-85956309 AGAGGTGACCAGGGGCCGGATGG - Intergenic
1141889979 16:86919931-86919953 ACAGGTGAGCTGTGGGCTGATGG + Intergenic
1142017542 16:87758523-87758545 AGAAGTCACCAGGGGGCTGGGGG + Intronic
1142035978 16:87862303-87862325 AGCAGTGACCAGAGAGCAGAGGG - Intronic
1142854465 17:2722180-2722202 GGAGGTGCCCAGAGGACTGTGGG - Intergenic
1142898091 17:2995212-2995234 AGAGGAGACAGGAGAGCTGAGGG - Intronic
1143184514 17:5002153-5002175 AGAGGGGTCCAGACTGCTGAGGG + Intronic
1143751689 17:9032744-9032766 CGAGCTGGCCAAAGGGCTGAGGG - Intronic
1144201619 17:12947339-12947361 AGAGGGAACCAGAGGGCCAAAGG - Intronic
1145307815 17:21685087-21685109 GGAGGGAAGCAGAGGGCTGATGG - Intergenic
1145308049 17:21686251-21686273 GGAGGGAAGCAGAGGGCTGATGG - Intergenic
1145390744 17:22453931-22453953 AGAGGCGACCAGATGTCCGATGG - Intergenic
1146256886 17:31396920-31396942 AGAGGGGACCTGAGGACTCAGGG - Intronic
1146786318 17:35725035-35725057 AGAGCAGATCAGAGAGCTGAAGG - Intronic
1146898514 17:36564177-36564199 AGAGATGACCTGTTGGCTGAAGG + Intronic
1146949420 17:36895339-36895361 AGAGGTCATCATAGGGCTGGCGG + Intergenic
1147499503 17:40949112-40949134 AAGGGTGACGAGATGGCTGATGG + Intergenic
1147806596 17:43135905-43135927 GGAGGTGAGCAGGGTGCTGAGGG - Intergenic
1148168686 17:45501814-45501836 GGAGGTGAGCAGGGCGCTGAGGG - Intergenic
1148280125 17:46341127-46341149 GGAGGTGAGCAGGGCGCTGAGGG + Intronic
1148302353 17:46559064-46559086 GGAGGTGAGCAGGGCGCTGAGGG + Intronic
1148764507 17:50029265-50029287 GGAGGTGACCAGAGGGCAGAGGG - Intergenic
1149550006 17:57533101-57533123 GGAGGTGACCAGTGGGGTCAAGG - Intronic
1150288969 17:63970998-63971020 CCACGTGACCAGAGGGCAGATGG - Intronic
1150399880 17:64848264-64848286 GGAGGTGAGCAGGGCGCTGAGGG - Intergenic
1150559600 17:66283087-66283109 AGATGACACCAGTGGGCTGAGGG + Intergenic
1150957217 17:69872487-69872509 AGAGAAGCCCAGAGGGCTGCTGG + Intergenic
1151427287 17:74039226-74039248 ACAGCTGATCAGAGGGCTGGGGG - Intergenic
1152255131 17:79234569-79234591 AGAGGCCACCTGAGGGCCGATGG + Intronic
1152691379 17:81719652-81719674 ACAGGTGACCACAGGTCTGCAGG - Intronic
1154356817 18:13627837-13627859 AGCGGTGGCCAGAGGGCAGACGG + Intronic
1155384207 18:25259537-25259559 AGAGGTAAGAAGAGAGCTGAAGG + Intronic
1156480940 18:37435993-37436015 AGAGGTGAGCAGAGAGGTGCGGG - Intronic
1157190960 18:45581196-45581218 AGATGAGAACAGAGGGCAGAGGG + Intronic
1157920939 18:51711955-51711977 AGAGCAGACAGGAGGGCTGAAGG + Intergenic
1158587798 18:58756384-58756406 AGACGAGACTAGAGGGCAGAGGG + Intergenic
1159913229 18:74165807-74165829 AGAGCAGAGCAGAGGCCTGAAGG + Intergenic
1159985992 18:74841381-74841403 AGCGGTGAGCAAAGGGATGAAGG - Intronic
1160682034 19:416369-416391 AGAGGTAACCAGAGAGATGCGGG + Intergenic
1160693725 19:472508-472530 GGAGGTGACCTGAGGGCTTTGGG - Intronic
1160913197 19:1484119-1484141 CGTGGTGACCTGAGGGCAGAGGG + Exonic
1161006011 19:1937218-1937240 ACAGGTGACCTGAGGACTCACGG + Intergenic
1161724249 19:5919186-5919208 AGAGGAGACGAGAGGACTGTGGG + Intronic
1162199126 19:9008611-9008633 TGATGTGGCCAGAGGGGTGATGG + Intergenic
1163438875 19:17311541-17311563 AGAGGTGGCCAGGGGCCTCAGGG - Intronic
1163584455 19:18156240-18156262 AGAGGAGACCAAGGGTCTGAGGG - Intronic
1163591055 19:18194310-18194332 AGAGGGAACCAGCGGGCAGAGGG + Intronic
1163664591 19:18597372-18597394 GGAGGTTCCCAGAAGGCTGACGG - Intronic
1164000130 19:21090784-21090806 AGAGCAGTCCTGAGGGCTGATGG + Intronic
1164508379 19:28877849-28877871 AGAGGTGAAGAAAAGGCTGAAGG - Intergenic
1164638820 19:29810891-29810913 AGAGGAGGCCTGAGGTCTGAGGG + Intergenic
1165126147 19:33599302-33599324 AGAGGTGACCACAGGGAGGTGGG + Intergenic
1165335745 19:35168543-35168565 AGACGAGGCCAGAGAGCTGAGGG + Intronic
1166047604 19:40238634-40238656 AGAGGTGTGGAGAGGGCTGTGGG - Intronic
1166230750 19:41424819-41424841 ACAGGTGAAGAGGGGGCTGACGG - Exonic
1166805688 19:45485647-45485669 GGAGGGGGCCAGAGGGCTGCGGG + Exonic
1167107890 19:47441311-47441333 AGGGGTGACCAGTGGGCTGTGGG - Intronic
1167594137 19:50418513-50418535 TGAGGTGACGGGAGGGCCGAGGG - Intronic
925913308 2:8587295-8587317 GGAGGTGACCAGGGAGCCGAGGG - Intergenic
926884178 2:17582209-17582231 AGAGGTGCCAGGAGGGGTGAGGG + Intronic
926936404 2:18090047-18090069 AGAGGTTTCCTGAAGGCTGAAGG + Intronic
927138079 2:20111872-20111894 ACAAGTGAGCAGAGGGCTCAAGG + Intergenic
927997576 2:27496718-27496740 TGGGGTTACCAGAGGGCTGGGGG + Intergenic
928086509 2:28349654-28349676 TGAGGTGACCAGGTGGCTGCAGG + Intergenic
928107142 2:28477896-28477918 AGGGGTGAGGTGAGGGCTGATGG - Intronic
928684009 2:33729084-33729106 AGAGCAGCCCAGAGGGCTGCTGG - Intergenic
929307426 2:40379520-40379542 TTAGGTGACCAGAGGGTTCATGG - Intronic
929531639 2:42756438-42756460 AGAGCAGAGCAGGGGGCTGAGGG + Exonic
930186376 2:48415955-48415977 AGAGTTGGGCAAAGGGCTGAGGG - Intergenic
931423754 2:62152109-62152131 GGAGGTGAGCAGAGGGAAGATGG - Intergenic
931855523 2:66298722-66298744 CGAGATGAGCAGAGGGCTGCAGG + Intergenic
932265078 2:70360963-70360985 ATAGGTGGCCTGAGGGCTTACGG - Intergenic
932312417 2:70754434-70754456 AGAGGTGACTATAGGGCTGGAGG - Intronic
932360367 2:71100378-71100400 AGAGATGCCCAGAGAGCTGGAGG - Intergenic
933226213 2:79752169-79752191 AGAGGAGAACAGAGGGATGAAGG + Intronic
933859605 2:86452425-86452447 AAATGTGACCAGAGGCTTGAAGG + Intronic
934029227 2:88026747-88026769 AGAGCAGCCCAGAGGGCTGCTGG - Intergenic
934717489 2:96552102-96552124 CGGGATGACCAGGGGGCTGAAGG - Exonic
934956959 2:98631189-98631211 AGTGGAGACCCGAGGGTTGATGG - Intronic
934964834 2:98712000-98712022 AAAGGTGACGAGAGATCTGAAGG - Intronic
935190879 2:100777861-100777883 ATTGATGACCAGACGGCTGATGG + Intergenic
935223917 2:101037355-101037377 TGAGGTGGTCAGAGGACTGAGGG - Intronic
935805068 2:106737510-106737532 AGAGCTGATGAGAGAGCTGATGG + Intergenic
937437751 2:121893241-121893263 AGACGGGCCCAGAGGGCAGAGGG - Intergenic
937588237 2:123582607-123582629 AGAGGTGACCAGGGAGCAGGTGG - Intergenic
937649201 2:124300819-124300841 AAAGGTAACCAGAGGGCCAAAGG + Intronic
937971272 2:127551211-127551233 AGAGATGACAAGAGGACAGATGG - Intronic
938128848 2:128693794-128693816 TGAGGGGACCTGAGGGGTGAGGG - Intergenic
938236497 2:129710389-129710411 AGACATGGCCAGAGGGCAGAGGG + Intergenic
938816619 2:134911192-134911214 AGAGCAGCCCAGAGGGCTGCTGG + Intergenic
938832262 2:135063482-135063504 AGTGGTTACCAGGGGACTGAGGG - Intronic
941395090 2:164964211-164964233 AGAGCAGCCCAGAGGGCTGCTGG - Intergenic
942378083 2:175357324-175357346 AAAAATGACCAGAAGGCTGAGGG + Intergenic
944770691 2:202911624-202911646 AGAGGAGACCGGAGGGCAGAAGG - Exonic
945372860 2:209041868-209041890 AAATGTGACCAGAGGTTTGAAGG + Intergenic
946216466 2:218187571-218187593 AATGGTGACCAGGGGGCTGGAGG + Intergenic
946427880 2:219609036-219609058 GGCGGTGATCAGAGGGATGAGGG - Intronic
946972131 2:225105820-225105842 AGACTTGAACAGAGGGATGAGGG - Intergenic
947500351 2:230666829-230666851 GGAGGTGACCAGAGACCTGGGGG - Intergenic
947521609 2:230850067-230850089 AGAGGGGAGGAGAGGGCAGAGGG + Intergenic
947757891 2:232581518-232581540 AGAGGAGACCGGAGGGCATAAGG - Intronic
947766227 2:232639547-232639569 AGGGGGTACCACAGGGCTGAGGG - Intronic
948368075 2:237471649-237471671 AGAGGGAATCAGAGGGCCGAGGG + Intergenic
948410075 2:237752515-237752537 AGAGGCTACCAGGGGGCTGGAGG - Intronic
1168856513 20:1012960-1012982 AGAGGCGAGCAGAGGGGTAAAGG + Intergenic
1169551529 20:6706446-6706468 GGAGATGACCAAAGGGCAGAAGG + Intergenic
1169662314 20:7993534-7993556 AGTGGGGACCAGAGACCTGATGG + Intronic
1170479008 20:16746551-16746573 AAAGGTTACCAGAGGGATCATGG - Intergenic
1170884583 20:20329182-20329204 AGAGATGACAAGACGGTTGATGG - Intronic
1171481754 20:25460067-25460089 AGAGGAGCTCAGAGGGCGGAGGG - Intronic
1172183957 20:33020023-33020045 GGAGGTGCCGAGAAGGCTGATGG - Intronic
1172227909 20:33317423-33317445 AGACGTCACCAAAGGGCTGTGGG - Intergenic
1172229300 20:33326324-33326346 AGAGGTGAACAAAGGGGTGCAGG - Intergenic
1172287831 20:33753420-33753442 AGAGGTGAGCAGAGGGGGCAGGG + Exonic
1172789331 20:37491711-37491733 AGAGGTGACCATTGGTCTTAGGG - Intergenic
1173581866 20:44152675-44152697 ACAGGTCACCAGAGGGAAGAGGG - Intronic
1173946716 20:46957195-46957217 AGAGCTGACCAGAGGTCCCAAGG - Intronic
1174180734 20:48672721-48672743 ACATTTGAGCAGAGGGCTGAGGG - Intronic
1175252281 20:57616790-57616812 AGAGGGGAGTAGAGGGCAGAAGG + Intronic
1175705774 20:61175371-61175393 AGAGGTGAACAGAGTGAGGATGG - Intergenic
1176039456 20:63056597-63056619 AGAGGGCAGCAGAGGGCTGGCGG + Intergenic
1177175847 21:17700083-17700105 AGAGGGGACCAGCATGCTGAGGG + Intergenic
1178455404 21:32745421-32745443 AGAGATGGCTAGAGGGCAGAGGG - Intronic
1179060274 21:37973135-37973157 AGAGGTGAACACAGGTGTGATGG - Intronic
1179358258 21:40682177-40682199 GGAGGTGGCCAGAGGGATGCGGG + Intronic
1179478754 21:41664777-41664799 GGAGGTGACAAGAGGCCGGAAGG + Intergenic
1181107197 22:20582409-20582431 TGAGGTGACCAAGGGGCTGGCGG - Intronic
1181274643 22:21680911-21680933 AGAGCTGACCAGGGGGCTGGCGG + Intronic
1181660677 22:24345950-24345972 AGAGGTGGCAGGAGAGCTGAGGG + Intronic
1181989824 22:26829000-26829022 GGAGGTGGCAAGAGGGGTGACGG + Intergenic
1181992567 22:26848510-26848532 ACAGGTGAGCAGAGGGCTGAGGG + Intergenic
1182044392 22:27262877-27262899 ACAGGTGAGCAGAGGGCCTAGGG - Intergenic
1182370900 22:29810066-29810088 AGAGGAAGCCAGAGGGCTGTGGG - Intronic
1183725170 22:39584549-39584571 ATGGGAGACCAGAGGGCTGGGGG + Intronic
1184153394 22:42651174-42651196 ACAGGTGAACAGAGGCCTGATGG + Intergenic
1184724132 22:46333280-46333302 TCAGGTGAGCAGAGGACTGATGG - Intronic
1185109490 22:48893156-48893178 GGTGCTGACCAGAGGGATGAGGG + Intergenic
1185205538 22:49535849-49535871 AAAGGTGGGCAGGGGGCTGAGGG + Intronic
1185302814 22:50091341-50091363 AGCAGTGGCCAGACGGCTGAGGG + Intronic
949618866 3:5787543-5787565 AAAGGGGACCAGAGAGCTCATGG - Intergenic
950021821 3:9792839-9792861 AAAGGTGACAAGAAGGCCGAAGG + Intronic
950454876 3:13086703-13086725 AGAGCTGTGCAGAGAGCTGAGGG - Intergenic
950497108 3:13340419-13340441 AGCAGTGACCAGAGGGCCCAGGG + Intronic
950764579 3:15263923-15263945 AGAGGAGCCCAGAGGGCTCATGG + Intronic
950889165 3:16387788-16387810 GGAGGTGACAGGAGGGCTGTGGG - Intronic
951350390 3:21600193-21600215 AGAGCTGCCCTGAGGGCTGCTGG - Intronic
952063705 3:29541838-29541860 AGAGGAGACAGTAGGGCTGAGGG - Intronic
952124261 3:30280923-30280945 AGAGCAGCCCAGAGGGCTGCTGG - Intergenic
953288761 3:41640519-41640541 GGAGGTGACCAGAGACCTGTGGG + Intronic
953755826 3:45645141-45645163 GGAGCTGGCCAGAGGGCTGCAGG + Intronic
953983357 3:47423897-47423919 AGAGTTGGGCAGAGGGCTGCAGG - Intronic
954117416 3:48474867-48474889 GGAAGTGACCTGAGGCCTGAGGG - Intronic
954118278 3:48479117-48479139 AAAGGTGACAAGAGGGCTCAGGG - Intronic
954220940 3:49153569-49153591 AGAGGTCACCATGGAGCTGAAGG + Intergenic
954633840 3:52060983-52061005 CTAGGTGACTAGAGGGCTGAGGG - Intergenic
954659057 3:52216828-52216850 GGTGGTGACCAGAGCTCTGAAGG - Intergenic
954827523 3:53387236-53387258 AGATGAGATCAGAGGGCTGGAGG - Intergenic
954867870 3:53744899-53744921 AGAGCTGAGCTGAGGCCTGATGG + Intronic
955670821 3:61400669-61400691 AGAGGTTACCAGAGGCTGGAAGG - Intergenic
955853561 3:63248016-63248038 AGAGCTGGCCAGAGCACTGAAGG + Intronic
956098682 3:65744969-65744991 AGAGGTTGCCAAAGGGCTGGAGG - Intronic
956179362 3:66502700-66502722 AGAGGTGATCTTATGGCTGAGGG - Intergenic
956829438 3:73031043-73031065 AGAGGTTGTCAGAGGGTTGAGGG + Intronic
956939371 3:74139022-74139044 AGGGGAAACCTGAGGGCTGAGGG + Intergenic
959649111 3:108734649-108734671 AGAGTGGCCCAGAGGGCTGCTGG - Intergenic
960041005 3:113149828-113149850 AGAGGAGACCTGAAGGCTGCTGG - Intergenic
960204194 3:114875291-114875313 GGAGGTAACCAAAGGGCTGTGGG - Intronic
961536557 3:127574188-127574210 AGAGTTGCCCTGAGGGCCGAGGG - Intronic
961817343 3:129558001-129558023 AGGGGTGGGCAGAGGGGTGATGG - Intronic
962203086 3:133415896-133415918 AGAGGTGAGTAGAGGGGAGAGGG - Intronic
962271765 3:133982641-133982663 AGAAGAGACCATGGGGCTGAGGG - Intronic
962382875 3:134911412-134911434 AGAGGGGCCGAGAGGGATGATGG + Intronic
963008514 3:140748635-140748657 AGAGGTGAGTAGAGGGCTAAAGG - Intergenic
963433069 3:145234278-145234300 AGAGCAGGCCAGAGGGCTGTGGG - Intergenic
963807290 3:149736452-149736474 TGAGGTAACCAGAGGTGTGATGG - Intronic
966850780 3:184163991-184164013 AGAGATGAGCAGATGGCAGAAGG - Intronic
967113870 3:186319207-186319229 ACAGGGGACCATAGGGCTAATGG - Intronic
968037532 3:195560707-195560729 AGAGGTCTCCAGGAGGCTGAAGG - Intergenic
968474786 4:799103-799125 ACAGGTGAAAAGAGGGCAGAAGG - Intronic
968880233 4:3294833-3294855 AGTGGTGACCGGAGGTCTCAGGG + Intronic
970672305 4:18410918-18410940 AGCTGTGACCAGAGGGCAGTTGG + Intergenic
972746190 4:41935063-41935085 AGCGGTGCCCAGAGGCATGACGG - Intergenic
974022163 4:56701338-56701360 AGAGCTGCCCTGAGGGCTGCTGG - Intergenic
974409191 4:61517271-61517293 TGAGGTGAGCAGGGGTCTGATGG + Intronic
976612777 4:87047082-87047104 AAAGGTGACCGAAGAGCTGACGG + Exonic
977602240 4:98946305-98946327 AGAGCTGACAAAAAGGCTGAAGG - Intergenic
978409533 4:108411893-108411915 ATAGGTGTCCAGGGCGCTGATGG - Intergenic
978507102 4:109470522-109470544 AGAGCTGTCCCCAGGGCTGAGGG + Intronic
979550229 4:121982576-121982598 AGAGGTGTGCAGAGGTCTGATGG - Intergenic
979853009 4:125596376-125596398 AGAGGTGACATGAGTGCAGAAGG + Intergenic
980716387 4:136635886-136635908 AGAGCAGCCCCGAGGGCTGATGG + Intergenic
983283272 4:165707922-165707944 AGGGGTGACCAAAAGGGTGAGGG + Intergenic
984184707 4:176529762-176529784 AGTGGTTACCAGAGAGATGAGGG - Intergenic
984926910 4:184815168-184815190 AGGGCTGTCCAGAGAGCTGAGGG + Intronic
984946484 4:184972575-184972597 TGAGGTGGAGAGAGGGCTGAAGG - Intergenic
985681585 5:1258535-1258557 AGAGGTGAGCAGAGCGCGGAGGG + Intronic
986775782 5:11012591-11012613 AGAGGTGGCCAGAGGGCTGCCGG + Intronic
987247158 5:16060480-16060502 AGAGCTGACCAGATGGCTCCTGG - Intergenic
987761343 5:22165979-22166001 AGAGCAGCCCTGAGGGCTGATGG - Intronic
989465347 5:41748319-41748341 GGAGATGAGGAGAGGGCTGATGG + Intronic
989783997 5:45305112-45305134 AGAGGTGAAAAGAAGGCAGAAGG + Intronic
990384792 5:55249840-55249862 AGAGGAGCCCCGAGGGCTGCTGG - Intergenic
991896135 5:71399447-71399469 AGAGCAGCCCTGAGGGCTGATGG - Intergenic
992159732 5:73989606-73989628 AGAGGAGCCCAGAGGGCTGCTGG + Intergenic
992757962 5:79926689-79926711 AGAGGTGAACAGTGGGCTGCTGG + Intergenic
993305635 5:86271851-86271873 AGTGGTGACAAAAAGGCTGAAGG - Intergenic
993929281 5:93917979-93918001 AGAGGACATCAGAGGGTTGAGGG - Intronic
994910812 5:105904039-105904061 AGAGGAGACCTGAGGGTTAAAGG + Intergenic
995105141 5:108369080-108369102 TTAGGTGAGCAGAGGGATGATGG - Intronic
996520254 5:124418249-124418271 AGAGGTTAAGAGAGAGCTGAAGG - Intergenic
997214043 5:132095697-132095719 AGAGGTGGGAAGAGGGCTGAAGG - Intergenic
998041120 5:138951599-138951621 CGAGGTGACTAGAGGCCTGGGGG - Intronic
998503678 5:142654879-142654901 AGGGGAGAGCAGAGGGCTGCAGG + Intronic
999268632 5:150283333-150283355 AGAGTTAACCAGAGGGAAGAGGG - Intronic
999318387 5:150598834-150598856 AGGGGTCCCCAGAGGCCTGAAGG + Intergenic
999929603 5:156416681-156416703 AAAGGAGACCAGAGAGATGAAGG - Intronic
999940818 5:156540850-156540872 AGTGCTGGCCAGGGGGCTGAGGG + Intronic
1000565452 5:162841243-162841265 AGAGATGACCAGAGTGAAGAGGG + Intergenic
1001399739 5:171439382-171439404 ACAGCTGGCCAGAGGGCTGGAGG + Intronic
1002272545 5:178082148-178082170 AGACATCACCAGAGGGGTGATGG - Intergenic
1002315385 5:178340026-178340048 AGAGATGAGTAGAGGGATGAGGG + Intronic
1002386287 5:178869641-178869663 AGAGTTGTCCAGAGGGATGCCGG + Intronic
1002449695 5:179311635-179311657 AGACATCACCAGAGGGGTGATGG - Intronic
1003094609 6:3132422-3132444 AGAGGGGAGCAGAGCACTGAGGG - Intronic
1003148976 6:3532625-3532647 AGTGGTGACAAGAGGGCTGAGGG - Intergenic
1004796862 6:19096129-19096151 AGAGATGACCAGAGCGGTGCTGG + Intergenic
1005146485 6:22696679-22696701 AGTAGTAACCAGATGGCTGAAGG - Intergenic
1006744558 6:36332126-36332148 AGATGTGGTCAGAGGGGTGATGG - Intronic
1007763411 6:44147449-44147471 AGAGGTGGCCACAGGGCTTGGGG - Exonic
1010166096 6:72917102-72917124 AGAGGAGCCCAGGGTGCTGAAGG + Intronic
1013308941 6:108875347-108875369 AGAGGTGATTAGAGGGGTGAGGG - Intronic
1013722559 6:113048482-113048504 AGAGGTGGCCAGAGAGATGCAGG - Intergenic
1013860124 6:114625655-114625677 GAAGGTGACCAGATGGCTGGAGG - Intergenic
1013871435 6:114766536-114766558 TCAGGTGAGCAGAGGGATGATGG + Intergenic
1015571168 6:134622795-134622817 AGAGGTGACGAGAGAAGTGAGGG + Intergenic
1016760045 6:147726791-147726813 AGAGGTGGGCGGAGGGCTTACGG + Intronic
1017564432 6:155668819-155668841 AGAGCTTCCCAGAGGGCTCAGGG + Intergenic
1017780233 6:157710115-157710137 AGAGCAGACCCGAGGGCTGCTGG - Intronic
1017890994 6:158639298-158639320 AGAGGCTACAAGAGGGCTGGGGG + Intronic
1019567141 7:1689928-1689950 CCAGGTGTCCAGAGGGCTCAAGG - Intronic
1019777895 7:2923309-2923331 AGAGGTGACCGAAGGCCGGAAGG + Exonic
1022128144 7:27377897-27377919 AGAGATTACCAAAGGTCTGATGG + Intergenic
1022261626 7:28711065-28711087 AGAGGTGGTCAGAGGCCAGATGG + Intronic
1022981689 7:35610536-35610558 AGAGGTGACCAGACCCCAGATGG + Intergenic
1023355246 7:39360695-39360717 AGAGGAGCCCCGAGGGCTGCTGG + Intronic
1024087670 7:45909805-45909827 GGAGATGACCAGTGGGCTGATGG + Intergenic
1024176994 7:46850831-46850853 AGAGGGGACTCGATGGCTGATGG + Intergenic
1024231522 7:47367333-47367355 TGAGGGGACCAGAGAGCTGGAGG - Intronic
1025111232 7:56218043-56218065 AGAGGAGACCTGAGGGCTGCTGG - Intergenic
1025301359 7:57821599-57821621 CGAGGGGCGCAGAGGGCTGATGG + Intergenic
1026086903 7:67270282-67270304 AGAAGTCACCAGAAAGCTGAAGG - Intergenic
1026288388 7:68984130-68984152 AGAGCAGACCAGAGGGCTGCTGG - Intergenic
1026306675 7:69148425-69148447 AGAGCAGACCTGAGGGCTGCTGG + Intergenic
1026575017 7:71564729-71564751 AGAGGTGCCCAGGAGGCTGTGGG - Intronic
1026690209 7:72544439-72544461 AGAAGTCACCAGAAAGCTGAAGG + Intergenic
1027596768 7:80184064-80184086 AAAGGAGACCAGTGGGCGGAGGG + Intronic
1027958482 7:84913441-84913463 AGAGGAGCCCCGAGGGCTGCTGG - Intergenic
1029517944 7:101039041-101039063 AGAAGTGACCACAGGACTGTTGG - Exonic
1029518115 7:101040634-101040656 AGAAGTGACCACAGGACTGTTGG - Exonic
1029519597 7:101051753-101051775 AGCCGTGATCAGAGGGCTGGGGG - Intronic
1029699167 7:102235252-102235274 ATAGGTGACCTGAGGACTGAGGG - Intronic
1031033782 7:116765208-116765230 GGAGGTGACCTGAGTCCTGAAGG + Intronic
1031309479 7:120177668-120177690 GGAGGTGGCCAGAGGGCTGGAGG - Intergenic
1032536222 7:132666904-132666926 AGGCCTGGCCAGAGGGCTGAGGG - Intronic
1032689138 7:134265354-134265376 AGAGGTGAAAAGAAGGCAGATGG + Intergenic
1034016869 7:147597090-147597112 AGAGCAGCCCTGAGGGCTGATGG - Intronic
1034237606 7:149584975-149584997 AGTGGTATCCAGAGGGCTGCAGG - Intergenic
1034828062 7:154284985-154285007 AGAGGTTACCAGAGGCCAGAGGG + Intronic
1035672960 8:1434116-1434138 AGACGTGGCCGCAGGGCTGAGGG + Intergenic
1036206449 8:6809033-6809055 AGAGGTCACCAGAGGGCAAAGGG + Exonic
1036446966 8:8829885-8829907 AGAGGTGCCCAGAGGCCAGATGG + Intronic
1036630513 8:10511069-10511091 AGAGATGCCGAGGGGGCTGACGG - Intergenic
1036646085 8:10612055-10612077 AGAGGAGTCCAGTGGGCTGTGGG + Exonic
1038482235 8:27909707-27909729 AAAGGTGATCAGGGGGATGAAGG - Exonic
1040033830 8:42849956-42849978 AGAGGTGCTCTGTGGGCTGAGGG + Intronic
1042577851 8:70240779-70240801 TGATGTGACCAGAGGCCTGCAGG + Intronic
1043570050 8:81592728-81592750 AGAGATGCCCAGAGGGCAGCTGG + Intergenic
1043574797 8:81645080-81645102 AGAGATGCCCAGAGGGCAGCTGG - Intergenic
1045423972 8:102044678-102044700 AGAGGTGTCCAAAGGCTTGAGGG + Intronic
1047087678 8:121536998-121537020 TGAGGTGAGCAGAGAGCTAAAGG + Intergenic
1048139852 8:131783706-131783728 AGAGGTCTTCAGAGAGCTGAAGG - Intergenic
1048533500 8:135271980-135272002 AGAGGTGAGCTCAGGGCTCAGGG - Intergenic
1048861410 8:138726938-138726960 TGGGGTGACCAGAGGGAGGAAGG + Intronic
1048991097 8:139760648-139760670 AGATGTCACCTGAGGGCTGGTGG - Intronic
1049114298 8:140672628-140672650 GGAGGTGACCAGAGGGTGAATGG - Intronic
1049302058 8:141876451-141876473 AGTAGTGGGCAGAGGGCTGAAGG + Intergenic
1049344960 8:142133948-142133970 GGAGCTGCCCAGAGGGCTGGGGG + Intergenic
1050137257 9:2479177-2479199 TGAAGTGACCAGAAGGCTAAAGG - Intergenic
1050264766 9:3878670-3878692 AGAGGTGACAAGAGGTGTGTTGG + Intronic
1050275957 9:4000693-4000715 AAAGGTAACTGGAGGGCTGATGG - Intronic
1050959227 9:11706067-11706089 AGAGTAGACCAAAGGGCTGCTGG - Intergenic
1051100356 9:13514006-13514028 AGATGAGTCCAGAGGGCAGATGG - Intergenic
1054452532 9:65410921-65410943 CTAGGTGACCTGAGGGCTGAAGG - Intergenic
1054878059 9:70117020-70117042 GAAGCTGACCTGAGGGCTGAAGG + Intronic
1056437107 9:86585368-86585390 AGAGAAGACCAGAAGCCTGAGGG + Intergenic
1056722694 9:89085319-89085341 AAAAGTGAACAGAAGGCTGAGGG - Intronic
1056838406 9:89976992-89977014 AGAGGTGTGCAGTGGGCAGAAGG - Intergenic
1057034945 9:91805196-91805218 AAAGGTGTCCAGAGGCCTGCAGG - Intronic
1057596012 9:96417272-96417294 AGAGGAAACGAGAGGGATGAGGG - Intronic
1058539792 9:105999764-105999786 ACAGGTCAGCAGAGGGCTGAAGG + Intergenic
1059853168 9:118366276-118366298 ATAGGTGACCAGAGGGTCCATGG - Intergenic
1060661149 9:125405899-125405921 AGAGGTCACCAGAGGTCAGTTGG - Intergenic
1061366334 9:130173846-130173868 AGACGTGCCCAGAAGGCCGATGG - Intronic
1061394007 9:130333421-130333443 AGAGGGGCCCAGGGGGCAGAGGG - Intronic
1062082906 9:134633902-134633924 GGAGGTGGCCTGGGGGCTGAGGG - Intergenic
1185585042 X:1236494-1236516 AGACGGGCCCAGAGGGCAGAGGG - Intergenic
1186294169 X:8131029-8131051 AGAGGCCATCAGAGGGCAGATGG - Intergenic
1187273986 X:17802858-17802880 GGAGGTGGCCAGAGGTCTGTGGG - Intronic
1187473450 X:19589305-19589327 AGGGCTCAGCAGAGGGCTGAGGG + Intronic
1188126758 X:26377694-26377716 AGAGCAGCCCAGAGGGCTGCTGG - Intergenic
1188337058 X:28949496-28949518 AGAGTTGACAAGAGGCCTTATGG + Intronic
1189088400 X:38051194-38051216 GGAGATGACCAGAGGGAAGAGGG + Intronic
1189268875 X:39736470-39736492 GGAGGTGACCAGCAGGCAGAAGG + Intergenic
1190826699 X:54024450-54024472 AGAGGTGTCCAGAGGGAACAGGG - Intronic
1191779359 X:64849364-64849386 AGAGGTGACCTGAGGGGTGATGG - Intergenic
1192888913 X:75367108-75367130 AGAGGAGCCCAGAGGGCTGCTGG - Intergenic
1193912782 X:87326794-87326816 AGAGGTGCCAAGATAGCTGAGGG + Intergenic
1196707365 X:118727750-118727772 AGGGGCGGCCGGAGGGCTGAGGG + Intronic
1197873686 X:131083215-131083237 AGAGGACAGCAGAGGGGTGAGGG + Exonic
1198932976 X:141879853-141879875 AGAGGGTAACCGAGGGCTGAGGG + Intronic
1201968676 Y:19767411-19767433 GGAGGTGTCCACAGGGCTTATGG - Intergenic