ID: 1104968964

View in Genome Browser
Species Human (GRCh38)
Location 12:132522618-132522640
Sequence GGCGCTCCATGCTGGCCCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 169}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104968961_1104968964 19 Left 1104968961 12:132522576-132522598 CCATCAGCTTTGGTTTGGATACT 0: 1
1: 0
2: 1
3: 22
4: 201
Right 1104968964 12:132522618-132522640 GGCGCTCCATGCTGGCCCACAGG 0: 1
1: 0
2: 0
3: 12
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104968964 Original CRISPR GGCGCTCCATGCTGGCCCAC AGG Intronic