ID: 1104968964 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 12:132522618-132522640 |
Sequence | GGCGCTCCATGCTGGCCCAC AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 182 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 12, 4: 169} |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1104968961_1104968964 | 19 | Left | 1104968961 | 12:132522576-132522598 | CCATCAGCTTTGGTTTGGATACT | 0: 1 1: 0 2: 1 3: 22 4: 201 |
||
Right | 1104968964 | 12:132522618-132522640 | GGCGCTCCATGCTGGCCCACAGG | 0: 1 1: 0 2: 0 3: 12 4: 169 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1104968964 | Original CRISPR | GGCGCTCCATGCTGGCCCAC AGG | Intronic | ||