ID: 1104969411

View in Genome Browser
Species Human (GRCh38)
Location 12:132524419-132524441
Sequence CAGGGTGCACACAAGGCAGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 357
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 327}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104969411_1104969425 24 Left 1104969411 12:132524419-132524441 CCGTCTGCCTTGTGTGCACCCTG 0: 1
1: 0
2: 2
3: 27
4: 327
Right 1104969425 12:132524466-132524488 CTGCAGGAGGTGCACAGAGCGGG 0: 1
1: 0
2: 9
3: 38
4: 434
1104969411_1104969422 11 Left 1104969411 12:132524419-132524441 CCGTCTGCCTTGTGTGCACCCTG 0: 1
1: 0
2: 2
3: 27
4: 327
Right 1104969422 12:132524453-132524475 GGGAGGCCTGTTGCTGCAGGAGG 0: 1
1: 0
2: 5
3: 39
4: 343
1104969411_1104969415 -6 Left 1104969411 12:132524419-132524441 CCGTCTGCCTTGTGTGCACCCTG 0: 1
1: 0
2: 2
3: 27
4: 327
Right 1104969415 12:132524436-132524458 ACCCTGTCAGCCACCCAGGGAGG 0: 1
1: 0
2: 0
3: 45
4: 384
1104969411_1104969414 -9 Left 1104969411 12:132524419-132524441 CCGTCTGCCTTGTGTGCACCCTG 0: 1
1: 0
2: 2
3: 27
4: 327
Right 1104969414 12:132524433-132524455 TGCACCCTGTCAGCCACCCAGGG 0: 1
1: 0
2: 5
3: 13
4: 165
1104969411_1104969413 -10 Left 1104969411 12:132524419-132524441 CCGTCTGCCTTGTGTGCACCCTG 0: 1
1: 0
2: 2
3: 27
4: 327
Right 1104969413 12:132524432-132524454 GTGCACCCTGTCAGCCACCCAGG 0: 1
1: 0
2: 3
3: 15
4: 199
1104969411_1104969424 23 Left 1104969411 12:132524419-132524441 CCGTCTGCCTTGTGTGCACCCTG 0: 1
1: 0
2: 2
3: 27
4: 327
Right 1104969424 12:132524465-132524487 GCTGCAGGAGGTGCACAGAGCGG 0: 1
1: 0
2: 5
3: 35
4: 408
1104969411_1104969421 8 Left 1104969411 12:132524419-132524441 CCGTCTGCCTTGTGTGCACCCTG 0: 1
1: 0
2: 2
3: 27
4: 327
Right 1104969421 12:132524450-132524472 CCAGGGAGGCCTGTTGCTGCAGG 0: 1
1: 0
2: 4
3: 36
4: 326

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104969411 Original CRISPR CAGGGTGCACACAAGGCAGA CGG (reversed) Intronic
900152203 1:1183591-1183613 GAGGGAGCACAGCAGGCAGAGGG - Intronic
900575479 1:3380313-3380335 CAGGGGGCCCACCAGGCAGAGGG + Intronic
900840222 1:5042690-5042712 CAGGCTGGTCAGAAGGCAGAAGG - Intergenic
900897776 1:5495835-5495857 CAGGGTTCCCACAAGGCCGGAGG + Intergenic
902255594 1:15186917-15186939 GAGGAGGCACACAAGGCAGCCGG - Intronic
902959610 1:19953802-19953824 TGGGATGCACACAAGGCAGGTGG - Intergenic
903457478 1:23497710-23497732 AAGGCTGCACAGCAGGCAGAAGG - Intergenic
903685883 1:25131678-25131700 CAGGTGGCACATATGGCAGATGG - Intergenic
903768253 1:25748483-25748505 CAGGGTGAACACAGGACACAGGG - Intronic
904001073 1:27339115-27339137 CAGGGAGCACAGAAGGCCCAGGG + Intergenic
905452842 1:38068230-38068252 TTGGGTGCACACAAAGCAAATGG + Intergenic
905798113 1:40826805-40826827 CACTGGGCACCCAAGGCAGACGG - Intronic
907459509 1:54597109-54597131 CAGAGTGCACATGAGGCAGAGGG - Intronic
910167169 1:84339687-84339709 CAGGGTGCACACACATCAGCTGG + Intronic
911102717 1:94106913-94106935 CAGAGGGCTCACAGGGCAGAAGG - Intronic
911586112 1:99692791-99692813 GAAGGTGAACAGAAGGCAGAAGG - Intronic
914390271 1:147215001-147215023 CAGGATGATCAGAAGGCAGAAGG + Intronic
915662993 1:157419054-157419076 TAGGGTGCACAGAAAGCTGAGGG + Intergenic
916547973 1:165824592-165824614 CAGGGAGTACAGAATGCAGATGG + Intronic
918110826 1:181454003-181454025 CAGGGTTCTCACAGTGCAGAGGG + Intronic
918508280 1:185281698-185281720 CAGGGTGCAGAGAAGAAAGACGG + Intronic
920198804 1:204246646-204246668 CTGGGTGAAGAAAAGGCAGAGGG + Intronic
1062840224 10:664222-664244 GAGTTTGCACAAAAGGCAGATGG - Intronic
1062926775 10:1322001-1322023 CAGGATGGAAACAATGCAGAGGG - Intronic
1063532212 10:6844487-6844509 GAGGCTGCACAGAAAGCAGAAGG + Intergenic
1063612052 10:7570942-7570964 CCATGTGCACAGAAGGCAGAGGG - Intronic
1065432822 10:25676648-25676670 CAAAGAGCACAAAAGGCAGAGGG - Intergenic
1070486708 10:76938732-76938754 CAGGGTACATATAAGGCAGCAGG - Intronic
1070917693 10:80165354-80165376 CAGGGTGCACACAGAGCTGTGGG + Intronic
1071462967 10:85915999-85916021 CAGGGTGCTCACCTGGCAGGTGG - Intronic
1071581489 10:86775436-86775458 AAGGGTGGACACAAGGCTGATGG + Intronic
1071728565 10:88224262-88224284 CAGAGTTCTCACATGGCAGAAGG + Intergenic
1072054409 10:91740274-91740296 CAGGGTGCACACTTGTCAGCTGG + Intergenic
1072630087 10:97139799-97139821 CAGTGTGCACACAGGGCACTGGG + Intronic
1074244987 10:111680717-111680739 CAGTGTCCTCACATGGCAGAAGG - Intergenic
1074846127 10:117399630-117399652 AAGGGTGCACAGAAGAAAGATGG - Intergenic
1075118381 10:119646314-119646336 CAGAGTGCACACCAGGCTGAGGG + Intergenic
1075705226 10:124496641-124496663 CAGGGGACCCAGAAGGCAGACGG - Intronic
1076011730 10:126994847-126994869 CGGGGTGGCCACCAGGCAGAGGG + Intronic
1076294513 10:129374210-129374232 CAGTGTGAACAGAAAGCAGAGGG - Intergenic
1076444974 10:130508048-130508070 AAGGGTGCAGAAAAGACAGATGG - Intergenic
1076479759 10:130777468-130777490 TAGGGTGCACTCAGGGAAGATGG - Intergenic
1076866166 10:133167448-133167470 CAGGCTGCACTCCAGGCACACGG - Exonic
1077035990 11:494775-494797 CAGGCTGCACACAGGCCAGAAGG + Exonic
1077776754 11:5280662-5280684 CAGGATGCTTACAGGGCAGATGG - Intronic
1078599905 11:12720962-12720984 CAAGGTACACACAAGACTGAAGG - Intronic
1079029258 11:16973703-16973725 CAGGGTGGGCTCAAGGCATAGGG - Intronic
1079116863 11:17645647-17645669 CGTGGTGCCCACAAGGCAGTGGG + Intronic
1079904223 11:26224543-26224565 CAGTGTGCACACAGGGCATAAGG - Intergenic
1080420936 11:32109922-32109944 CTGGGTCCTCACATGGCAGAAGG - Intergenic
1082737045 11:56867021-56867043 CAGGAAGCACACAAGGGAGCTGG + Intergenic
1083285755 11:61657690-61657712 CATGGCGGCCACAAGGCAGATGG + Intergenic
1083366175 11:62142682-62142704 CAGAGTCCACAGAAGGCAGATGG - Intronic
1083878558 11:65537320-65537342 CAGGGAGCAGGCTAGGCAGATGG + Intronic
1084568351 11:69944295-69944317 CAGGGTGCGGACAGGGCAGGAGG + Intergenic
1084876299 11:72136143-72136165 CAGCATGCACACAGGTCAGAGGG + Intronic
1084881271 11:72173212-72173234 CAGCATGCACACAGGTCAGAGGG + Intergenic
1087604968 11:100366332-100366354 CTGCCTGCACACAAGGCAGAGGG + Intergenic
1088357837 11:108961709-108961731 CCGTGGGCACACAGGGCAGAAGG + Intergenic
1088511578 11:110580895-110580917 CTGGGTGTGCACATGGCAGATGG + Exonic
1088628369 11:111749819-111749841 CAGTGTGAAAGCAAGGCAGATGG - Intronic
1089019219 11:115194822-115194844 GAGGGGACACACAGGGCAGAAGG + Intronic
1089360631 11:117883959-117883981 CAGGCTGCCCCCAAGGCTGATGG - Intergenic
1089638938 11:119834200-119834222 CAGGGTGCAGACAAAATAGATGG - Intergenic
1089663525 11:120001570-120001592 CAGAGAGCACACAGGGCAGGTGG - Intergenic
1089729763 11:120512425-120512447 CAGGGGGCAGTCGAGGCAGATGG - Intronic
1089881036 11:121773956-121773978 CAGGGGTCACACATGGCATAAGG + Intergenic
1089972038 11:122701781-122701803 CAGAGTTCAGAAAAGGCAGATGG - Intronic
1090055730 11:123422850-123422872 CAGAGTGAACACGAGGGAGAAGG - Intergenic
1091106012 11:132920567-132920589 CAGGGTGCACACATGGCCCCAGG + Intronic
1092085824 12:5758608-5758630 CAGGGCTCACACAAAGCATAAGG + Intronic
1092171090 12:6374550-6374572 CTGGGAGCACACCAGGCGGATGG + Exonic
1092992523 12:13916849-13916871 CATGGTGCACACAAGACATCTGG + Intronic
1093158997 12:15722751-15722773 CAGTGTCCTCACATGGCAGAAGG + Intronic
1093655367 12:21688057-21688079 CAGTGTCCACACATGCCAGAGGG - Intronic
1095185785 12:39199106-39199128 CAGGGTGTTCCCCAGGCAGAAGG + Intergenic
1096446661 12:51699208-51699230 CAGGGAGCATTCCAGGCAGAGGG + Intronic
1097704557 12:62854423-62854445 TAGTGTGCACATAAGGCAAAAGG - Intronic
1099620523 12:84997368-84997390 GAAAGTGCACACAAGGCAGTTGG - Intergenic
1101150920 12:101881627-101881649 CAGGGAGAACACCTGGCAGAGGG - Intronic
1101646012 12:106631587-106631609 CTGTGTTCACACATGGCAGAAGG - Intronic
1101995767 12:109523886-109523908 CAGGGTGCAGACATGGCCCAGGG - Intronic
1102029542 12:109731979-109732001 CAGGGTGCACAGCAGTGAGAAGG - Intronic
1102487491 12:113268102-113268124 CAGGGCACCCACAAGGCTGAGGG - Intronic
1103057408 12:117832756-117832778 TAGGTTGGACCCAAGGCAGAAGG - Intronic
1103222122 12:119254724-119254746 CTGGGTCCTCACATGGCAGAAGG + Intergenic
1103995450 12:124827056-124827078 CAGGGGCCAGACCAGGCAGAGGG - Intronic
1104690052 12:130818796-130818818 CAGGGTGCAAGCCAGGCTGACGG + Intronic
1104906189 12:132214663-132214685 CAGGCTGGACAGGAGGCAGAGGG - Intronic
1104969411 12:132524419-132524441 CAGGGTGCACACAAGGCAGACGG - Intronic
1107634756 13:42381001-42381023 CAGGGTGCACAGAGGGGAGGGGG + Intergenic
1107988621 13:45797601-45797623 CAGGGTGCACACAAATCACCTGG + Intronic
1110076810 13:71256238-71256260 CTGTGTGCTCACATGGCAGAAGG + Intergenic
1110157037 13:72329920-72329942 CTGTGTCCTCACAAGGCAGAAGG + Intergenic
1112594481 13:100795464-100795486 CAGGGTCAAGACAAAGCAGAGGG - Intergenic
1113074167 13:106451726-106451748 CTGGGTCCTCACATGGCAGAAGG - Intergenic
1113138147 13:107116839-107116861 CAGGGTGGGCAGAAGGCAGAGGG + Intergenic
1113581208 13:111430812-111430834 CAGAGGCCACCCAAGGCAGAGGG - Intergenic
1114574368 14:23699163-23699185 CAGTGTCCACACATGACAGAAGG - Intergenic
1115658076 14:35463118-35463140 CAGGGTGGGAACCAGGCAGATGG - Intergenic
1116060753 14:39921386-39921408 CAGGTTTCTCACATGGCAGAAGG + Intergenic
1116994370 14:51307015-51307037 CAGGGAGCTTACAATGCAGAGGG - Intergenic
1117447652 14:55820182-55820204 CAGGTAGCACACAAGGGAGTAGG + Intergenic
1118889234 14:69894204-69894226 CATGCACCACACAAGGCAGAGGG - Intronic
1122281560 14:100625832-100625854 CTGTGTCCTCACAAGGCAGAAGG - Intergenic
1122738586 14:103857735-103857757 CAGTGTCCACACATGCCAGAAGG - Intergenic
1122794684 14:104200229-104200251 CAGGCTGCACAGTAGGCAGATGG - Intergenic
1124026010 15:25966516-25966538 CAGCGTGCTCAAAAGGAAGAGGG + Intergenic
1124256457 15:28146673-28146695 CAGTGTGCAGCCAAGTCAGATGG + Intronic
1124567773 15:30832420-30832442 CAGTGTGCAGCCAAGTCAGATGG - Intergenic
1124631630 15:31340978-31341000 CAGGATGAACACAGGGCACAGGG - Intronic
1124653281 15:31488154-31488176 AAGGGTAAACACCAGGCAGAAGG + Intronic
1126098709 15:45106960-45106982 CAGGGTGCACCTGAGGGAGAGGG + Exonic
1127353026 15:58171473-58171495 GAGGGGGCACACAGGGCAGTGGG - Intronic
1127819914 15:62645662-62645684 CAAGATGGCCACAAGGCAGAGGG - Intronic
1128858710 15:71045888-71045910 CACTGTGCACACATGGAAGATGG - Intronic
1130938797 15:88491080-88491102 CAAGGTGCAGAGAAGGCAGGTGG - Intergenic
1131511869 15:93053653-93053675 CTGGGTTCACACAAGGCTGCTGG - Intronic
1131957045 15:97748010-97748032 CAGGGAGCAGCGAAGGCAGAGGG - Intergenic
1132534529 16:471510-471532 CACGGTGCACACAGGGCGGGAGG - Intronic
1132574555 16:658521-658543 CAGGGTGGACACCGGGCAGCTGG - Exonic
1132852655 16:2031681-2031703 CAGGGGGCACCCAAGGAACAGGG + Intronic
1132995430 16:2820113-2820135 AAAGGTGCACACCAGGCAGGGGG - Intronic
1133231707 16:4370031-4370053 GGGGGTGAACACCAGGCAGATGG + Intronic
1133255079 16:4511749-4511771 CAGTGAGGACACAGGGCAGACGG + Exonic
1134285674 16:12860162-12860184 CTGGATGCTCACATGGCAGAAGG - Intergenic
1135922931 16:26667517-26667539 CAGGGTTCCCACAGAGCAGAAGG + Intergenic
1138132287 16:54490801-54490823 CAGGTTGCACACTGGGAAGAAGG - Intergenic
1141714015 16:85716634-85716656 GAGGGAGCAGACAAGGCAGAGGG + Intronic
1142298350 16:89241461-89241483 CACAGGGCACACAGGGCAGACGG + Intergenic
1142660053 17:1422529-1422551 CAAGTTGCACAGAATGCAGAGGG + Exonic
1143741075 17:8954474-8954496 CACGGTGTTTACAAGGCAGAGGG - Intronic
1144232346 17:13220700-13220722 CAGGGTGAAGGCAAGGTAGATGG + Intergenic
1145056650 17:19707658-19707680 CAGGGTGGTCAGCAGGCAGAGGG - Intronic
1146004981 17:29155419-29155441 CAGGGTCCACACAGGGCGGCAGG - Intronic
1146212926 17:30956191-30956213 GAGGGTGCCCCCAGGGCAGAGGG - Intronic
1146262909 17:31433394-31433416 CAGGGGGCACAGAACACAGAAGG + Intronic
1146516711 17:33495299-33495321 CAGGGGCCAAACAAGGCAGCAGG - Intronic
1147267578 17:39244236-39244258 GAGGGAGCACACAAGGAAGGAGG - Intergenic
1147440357 17:40443743-40443765 CAGGGCGGCCACGAGGCAGAGGG - Exonic
1149389277 17:56173281-56173303 CAGGGGGAACAGAAGGCAAAGGG - Intronic
1150333573 17:64313882-64313904 CAAGGTCCACAGAAGGCAGGTGG + Intergenic
1151334674 17:73432930-73432952 GAGGAAGCACACAGGGCAGATGG + Intronic
1152395723 17:80031633-80031655 AAGGGTGCACAAATGGCAGATGG - Intronic
1152507765 17:80762419-80762441 CAGGGTGCAGGCAAGGCTGAGGG + Intronic
1152702559 17:81826210-81826232 GTGTGTGCACACAAGGCAAAGGG - Exonic
1203169290 17_GL000205v2_random:133052-133074 CAGAGTGGACACAAAACAGATGG + Intergenic
1153450251 18:5219189-5219211 CTGTGTGCACAGAAGTCAGAAGG - Intergenic
1153952586 18:10069668-10069690 CAGGGTGGAGACATGGGAGAGGG + Intergenic
1154014617 18:10605232-10605254 CCCTGTGCTCACAAGGCAGAGGG - Intergenic
1154136587 18:11785327-11785349 ATGGGTGTCCACAAGGCAGATGG + Intronic
1155353875 18:24932226-24932248 CAGGCAGCTCCCAAGGCAGATGG - Intergenic
1155700490 18:28737107-28737129 CTGTGTACACACATGGCAGAAGG - Intergenic
1156481905 18:37441630-37441652 GAGGGTGACCACAAAGCAGATGG - Intronic
1157231480 18:45920547-45920569 CTGCGTCCACACATGGCAGAAGG + Intronic
1157489648 18:48113824-48113846 CAGGGTGCACTCCAGGAAGCAGG + Intronic
1157546323 18:48549146-48549168 CAGGGTGCACATAGGGGTGATGG + Intronic
1157810977 18:50695602-50695624 CAGGGTGATGACAAGACAGAAGG + Intronic
1158396220 18:57080146-57080168 CTGTGTGCTCACATGGCAGAAGG - Intergenic
1158900407 18:61957151-61957173 CAGGGTGGACAACTGGCAGAAGG - Intergenic
1159479779 18:68974264-68974286 CTGGGTCCTCACATGGCAGAAGG - Intronic
1159980716 18:74776191-74776213 ATGTGTCCACACAAGGCAGAAGG - Intronic
1160145442 18:76360040-76360062 CAGGGTGCACAGAGTGCAGGAGG - Exonic
1161200096 19:3009757-3009779 CAGGGAGCTCCCAAGGCAGTGGG - Intronic
1162453992 19:10771531-10771553 CAAGGAGCCCACAAGGTAGAGGG - Intronic
1164896465 19:31881607-31881629 CACGGTGGAAAGAAGGCAGAGGG + Intergenic
926289979 2:11521004-11521026 CATGGAGCCCACACGGCAGAGGG - Intergenic
926498078 2:13616587-13616609 CTGTGTCCTCACAAGGCAGAAGG - Intergenic
927374294 2:22395559-22395581 CAGGGTGAACAAAAGATAGAAGG + Intergenic
928424545 2:31167196-31167218 CAAGGGGCACAAAAGACAGATGG + Intergenic
928432006 2:31227983-31228005 GTGGGTGCCCACCAGGCAGAGGG + Intronic
929055867 2:37875514-37875536 CTGGCTCCACCCAAGGCAGACGG + Intergenic
929911571 2:46094159-46094181 CAGCAGGCACACAGGGCAGAAGG - Intronic
930257441 2:49108531-49108553 CTGGCTGCAAACTAGGCAGAAGG + Intronic
930920250 2:56744512-56744534 CAGTGTGCACCCAAGGTTGAAGG - Intergenic
934609804 2:95726704-95726726 CAGGGTCCTCACATGGCAGGGGG + Intergenic
934663966 2:96157570-96157592 CATGGTTCCCACAGGGCAGAAGG + Intergenic
935214124 2:100962887-100962909 CAGGGTTCTAACAGGGCAGAGGG - Intronic
935310506 2:101778459-101778481 CAGGGTGGACAGCATGCAGAAGG + Intronic
935689837 2:105721033-105721055 CTGTGTGCTCACAGGGCAGAAGG + Intergenic
936062765 2:109306444-109306466 CAGGCTGCACATACCGCAGAAGG + Intronic
936360700 2:111798370-111798392 TTGGGTACATACAAGGCAGAGGG + Intronic
936472522 2:112811685-112811707 CAGGGAGGCCACAAGGCTGATGG + Intergenic
936543126 2:113368274-113368296 CAGGGTCCTCACATGGCAGAAGG + Intergenic
937055408 2:118930900-118930922 CTGTGTGCTCACATGGCAGATGG + Intergenic
937986677 2:127641170-127641192 CAGGATTCACACTGGGCAGAGGG + Intronic
938238997 2:129728561-129728583 CAGGTTCAATACAAGGCAGATGG + Intergenic
938606805 2:132902587-132902609 CAGACTGCACACAAGTGAGAAGG - Intronic
938981527 2:136531882-136531904 CAGGGTGCACACCAAGAAGCAGG + Intergenic
939195948 2:138972394-138972416 CAGGGTGGAGAGAAGGCAGGAGG + Intergenic
939271073 2:139940415-139940437 CTGGGTGCTCACAAGGCAGATGG + Intergenic
939584037 2:143985226-143985248 GAGGGAGCACACAAGCCAGGGGG - Intronic
940223982 2:151382823-151382845 CAGGGTGCTCACAAAGCAGGAGG + Intergenic
940495408 2:154422005-154422027 CAGCGTGCACAGAGAGCAGAGGG + Intronic
943101041 2:183486900-183486922 CAGGGTCCAGAGAAGGCAGAGGG + Intergenic
944473413 2:200079819-200079841 CAAGGTGGACAAAAGGCAGAAGG + Intergenic
946190673 2:218006208-218006230 GAGGGTGGAGCCAAGGCAGAAGG + Intergenic
946584386 2:221168158-221168180 CAGTATGCATACAAGGGAGATGG + Intergenic
947760246 2:232599005-232599027 CAGGGTGCACACTAAGCAGGAGG + Intergenic
948119961 2:235522654-235522676 GAGGCTGGCCACAAGGCAGAGGG + Intronic
1169331398 20:4719302-4719324 CTGTGTGCCCACATGGCAGAAGG + Intergenic
1169570341 20:6899120-6899142 CAGGGTGCGAGCAAGGCAGCAGG - Intergenic
1169596952 20:7211409-7211431 GAGTGTGCATACAAGGCAAAGGG - Intergenic
1169907517 20:10618424-10618446 TAGGGTGGACATGAGGCAGATGG + Intronic
1170050970 20:12144954-12144976 CAGGGTGCACACACGTCATCTGG + Intergenic
1171187344 20:23132319-23132341 CAGGGAGCTCATATGGCAGAAGG + Intergenic
1171458472 20:25285167-25285189 CGTGGTGCCCACACGGCAGAGGG - Intronic
1171534055 20:25870603-25870625 CAGTGTCCTCACATGGCAGAAGG + Intergenic
1172162020 20:32875403-32875425 CAGGGGGCACAGAAGGGAGATGG - Intronic
1172225569 20:33303046-33303068 CAGGGTGAACAAAGGGCGGAGGG - Exonic
1173555218 20:43961111-43961133 CGGGGTGCCCCCATGGCAGAGGG + Intronic
1173595057 20:44253669-44253691 CAGGGGGCAGAGATGGCAGATGG + Intronic
1173596613 20:44262604-44262626 AAGAGTGAACACAAGGCATAGGG - Intronic
1174159858 20:48543040-48543062 CAGGGTCCAAGCAAGCCAGACGG + Intergenic
1175206894 20:57317971-57317993 CAGGGGGCACAAGGGGCAGAAGG - Intergenic
1176040107 20:63060767-63060789 CAGGGTGCCCGGAAGGCGGAAGG + Intergenic
1176402467 21:6326099-6326121 CAGAGTGGACACAAAACAGATGG - Intergenic
1176434690 21:6663005-6663027 CAGAGTGGACACAAAACAGATGG + Intergenic
1176458952 21:6990075-6990097 CAGAGTGGACACAAAACAGATGG + Intergenic
1177771345 21:25519545-25519567 CAGTGTTCACTCAAGGCTGAAGG - Intergenic
1178818879 21:35957211-35957233 CAGGCTGAATACAAGACAGAAGG + Intronic
1178821528 21:35979504-35979526 CTGGGTCCTCACAGGGCAGAAGG - Intronic
1180843309 22:18969277-18969299 CAGCCTCCACACCAGGCAGAGGG + Intergenic
1180879266 22:19192432-19192454 CAGGGAGCATGCAAGCCAGATGG + Intronic
1181058162 22:20269458-20269480 CAGCCTCCACACCAGGCAGAGGG - Intronic
1181514703 22:23403912-23403934 CAGCCTCCACACCAGGCAGAGGG - Intergenic
1181770126 22:25119181-25119203 CAGGGTGGACACAAGAATGAAGG - Intronic
1183086973 22:35492321-35492343 CAGGGAGCACACCAGACACAGGG - Intergenic
1183455809 22:37922432-37922454 CAGGGTGCAGTCAGGGCAGGGGG + Intronic
1183933003 22:41246799-41246821 CACGGTGTGCAGAAGGCAGAGGG - Intronic
1184253762 22:43275768-43275790 CAGGGAGAACAACAGGCAGATGG + Intronic
1184456689 22:44614905-44614927 CTGGGTCCTCACAAGGGAGAGGG - Intergenic
1184471167 22:44697286-44697308 CAGGGTGGTCGCACGGCAGAAGG - Intronic
1184672948 22:46025158-46025180 CAGGGTGCACTGCAGGGAGAGGG - Intergenic
1184672975 22:46025297-46025319 CAGGGTGCACTGCAGGGAGAGGG - Intergenic
1184673014 22:46025485-46025507 GAGGGAGCACCCAAGGGAGAGGG - Intergenic
1184673040 22:46025625-46025647 CAGGGTGCACTGCAGGGAGAGGG - Intergenic
1184769651 22:46589781-46589803 CAGGGTGCACACAAAGCAGGTGG - Intronic
1184849513 22:47112286-47112308 CTGGGTGAACACTGGGCAGAAGG - Intronic
1185233049 22:49694220-49694242 CATGGTGCTCACAGGCCAGATGG - Intergenic
950525550 3:13520800-13520822 CAGGGGGCAGAGAAGGCTGAGGG + Intergenic
954371787 3:50172794-50172816 CTGGCTGCCCACCAGGCAGAGGG - Intronic
954914345 3:54136002-54136024 CAGGGAGCAGACAAGGCATGGGG - Intronic
955918442 3:63929819-63929841 CAGGGCGGGCACAAGGCCGATGG + Intronic
956165226 3:66393244-66393266 CAGTGAGCACAAAAGGCAGGAGG + Intronic
956689627 3:71863860-71863882 CAGGGTCATCAGAAGGCAGAGGG + Intergenic
957591058 3:82198428-82198450 CAGAGTGCACACAATACTGAAGG - Intergenic
959661554 3:108874152-108874174 CAGTGTGCACACAAGACAAGGGG + Intergenic
960169545 3:114442660-114442682 CAGGGTGTGCTCAAGTCAGAAGG - Intronic
960732699 3:120743822-120743844 CAGGGTAGACAGAGGGCAGAGGG + Intronic
960966647 3:123110343-123110365 CACGGAGCACACAGGGCAGAAGG - Intronic
960974716 3:123162871-123162893 CAGGGTGCACAGCAAGCAGCTGG - Intronic
962467482 3:135673874-135673896 CTGTGTGCTCACATGGCAGAAGG + Intergenic
963728503 3:148948118-148948140 CAGGGATCCCACAAGGCAAAGGG - Intergenic
964137561 3:153362020-153362042 CAGGCTGCACACAAGCCTGGTGG + Intergenic
964788499 3:160427225-160427247 CAGGGAGCACACATGTAAGATGG + Intronic
966216559 3:177508863-177508885 GGGGGTCAACACAAGGCAGAGGG - Intergenic
966433354 3:179855767-179855789 CTGGGTCCTCACATGGCAGAAGG - Intronic
967808371 3:193734771-193734793 CCGTGTGCACACAAACCAGATGG - Intergenic
968004155 3:195228031-195228053 CAGGAGGCACTCAAGCCAGAAGG + Intronic
968488025 4:873590-873612 CAGGCAGCACAAAGGGCAGAAGG - Intronic
968622045 4:1608249-1608271 CAGGGTGCAGGCACGGCAGGTGG - Intergenic
969065665 4:4478584-4478606 CAGGGTGGACAAAAGAAAGATGG + Intronic
969485583 4:7470758-7470780 CATGGAGCCCACAAGGCAGTGGG + Intronic
969719247 4:8884054-8884076 CAGCGTCCTCACATGGCAGAAGG - Intergenic
971324569 4:25633556-25633578 AAGGGGGCACACAAGGCTGAAGG + Intergenic
971739719 4:30503870-30503892 CACTTTGGACACAAGGCAGAAGG + Intergenic
972349721 4:38225531-38225553 CAGGGGACCCAGAAGGCAGAAGG - Intergenic
974062335 4:57046738-57046760 GAGGGTGGGTACAAGGCAGAGGG - Intronic
976356267 4:84121025-84121047 CAGGGAGACCACAAGGTAGAAGG + Intergenic
980706659 4:136505336-136505358 GAAAGTGCACAGAAGGCAGATGG + Intergenic
980900055 4:138896430-138896452 CAGTGTCCTCACACGGCAGAAGG + Intergenic
982064806 4:151644790-151644812 CAGGGTGCACAGCAGGAACAGGG - Intronic
983526608 4:168766508-168766530 CTGGGAGCACCCAAGGCAGGCGG + Intronic
985563457 5:603539-603561 CAGGCTGGACACCAGGCAGACGG + Intergenic
985607348 5:865134-865156 CAGGGTCCACAGAGGGCACAGGG + Intronic
985966017 5:3339217-3339239 CACGGTGCACAAAGAGCAGAGGG + Intergenic
988707407 5:33739809-33739831 AAGGGTGTAAAGAAGGCAGAAGG + Intronic
991689797 5:69214912-69214934 CTGTGTGCTCACATGGCAGAAGG - Intergenic
996538912 5:124608555-124608577 CAGAGTGAAGAGAAGGCAGATGG + Intergenic
996879334 5:128276867-128276889 CAGTGTGCACAAAAGCCAGGAGG - Intronic
997655252 5:135549603-135549625 CAGGGAGCACTCCAGGCAGGAGG - Intergenic
998253820 5:140570040-140570062 CAGGGTGCAGACTAGGCTGGGGG - Intronic
998286224 5:140863300-140863322 CAGGCTGGACACCACGCAGATGG - Intronic
1000379988 5:160620471-160620493 CAGGGTGCAGAGGAGGCTGAAGG + Exonic
1002359377 5:178658588-178658610 CTGTGTGCACACAGGGAAGATGG + Intergenic
1003192078 6:3883116-3883138 CAGGAGGCACAGAAGGCACAGGG - Intergenic
1006385536 6:33728765-33728787 AAGGGTGCTCAGGAGGCAGAGGG - Intronic
1007266311 6:40598969-40598991 CAAGTTGCAATCAAGGCAGAGGG + Intergenic
1007702810 6:43774347-43774369 CAGGCTGCACCCATGGCAGAAGG + Exonic
1008444573 6:51572911-51572933 TAGGGTCCACACAAAGTAGATGG - Intergenic
1010091064 6:71982612-71982634 TAGGGAGCACACAAGGAAGTGGG - Intronic
1010339580 6:74732555-74732577 CTGGGTCCTCACATGGCAGAAGG - Intergenic
1011002917 6:82611238-82611260 CAGGAAGATCACAAGGCAGAAGG + Intergenic
1011403244 6:86987794-86987816 CAGTGTCCTCACATGGCAGAAGG + Intronic
1013612997 6:111812447-111812469 CAAAGTGCACACCAAGCAGATGG - Intronic
1013729643 6:113149372-113149394 CAGGGAGCACACATGCCACATGG - Intergenic
1017273119 6:152532670-152532692 AAGGGTGCACAGAATGCACATGG - Intronic
1018127021 6:160691644-160691666 CAGTGTCCTCACATGGCAGAAGG - Intergenic
1018149537 6:160925436-160925458 CAGTGTCCTCACATGGCAGAAGG + Intergenic
1018442246 6:163823908-163823930 AAGGTTGCAAACCAGGCAGAGGG + Intergenic
1019480499 7:1264582-1264604 CAGGGTGCACACAGGGTGGGTGG - Intergenic
1020040268 7:4996286-4996308 CAGGGTGCAGCCAAGGCCCAGGG + Intronic
1022525973 7:31037564-31037586 CAGGGTGCTCAGAAGAGAGATGG - Intergenic
1024220647 7:47283989-47284011 CTGGGTGCATGTAAGGCAGATGG + Intronic
1024325408 7:48105711-48105733 CTGTGTGCTCACATGGCAGAAGG + Intronic
1024385581 7:48748278-48748300 CAGGGTGCACACTTGTCAGCTGG + Intergenic
1025250727 7:57349786-57349808 GAGGGCGAACACCAGGCAGAGGG + Intergenic
1026376698 7:69758807-69758829 TAGAGGGCACACAAAGCAGAAGG - Intronic
1027542966 7:79491731-79491753 CAGTGTGAAGACAAGGAAGATGG - Intergenic
1028082371 7:86594363-86594385 CAGGCTGCAAATAAAGCAGATGG - Intergenic
1028230999 7:88306550-88306572 CAGGGTGCAGACAAGCCCAAAGG - Intronic
1030115666 7:106060501-106060523 AAGGCTGCACACTAGGGAGAGGG - Intergenic
1033534969 7:142303704-142303726 CATGGTGGACCAAAGGCAGAAGG - Intergenic
1035367347 7:158357768-158357790 CAGGAAGCTCACAAGGCAGGAGG + Intronic
1035619444 8:1026410-1026432 CAGGGTGCAGCCAAGGCGGCGGG - Intergenic
1037689918 8:21172935-21172957 CTGGGTGCACAAAAGTTAGAAGG - Intergenic
1037834653 8:22208873-22208895 CCAGGTGCACAAAAGCCAGAGGG + Intronic
1037921910 8:22812892-22812914 CAGGGTGGAGACAAGGAAAAAGG - Intronic
1038400329 8:27279649-27279671 CAGGGTGTAGACAGGGGAGAGGG + Intergenic
1039913565 8:41843529-41843551 CATGGTGCAGACAGGGCAGCTGG + Intronic
1040386017 8:46915623-46915645 CAGGGTGCATGCAAGACACAAGG + Intergenic
1040493027 8:47942308-47942330 CAGGGGGAACACAAGTCTGACGG + Intronic
1042620056 8:70694569-70694591 CTGAGTCCACCCAAGGCAGAAGG - Intronic
1047806555 8:128367036-128367058 CAGGATGAACCCAAGGCACATGG - Intergenic
1047809223 8:128390208-128390230 CTGGGAGGACACAAGACAGAGGG + Intergenic
1048382775 8:133882685-133882707 CAAGGGGCACACAGGGAAGAAGG - Intergenic
1048565920 8:135597181-135597203 CAGTGTCCCCACAGGGCAGAAGG + Intronic
1048933977 8:139340150-139340172 CTGGGAGCACACACAGCAGAGGG - Intergenic
1049340484 8:142109728-142109750 CAGGGTGCAGAGGAGGCAGCTGG - Intergenic
1049619505 8:143591703-143591725 CTGGGTGCAGACCAGGCAGGTGG - Intronic
1051963955 9:22803194-22803216 CTGTTTGCTCACAAGGCAGAAGG + Intergenic
1052339966 9:27355232-27355254 CATGGTGGAGGCAAGGCAGAGGG + Intronic
1053196783 9:36125954-36125976 CAGGGTGCTCACAGGACAGAGGG - Intergenic
1055372665 9:75617067-75617089 CAGGGAGCAAACAAGGCTGCTGG - Intergenic
1055802922 9:80060253-80060275 CAGGTTTCTCACAAGGCAGATGG + Intergenic
1056468147 9:86879126-86879148 CAGGGTCATCAGAAGGCAGAGGG + Intergenic
1056826182 9:89877900-89877922 CAGTATGCACAGAAGGCAAACGG - Intergenic
1058173154 9:101706822-101706844 AACGTTGCACACAAGGGAGACGG + Intronic
1058884586 9:109313676-109313698 CAGGCAGCACACAGCGCAGATGG + Intronic
1059953818 9:119495472-119495494 CAGGGAGCATACCAGGCTGAGGG + Exonic
1060229810 9:121818300-121818322 CAGGGAGCCAACAAGGCAGCCGG + Intergenic
1060606446 9:124918837-124918859 CAGGAGGCAGAAAAGGCAGAAGG - Intronic
1061619282 9:131800930-131800952 CAGGGTGCACAGCAGGCAGTGGG - Intergenic
1062026946 9:134344901-134344923 CTGGGTCCACACCAGGCACAGGG - Intronic
1062154205 9:135037339-135037361 CAGCAGGCACAGAAGGCAGAGGG + Intergenic
1062267025 9:135691355-135691377 CACAGTGCACACAATGCACACGG + Intergenic
1203436846 Un_GL000195v1:145639-145661 CAGAGTGGACACAAAACAGATGG - Intergenic
1185697877 X:2209005-2209027 CTGTGTGCTCACAAGGCAGTGGG + Intergenic
1185913981 X:4014380-4014402 AAGTGTCCACACATGGCAGAAGG - Intergenic
1186891063 X:13959706-13959728 CAGGGTTAACCCAAGGCCGAGGG + Intergenic
1190061586 X:47215078-47215100 CAGGTTTCAAACAAGGTAGAAGG - Exonic
1190801616 X:53794658-53794680 TAGGCTGCACATAAGGCAGAGGG + Intergenic
1191902428 X:66054335-66054357 CAGGATGTAGACAAGGCAGGTGG + Intergenic
1191910681 X:66146223-66146245 CTGTGTCCTCACAAGGCAGAAGG - Intergenic
1199400231 X:147390069-147390091 CAGGGTGCACACTCGTCAGCTGG - Intergenic
1199797458 X:151214174-151214196 CTGTGTCCTCACAAGGCAGATGG + Intergenic