ID: 1104970157

View in Genome Browser
Species Human (GRCh38)
Location 12:132527430-132527452
Sequence CAGGAGGACGACAGCCCCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 256
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 232}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104970144_1104970157 19 Left 1104970144 12:132527388-132527410 CCCAGAGCTGCTGCAGGGGAGCC 0: 2
1: 0
2: 0
3: 46
4: 330
Right 1104970157 12:132527430-132527452 CAGGAGGACGACAGCCCCTGGGG 0: 1
1: 0
2: 1
3: 22
4: 232
1104970145_1104970157 18 Left 1104970145 12:132527389-132527411 CCAGAGCTGCTGCAGGGGAGCCT 0: 1
1: 2
2: 0
3: 52
4: 316
Right 1104970157 12:132527430-132527452 CAGGAGGACGACAGCCCCTGGGG 0: 1
1: 0
2: 1
3: 22
4: 232
1104970149_1104970157 -2 Left 1104970149 12:132527409-132527431 CCTCAGACTGGCTGGGCCCCTCA 0: 1
1: 0
2: 10
3: 39
4: 289
Right 1104970157 12:132527430-132527452 CAGGAGGACGACAGCCCCTGGGG 0: 1
1: 0
2: 1
3: 22
4: 232

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104970157 Original CRISPR CAGGAGGACGACAGCCCCTG GGG Intronic
900352131 1:2240175-2240197 CCGGAGGACAGCAGCCTCTGTGG - Intronic
900547157 1:3235572-3235594 CAGGAGGCTATCAGCCCCTGGGG - Intronic
900553658 1:3269227-3269249 GAGGAGGAGGACGGCCCCAGAGG + Intronic
900553687 1:3269361-3269383 CAGGAGGAGGACAGTCCCAGAGG + Intronic
900553700 1:3269408-3269430 CGGGAGGAGGACAGTCCCAGAGG + Intronic
900553744 1:3269591-3269613 CGGGAGGAGGACAGTCCCAGAGG + Intronic
900553768 1:3269700-3269722 CAGGAGGAGCACAGTCCCGGAGG + Intronic
900553781 1:3269759-3269781 CTGGAGGAGGACAGTCCCAGAGG + Intronic
900553845 1:3270051-3270073 CCGGAGGATGACAGTCCCAGAGG + Intronic
900553880 1:3270201-3270223 CCGGAGGAGGACAGTCCCAGAGG + Intronic
900553893 1:3270259-3270281 CAGGAGGAGCACAGTCCCGGAGG + Intronic
900553924 1:3270399-3270421 CAGGAGGAGGACAGTCCCAGAGG + Intronic
900553979 1:3270660-3270682 CAGGAGGAGGACAGTCCCAGAGG + Intronic
900554003 1:3270751-3270773 CAGGAGGAGGACAGTCCTGGAGG + Intronic
900554006 1:3270767-3270789 CTGGAGGAGGACAGTCCCAGAGG + Intronic
900554016 1:3270798-3270820 CGGGAGGAGGACAGTCCCAGGGG + Intronic
900987643 1:6082497-6082519 CAGGGGGACCACAGTCCCTCTGG + Intronic
901192480 1:7420863-7420885 CAGGATGATGTCAGCACCTGTGG - Intronic
902255740 1:15187512-15187534 GAGCAGGCAGACAGCCCCTGGGG - Intronic
902289166 1:15425647-15425669 CAGGAGGCTGCCAGGCCCTGTGG + Intronic
902402424 1:16165559-16165581 CAGGATGCCCTCAGCCCCTGAGG + Intergenic
903380860 1:22896124-22896146 CAGGTGGACAGAAGCCCCTGGGG + Intronic
904282101 1:29427752-29427774 CAGAGGGAGGGCAGCCCCTGAGG - Intergenic
904441920 1:30537552-30537574 CTGGAGGCCGAAAGACCCTGTGG - Intergenic
905381868 1:37567847-37567869 CAGGAGGAGGACACCCAATGTGG + Intronic
905864600 1:41369860-41369882 CAGGAGGGAGGGAGCCCCTGGGG + Intronic
906147112 1:43566709-43566731 CAGGAGGGCTCCAGCCCCTCAGG - Intronic
906209581 1:44004973-44004995 CAGCACAACCACAGCCCCTGTGG - Intronic
907304722 1:53507117-53507139 CAGGAGGGGACCAGCCCCTGAGG - Intronic
907675018 1:56510166-56510188 CAGCAGGAGGACAGCCCGCGGGG - Intronic
912658498 1:111508215-111508237 CAGGAGGTCTCCAGGCCCTGGGG + Intronic
915751151 1:158212517-158212539 GAGGAGGCAGACAGTCCCTGGGG + Intergenic
916190296 1:162171512-162171534 CAGGAAGAAGCCAGCCACTGAGG - Intronic
916787265 1:168095709-168095731 GAGGAGGAAGACAGCAGCTGAGG + Intronic
918072139 1:181141041-181141063 CAAGAGGAAGTCACCCCCTGAGG + Intergenic
918074435 1:181159674-181159696 GAGGAGGAGGCCAGCCACTGGGG - Intergenic
921168331 1:212523735-212523757 CAGGAGCAGGACAGCCTCAGCGG + Intergenic
922902412 1:229147247-229147269 CAGGCAGACGACACCTCCTGGGG - Intergenic
924945720 1:248845586-248845608 CAAGAGGAGGACATCCCATGCGG + Exonic
1063114861 10:3066684-3066706 CAGGAGCACCACAGCCCCCATGG + Intronic
1065970682 10:30803841-30803863 CAGCAGGAGGGCAGCCCCTGAGG + Intergenic
1066107348 10:32167512-32167534 CAGGAGGATGACAGCCCCCATGG + Intergenic
1067944398 10:50681124-50681146 CTGGAGCAAGGCAGCCCCTGGGG - Intergenic
1068443485 10:57090266-57090288 CAGGAGGATGACACATCCTGAGG + Intergenic
1068443863 10:57095378-57095400 CAGGAGGCAGACAGTCTCTGGGG + Intergenic
1069555423 10:69394641-69394663 CAGGAGGAGGACAGGCTCTCGGG + Intronic
1070865898 10:79707995-79708017 CTGGAGCAAGGCAGCCCCTGGGG - Intronic
1070879692 10:79846126-79846148 CTGGAGCAAGGCAGCCCCTGGGG - Intronic
1071336373 10:84603919-84603941 CAGGAAGACAACAGCCTCAGAGG - Intergenic
1071632798 10:87230216-87230238 CTGGAGCAAGGCAGCCCCTGGGG - Intronic
1071646247 10:87362434-87362456 CTGGAGCAAGGCAGCCCCTGGGG - Intronic
1072318109 10:94222997-94223019 CAGCTGGACGACAGCCAGTGTGG + Intronic
1072521800 10:96236130-96236152 TAGGAGCACCAGAGCCCCTGGGG + Intronic
1075266977 10:121009256-121009278 CAGGAGAGGGACAGCCCCTCAGG - Intergenic
1076221696 10:128739047-128739069 CAGGAGGCAGAGAGCCCATGGGG - Intergenic
1076351187 10:129816172-129816194 CAGGAGGATTCCAGCCCCCGGGG - Intergenic
1076469683 10:130709856-130709878 CAGGAGGCAGACAGGCCTTGGGG + Intergenic
1076861807 10:133141387-133141409 GGGAAGGACGGCAGCCCCTGTGG + Intergenic
1078879216 11:15431613-15431635 CAGGAGGAGGCCAGCCCCCTGGG - Intergenic
1081537892 11:44008465-44008487 CAGAAGAAGGACAGCCCCTGTGG - Intergenic
1083453476 11:62762202-62762224 TAGAATGAGGACAGCCCCTGTGG + Intronic
1083973837 11:66100933-66100955 CTGGAGGAGGACAGGCACTGAGG - Intronic
1084174760 11:67417461-67417483 CTGGAGGAAGAGGGCCCCTGGGG + Exonic
1084981217 11:72829801-72829823 CAGCAGGAAGAAAGGCCCTGAGG + Intronic
1085284380 11:75350551-75350573 CTGGAGCAGGACAGCCCCTGGGG - Intronic
1088819970 11:113448596-113448618 CAGGAGGAAGACAGAGCCAGAGG + Intronic
1089353373 11:117834003-117834025 TAGGAGGGCCACAGCACCTGGGG + Intronic
1089584855 11:119503814-119503836 CTGGAGGATGACAGACCCAGTGG - Intergenic
1091317926 11:134628666-134628688 CAGCAGGAAGACAGCCACAGCGG + Intergenic
1097492007 12:60282553-60282575 CAGGAGGCAGACAGGCTCTGGGG - Intergenic
1097888044 12:64749654-64749676 CAAGAGGCCGACAGCCCTGGGGG - Intronic
1098651209 12:72972120-72972142 AAGGAGGAGAACAGCCACTGTGG + Intergenic
1101210665 12:102532339-102532361 CATGAAGGCCACAGCCCCTGTGG - Intergenic
1101625844 12:106440407-106440429 AGGGAGACCGACAGCCCCTGAGG - Intronic
1102025283 12:109711150-109711172 CAGGGGTCCGACAGGCCCTGAGG - Intergenic
1102522820 12:113489608-113489630 CTGGAGGATCACAGGCCCTGTGG - Intergenic
1103454051 12:121050790-121050812 CAGGAGGGAGATAGCTCCTGGGG + Intergenic
1104955869 12:132465549-132465571 CAGGTGGCCGAGAGGCCCTGGGG - Intergenic
1104970157 12:132527430-132527452 CAGGAGGACGACAGCCCCTGGGG + Intronic
1105026638 12:132853465-132853487 CAGGAGCCCCACAGGCCCTGGGG - Exonic
1106717945 13:32410265-32410287 CAGAAGGATGACAGGCCCTGCGG - Intronic
1113508348 13:110832083-110832105 CAGTGGGAGGACAGCCCCTCAGG - Intergenic
1114205230 14:20564637-20564659 CAGGAGGACCAGACCACCTGGGG + Intergenic
1117500398 14:56345466-56345488 CAGGAGGAAGACAGGCCGAGGGG + Intergenic
1119423642 14:74522643-74522665 TAGGAGGAGCACAGTCCCTGTGG - Intronic
1120079809 14:80203037-80203059 CAGCAGGAAGTCAGCCACTGAGG + Exonic
1121422318 14:93824496-93824518 CAGGAGGGAGACGGTCCCTGGGG - Intergenic
1122910675 14:104826447-104826469 CAGCAGGACGCCAGGCTCTGGGG - Intergenic
1123092441 14:105747784-105747806 CGGGAGGAGGACAGAGCCTGGGG - Intergenic
1123407089 15:20027098-20027120 CCGGCGGACCACAGCTCCTGTGG + Intergenic
1123516420 15:21033754-21033776 CCGGCGGACCACAGCTCCTGTGG + Intergenic
1124440008 15:29678800-29678822 CAGGAGGACCAGAGCTGCTGGGG - Intergenic
1127452687 15:59132080-59132102 CTTGAGGACAACTGCCCCTGGGG + Intergenic
1129064543 15:72889983-72890005 CAGGAGGAAAACAGATCCTGGGG - Intergenic
1130053356 15:80502460-80502482 CAGGAGGAGGAGAGACCCAGAGG + Intronic
1132659100 16:1053673-1053695 CAGCAAGACAGCAGCCCCTGCGG - Intergenic
1133171611 16:3985617-3985639 CAGAAGGACGGCAGCCCACGTGG - Intronic
1140509176 16:75495078-75495100 AAGGAGCAAGTCAGCCCCTGCGG - Intronic
1140514994 16:75535265-75535287 AAGGAGCAAGTCAGCCCCTGCGG - Intronic
1141789685 16:86226199-86226221 CAGGAGGAGGGCAAGCCCTGGGG + Intergenic
1142490343 17:274426-274448 CGGAGGGAGGACAGCCCCTGTGG - Intronic
1142762176 17:2049261-2049283 CCAGAGGACTTCAGCCCCTGTGG + Intergenic
1145307010 17:21680967-21680989 CAGGAGGAGGAAAGCCCAGGCGG - Intergenic
1148192968 17:45692696-45692718 CAGGAGGAAGATGGACCCTGAGG + Intergenic
1150140834 17:62727151-62727173 CAGGAGGACGAAGGGCTCTGTGG + Intronic
1151293434 17:73166217-73166239 CAGGGTGACAAAAGCCCCTGAGG - Intronic
1151397915 17:73836786-73836808 CATGAGGAAGACAGACACTGAGG - Intergenic
1152157642 17:78645285-78645307 CAGGAGGATGACAGCCTCTGTGG + Intergenic
1152311865 17:79556364-79556386 CAGGAGGAGGAGTGCCCGTGTGG + Intergenic
1152394352 17:80023470-80023492 GCGGAGGCCCACAGCCCCTGCGG + Intronic
1157042922 18:44061239-44061261 CAGGAGGCAGACAGGCTCTGGGG - Intergenic
1157479936 18:48047228-48047250 CAGGAGCATGACATCCCCTTTGG - Intronic
1160605003 18:80043629-80043651 CAGGATGAGGACACCCCCGGAGG + Intronic
1160701468 19:509510-509532 CAGGAGGACCACACTCCCTCTGG + Intronic
1160944034 19:1632959-1632981 CAGGAGGCTGGCAGCCCGTGAGG + Intronic
1160974351 19:1785343-1785365 CACCAGGACACCAGCCCCTGGGG + Intronic
1161773100 19:6241958-6241980 CAGGAGGCGGGCAGCCCCTCTGG - Intronic
1162151214 19:8646903-8646925 CAGGAAGAACACAGGCCCTGAGG + Intergenic
1163126726 19:15248278-15248300 TAGAATGACGACAGCCCCTGGGG - Intronic
1163156537 19:15442769-15442791 CAGGGGGACCCCAGCCCCTCAGG - Intronic
1164000360 19:21092755-21092777 GAGGAGAACGACAGACACTGAGG - Intronic
1165111464 19:33504890-33504912 GTGGAGGACGAGAGCCCCTTTGG - Intronic
1165334804 19:35162245-35162267 GAGGAGGAAGAGAGGCCCTGGGG - Intronic
1165431675 19:35776465-35776487 CTGGAGGGGGACAGACCCTGAGG + Intronic
1166297523 19:41896371-41896393 CAGGGGGGCGTCAGCACCTGTGG - Exonic
1166749620 19:45158739-45158761 CAGGAGGACGCCAGCCGCGGAGG + Exonic
1167106079 19:47430511-47430533 CAGGCGGATGCCCGCCCCTGTGG - Intronic
1167590690 19:50402846-50402868 CAGGAGCACCCCAGCCCATGTGG + Intronic
925022972 2:586730-586752 CAGAAGGACAACAGCCACTCAGG + Intergenic
926148586 2:10411905-10411927 CAGGAGAACAACAGGCCCAGAGG - Intronic
926738718 2:16093832-16093854 CAGGAGGAAGCCAGCCCCGCAGG + Intergenic
927197096 2:20555555-20555577 CATGAAGACGAAAGCCCCAGAGG + Intergenic
928909858 2:36408596-36408618 CAGGAGGCGGAGAACCCCTGTGG - Intronic
931196402 2:60055995-60056017 CAGAAGGAAGACAGAACCTGTGG + Intergenic
933750547 2:85600087-85600109 CAGGAGCACCACAGCGTCTGGGG - Intronic
936399465 2:112154627-112154649 CAGCAGGTGGACAGCCCTTGAGG + Intronic
938307608 2:130265898-130265920 CAGGGTGACAGCAGCCCCTGGGG - Intergenic
938447724 2:131390944-131390966 CAGGGTGACAGCAGCCCCTGGGG + Intergenic
940971328 2:159899944-159899966 CAGGAAGGCGACAGGGCCTGGGG + Intronic
942104891 2:172624257-172624279 CAGGAGTTCCCCAGCCCCTGGGG + Intergenic
944083473 2:195816770-195816792 CAATAGGACGATAGCCCATGCGG + Exonic
946113736 2:217443814-217443836 AAGGTGGAGCACAGCCCCTGAGG - Intronic
946397250 2:219449178-219449200 CCGGAGGAGGACGGTCCCTGGGG + Exonic
948944595 2:241213113-241213135 CATGAGGAGGCCAGCCTCTGCGG - Intronic
948944605 2:241213145-241213167 CATGAGGAGGCCAGCCCCTGCGG - Intronic
948944615 2:241213178-241213200 CATGAGGAGGCCAGCCCCTGCGG - Intronic
948944625 2:241213210-241213232 CATGAGGAGGCCAGCCCCTGCGG - Intronic
948978616 2:241480422-241480444 CTGGAGGAAGGCAGCCACTGTGG + Intronic
1169117900 20:3078000-3078022 CAGGAGGATGAGAGACCATGTGG + Intergenic
1171100537 20:22379625-22379647 CTGGAGGATGAGAGGCCCTGGGG - Intergenic
1171865598 20:30485766-30485788 CGGCAGGACGACGGCCCCAGTGG + Intergenic
1172836729 20:37877977-37877999 TAGGAAGTCCACAGCCCCTGGGG + Intergenic
1175545721 20:59776505-59776527 CACGGGGAGGATAGCCCCTGGGG + Intronic
1175545728 20:59776521-59776543 CCTGGGGAGGACAGCCCCTGGGG + Intronic
1176411518 21:6451754-6451776 CAAGAGGACGTCAGTCCATGTGG + Intergenic
1178759793 21:35391443-35391465 GAGGAGGAAGACAGCCCTTCTGG + Intronic
1179520738 21:41942777-41942799 CAGGGAGAGGCCAGCCCCTGGGG - Intronic
1179639321 21:42736799-42736821 CAGGAGGAGGACAGCCTGTCTGG - Intronic
1179687012 21:43060076-43060098 CAAGAGGACGTCAGTCCATGTGG + Intronic
1179791759 21:43759898-43759920 CAGAAGGACCCCAGGCCCTGGGG + Exonic
1179885375 21:44312046-44312068 CAGGCGGCAGACAGCCCCTGGGG - Intronic
1180339590 22:11606813-11606835 GAGGAGGATGACACCCGCTGGGG + Intergenic
1182354240 22:29715199-29715221 GAGGAGGGGGACAGGCCCTGGGG + Intergenic
1182541757 22:31046873-31046895 CAGGAGAAAGGCAGCCCCTGAGG + Intergenic
1185143702 22:49117807-49117829 CAGCAGGTCGCCAGCCCCTCTGG + Intergenic
1185269637 22:49923100-49923122 AGGGAGGAGGGCAGCCCCTGAGG - Intronic
950437421 3:12988651-12988673 CAGGATGACGACAATCTCTGAGG + Intronic
953912372 3:46899510-46899532 CAGGGAGAGGGCAGCCCCTGGGG + Intronic
954293965 3:49664007-49664029 GGGGAGGTCTACAGCCCCTGGGG - Intronic
954648756 3:52146959-52146981 CAGGTGGAGGACAGCATCTGGGG + Intronic
960992354 3:123320230-123320252 CAGGTGGGCCACAGTCCCTGTGG - Intronic
961633319 3:128317471-128317493 GAAGAGGACGCCAGCCCCAGAGG - Intronic
962266645 3:133948813-133948835 CAGGGGGACCCCAGCCCCTGTGG - Intronic
963178565 3:142328846-142328868 CAGGAGGACGGAAGCCCAGGAGG - Intronic
965597391 3:170422117-170422139 CATGAGGACAGCAGCCTCTGGGG + Intronic
967245160 3:187479156-187479178 CAGGAGGAAGACAGCCAAGGGGG - Intergenic
967968724 3:194984125-194984147 CAGCAGGGCGACAGGCCCAGTGG - Intergenic
968891574 4:3372177-3372199 CTGGAGGAAGAGAGCCCTTGTGG + Intronic
969185466 4:5471107-5471129 CAGGAGGGCCACAGTCCCAGGGG + Intronic
969607977 4:8211782-8211804 CAGGAGCTCCACAGCCCCCGTGG + Intronic
969674531 4:8607612-8607634 CAGGGGAGCGACGGCCCCTGAGG - Intronic
971495384 4:27258812-27258834 CATGAGGACCACAGCTCCAGGGG - Intergenic
972859878 4:43154313-43154335 CAGAAAAACGACAGCCCCTATGG - Intergenic
979639117 4:122991370-122991392 CTGGAGGATGAGAGACCCTGTGG + Intronic
981695802 4:147557738-147557760 CAGGTGAACGACAGCCACTGTGG - Intergenic
982069790 4:151685333-151685355 CAGGAGGCTGACAGCACCTGTGG + Intronic
984947660 4:184982601-184982623 CAGGAGGCAGACAGCCCGAGAGG - Intergenic
985429591 4:189866582-189866604 CATGAGGAAGACAGCCTCAGAGG + Intergenic
985429623 4:189866817-189866839 CATGAGGAAGACAGCCTCAGAGG + Intergenic
985429629 4:189866864-189866886 CATGAGGAAGACAGCCTCCGAGG + Intergenic
985429638 4:189866911-189866933 CATGAGGAAGACAGCCTCAGAGG + Intergenic
985429652 4:189867005-189867027 CATGAGGAAGACAGCCTCAGAGG + Intergenic
985429680 4:189867193-189867215 CATGAGGAAGACAGCCTCAGAGG + Intergenic
985760339 5:1745693-1745715 CAGGAGAACGGCCGTCCCTGGGG + Intergenic
986556771 5:9017754-9017776 CAGGAGGAGGCCAGGCGCTGTGG - Intergenic
986809049 5:11336910-11336932 CTAGAGGAAGACAGTCCCTGAGG + Intronic
997907255 5:137830704-137830726 CAGAAGGATGTCAGCCCCTAAGG - Intergenic
1002461471 5:179375954-179375976 AGGGAGGACTCCAGCCCCTGGGG + Intergenic
1003497905 6:6679936-6679958 CAGGATGCAGACATCCCCTGAGG - Intergenic
1004661008 6:17709162-17709184 TAGGAGGAAGATAGCACCTGAGG - Intergenic
1006373521 6:33659414-33659436 CAGGTGGACCCCAGCCACTGAGG - Intronic
1006419916 6:33926461-33926483 CAGAAGGACGGCAGCCACTTTGG + Intergenic
1007169335 6:39851716-39851738 CAGGCAGAGGACAGCCCCTTGGG + Intronic
1010015776 6:71103899-71103921 CAGGAGTGTGGCAGCCCCTGGGG + Intergenic
1012727312 6:102830986-102831008 GAGGAGAACAACAGACCCTGGGG + Intergenic
1015715917 6:136191820-136191842 CAGGAAGGCGACAGCCCCTAGGG + Exonic
1017006104 6:150028996-150029018 CAGGAGGAGGACAGCCCAGGAGG - Intergenic
1017583851 6:155898466-155898488 CAGGAGGACTACAGCTACTCAGG - Intergenic
1018100996 6:160439952-160439974 TAGTAGGTCGCCAGCCCCTGGGG + Intronic
1018173925 6:161163051-161163073 CAGGAGAACCAGAGCCTCTGGGG + Intronic
1019117667 6:169778170-169778192 CAGGAGGGCCACTGCCCGTGTGG - Intronic
1019319396 7:408778-408800 CAGGCAGAGGACAGCACCTGTGG + Intergenic
1019886316 7:3909027-3909049 GATGAGGAAGACAGCCCCTCTGG + Intronic
1020592404 7:10157485-10157507 CAGGAAAACTACAGCACCTGTGG - Intergenic
1023106588 7:36768951-36768973 CAGGAGCAGAACAGCTCCTGTGG + Intergenic
1023322726 7:39016857-39016879 AAGAAGGCCGACAGCCACTGTGG + Intronic
1023879716 7:44311625-44311647 CAGGGGCAGGACAGCCCCTCTGG - Intronic
1023962406 7:44937839-44937861 CAGGTGGATGAGAGACCCTGAGG + Intergenic
1024229936 7:47356012-47356034 CAGGTGGAAGGCAGCCCATGGGG + Intronic
1027441041 7:78219503-78219525 CAGTAGTACGAGAGGCCCTGAGG - Intronic
1028596104 7:92547389-92547411 CAGGAGGCAGACAGGCTCTGGGG + Intergenic
1032238038 7:130141374-130141396 CAGGAGGGCGAAAGCACCTTTGG + Intergenic
1034062855 7:148109026-148109048 CAGTAAGACGACAAACCCTGAGG - Intronic
1034942103 7:155237324-155237346 CGGGAGGAAGCCAGCCCTTGAGG - Intergenic
1037300949 8:17451387-17451409 CAAGGGAACAACAGCCCCTGGGG - Intergenic
1037836850 8:22219771-22219793 CAGGCGGACCCCAGCCCCGGGGG + Exonic
1037910102 8:22739219-22739241 CGGGAGGAGGGCAGCACCTGGGG - Intronic
1039803057 8:40976285-40976307 CAGGAGGCTGGCAGCCCCTCTGG - Intergenic
1041810416 8:61902468-61902490 CAGGGGGAGCAGAGCCCCTGTGG + Intergenic
1043553546 8:81403087-81403109 CAGGAGGATGAAAGGACCTGGGG - Intergenic
1043679644 8:83007031-83007053 CAGGAGGACGAAAGCCTCAAGGG - Intergenic
1045340560 8:101250843-101250865 CAAGAAGACAACAGCTCCTGTGG - Intergenic
1045878905 8:107014939-107014961 CAGGATGAGGTCAGCACCTGTGG + Intergenic
1049097542 8:140557862-140557884 CAGAAGGACGAGAGGGCCTGTGG - Intronic
1049256186 8:141615177-141615199 CAGGAGGACGGGAGACCCCGTGG - Intergenic
1049272801 8:141704913-141704935 CAGGAGAGCCACAGCCCCTCAGG + Intergenic
1049454925 8:142681915-142681937 CAGGAGGCCAACTGCGCCTGGGG - Exonic
1049573266 8:143379309-143379331 CAGGAGGCTGAAGGCCCCTGCGG - Exonic
1053629309 9:39916651-39916673 CAGTAGGAAAACAGCCTCTGAGG - Intergenic
1054214578 9:62334051-62334073 CAGTAGGAAAACAGCCTCTGAGG + Intergenic
1054672903 9:67821302-67821324 CAGTAGGAAAACAGCCTCTGAGG - Intergenic
1056049162 9:82749937-82749959 CAGGAGGACCACTGCCTTTGAGG - Intergenic
1057354576 9:94323019-94323041 CTGGAGCAAGGCAGCCCCTGGGG + Intronic
1057653181 9:96934616-96934638 CTGGAGCAAGGCAGCCCCTGGGG - Intronic
1059826351 9:118033560-118033582 CAGGACAAAGACAGCACCTGAGG - Intergenic
1060673130 9:125488229-125488251 CAGAAGGATAACAGCACCTGAGG + Intronic
1060808386 9:126593620-126593642 CAGGAGGACAAGACCCTCTGTGG + Intergenic
1061051306 9:128197483-128197505 CAGGTGAGCGACAGCCACTGGGG - Intronic
1062010480 9:134264222-134264244 CAGGAGAAGGGCAGCCTCTGCGG + Intergenic
1186067407 X:5780722-5780744 CAGGAGGACTGCACTCCCTGTGG - Intergenic
1186730253 X:12402353-12402375 CAAGAGGTCCAAAGCCCCTGAGG + Intronic
1187473430 X:19589226-19589248 CTGTAGGCCGACAGCCCCTGAGG + Intronic
1192176965 X:68892390-68892412 AAGGAGGAAACCAGCCCCTGGGG - Intergenic
1193392536 X:80945928-80945950 AAGCAGGACTACAGCCCCGGTGG - Intergenic
1199225716 X:145370872-145370894 CAGCAGGACAACAGACCCTGTGG + Intergenic
1200060128 X:153480389-153480411 CAGCAGGCCACCAGCCCCTGGGG - Intronic