ID: 1104970904

View in Genome Browser
Species Human (GRCh38)
Location 12:132530274-132530296
Sequence CCGGCTGCTGGGAGGCACCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 329
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 307}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104970904 Original CRISPR CCGGCTGCTGGGAGGCACCT GGG Intronic
900014163 1:137360-137382 CGGGCTGCTGGGAGGCAGGCAGG + Intergenic
900044026 1:492562-492584 CGGGCTGCTGGGAGGCAGGCAGG + Intergenic
900065436 1:727468-727490 CGGGCTGCTGGGAGGCAGGCAGG + Intergenic
900208740 1:1442801-1442823 CACGCTGCTGGGAGCCACCTAGG + Exonic
900215362 1:1478778-1478800 CCGGCTGCGGGGAGCGGCCTGGG + Intronic
900222623 1:1517445-1517467 CCGGCTGCGGGGAGCGGCCTGGG + Intronic
900569993 1:3353479-3353501 CTGGCTTCTGGCAGGCACCTGGG + Intronic
900782438 1:4626801-4626823 CAGGCTGCTGGGATACAGCTGGG + Intergenic
901142844 1:7046384-7046406 CCGGCAGCTGGGAGACCCTTTGG - Intronic
902328955 1:15721114-15721136 CCAGCTGGTTGGAGGCTCCTGGG + Intronic
902617725 1:17632957-17632979 CCGGCTGCTGGGCTGTGCCTGGG + Intronic
903163254 1:21504016-21504038 CTGACTGCTAGGAGGGACCTGGG + Intergenic
903179494 1:21598096-21598118 CTGGCCGCGGGGAGGCACCAGGG + Intronic
904614592 1:31743021-31743043 CCGGTGGCTGGGCGGCACCATGG + Intronic
907319248 1:53592522-53592544 AGGGCTGCTGGGAGACAGCTGGG - Intronic
907540971 1:55215235-55215257 CCGGCTGCTGCGGAGCACCCGGG - Intergenic
912710225 1:111944580-111944602 CAGCCTGCTGGGAGGCCCCAGGG - Intronic
915622259 1:157092893-157092915 CAGGCCCCTGGGAGGCTCCTAGG + Exonic
916412513 1:164559752-164559774 TCGGCTCCTGGGAAGCACCAAGG - Exonic
919853478 1:201689813-201689835 CCAGCTGCTCTGAGGCCCCTAGG - Intronic
919920203 1:202162733-202162755 CGGGCTGTTGGAAGGCTCCTGGG + Intergenic
919920305 1:202163285-202163307 CGGGATGCTGGGAGACCCCTGGG - Intergenic
920255566 1:204651965-204651987 CCGGGCACTGGGAGACACCTGGG - Intronic
920547370 1:206829599-206829621 CCTGCTACTGGGAGGCCCCAGGG + Intronic
922614690 1:226954902-226954924 CAGGGTGCTGGGAGGCATGTTGG + Intronic
922734494 1:227971965-227971987 CGGGCTGCTGGGAGGCAGGCAGG + Intergenic
922734775 1:227973096-227973118 CGGGCTGCTGGGAGGCAGGCAGG + Intergenic
924343490 1:243054935-243054957 CGGGCTGCTGGGAGGCAGGCAGG + Intergenic
1062799529 10:368924-368946 GCGGCTCCTGGGAGGTGCCTGGG + Intronic
1063472913 10:6302886-6302908 CAGACTGTTGGAAGGCACCTTGG + Intergenic
1066732626 10:38449169-38449191 CGGGCTGCTGGGAGGCAGGCAGG - Intergenic
1066733032 10:38450775-38450797 CGGGCTGCTGGGAGGCAGGCAGG + Intergenic
1068667169 10:59689261-59689283 ACAGCTGGTGAGAGGCACCTAGG - Intronic
1069438283 10:68406483-68406505 GCAGCTGCTGGGAGGCAGATCGG + Intronic
1070053041 10:72907511-72907533 CCTGCTGCTGAGAAGCACCTGGG + Intronic
1070661238 10:78306809-78306831 CCTTTTACTGGGAGGCACCTGGG + Intergenic
1070826748 10:79394612-79394634 CCGAAGGCTGGGAGGCACATAGG + Intronic
1071251357 10:83823012-83823034 CCGGCTGCTGGGATGCAAGCTGG + Intergenic
1071503785 10:86221120-86221142 CCGACTGCTCTGAAGCACCTGGG - Intronic
1073289997 10:102408821-102408843 GCGGCTTGTGGGAGGCACCGAGG - Intronic
1074182865 10:111078721-111078743 CCGGCGGCTGGGTGGCACGCGGG - Exonic
1074386446 10:113020291-113020313 CATGCTGATGGGAGGCAGCTGGG + Intronic
1074720161 10:116257184-116257206 TCGGCTGCTAGGAGGCATTTTGG - Intronic
1075413989 10:122249183-122249205 AGGGCTGCTGGGAGGCCCCTGGG - Intronic
1076470706 10:130716289-130716311 CCAGCTGCTGGCAGGCCCTTTGG - Intergenic
1076520374 10:131077304-131077326 CCTGCTGCTGGGAGGGTGCTGGG + Intergenic
1076746194 10:132515915-132515937 CCCACAGCTGGAAGGCACCTGGG + Intergenic
1076970363 11:129037-129059 CGGGCTGCTGGGAGGCAGGCAGG + Intergenic
1077102527 11:828478-828500 CCTGCTGCAGGGAGGGCCCTCGG + Intronic
1077103215 11:831180-831202 CCGGCTGCAGGAAGGCTCCTTGG - Intronic
1078413718 11:11148422-11148444 CAGGCAGCAGGGAGGTACCTCGG - Intergenic
1081574158 11:44309105-44309127 TCGCCGGCTGGGAGGCTCCTCGG - Intronic
1081997589 11:47375298-47375320 ACGGCTGCTGGGTGGAACCCAGG - Intronic
1082261045 11:50076469-50076491 CAGGCTGCTGGGAGACAGGTAGG + Intergenic
1082261283 11:50077718-50077740 AAGGCTGCTGGGAGGCAGGTAGG + Intergenic
1083440023 11:62669956-62669978 CTGGATGCTGGGAGGAGCCTGGG + Exonic
1083592258 11:63902718-63902740 CAGGGGGCTGGCAGGCACCTTGG - Exonic
1083920594 11:65779985-65780007 CGGGCTGCTGGGGGGCTCCCTGG - Exonic
1084121472 11:67071529-67071551 GCGGCTGCTGAGGGCCACCTCGG - Exonic
1084212294 11:67629845-67629867 CCGGCTGCTGGCAGGGGCCACGG - Exonic
1084421578 11:69063176-69063198 AAGGCTGCTGGGAGGCTTCTGGG - Intronic
1084453175 11:69251999-69252021 CCGGCGGCTTGGACACACCTGGG + Intergenic
1084596697 11:70120822-70120844 CCGGATGCTGGAAGGCTCCCAGG + Intronic
1088605214 11:111523463-111523485 CCAGCGGCTGGCAGGAACCTAGG + Intronic
1089640007 11:119841731-119841753 ACGGCTGCTGGGATTCTCCTTGG - Intergenic
1090471079 11:126981775-126981797 CCTAGAGCTGGGAGGCACCTTGG - Intronic
1090650567 11:128802458-128802480 CAGGCTGCTGGGATGGACGTTGG + Intronic
1092578425 12:9814361-9814383 CACGCCGCTGGGAGGCGCCTGGG + Intergenic
1093786065 12:23193439-23193461 CTATCTTCTGGGAGGCACCTTGG + Intergenic
1093949420 12:25147539-25147561 CTGGCAGCTGGGAGGATCCTAGG + Intronic
1095906645 12:47385151-47385173 CAGGGTGCTGGGGGCCACCTGGG - Intergenic
1095989599 12:48025584-48025606 GCGGGGGCTGGGAGGCACCCTGG - Intergenic
1096409280 12:51365466-51365488 CCGGCTGCTGGGGGCCAGCGTGG - Exonic
1099478032 12:83132213-83132235 CCGGCTGCTTTGATGAACCTGGG + Exonic
1100539979 12:95548669-95548691 CCCGGGGCCGGGAGGCACCTGGG - Intronic
1100971683 12:100078004-100078026 CCTGCTCCTGGGAAGCAACTAGG + Intronic
1102006628 12:109593215-109593237 CAGGCTGGTGAGAGGCACCCGGG + Intronic
1103196067 12:119044682-119044704 AGGGCTGCTGGGAGGAACCAGGG + Intronic
1104735692 12:131134848-131134870 CCTGGTGCTGGGATGCACTTTGG + Intronic
1104794886 12:131510416-131510438 CCTGGTGCTGGGATGCACTTTGG - Intergenic
1104945772 12:132414330-132414352 CGGGCTGCAGGGAGGGCCCTTGG - Intergenic
1104970904 12:132530274-132530296 CCGGCTGCTGGGAGGCACCTGGG + Intronic
1106101468 13:26697511-26697533 GCGGCTGCTGGAAGGGAGCTGGG + Intergenic
1107558799 13:41542432-41542454 CCTGCTGCTGGTAGGCAGGTGGG + Intergenic
1111010396 13:82305806-82305828 CAGGCTGCTGGAAGTGACCTAGG - Intergenic
1112425960 13:99301306-99301328 CCTTCTGCTGGGAGCCACCCTGG + Intronic
1113476034 13:110582031-110582053 CAGGCTGCGGTGAGGCACCCAGG - Intergenic
1114280893 14:21191980-21192002 GCTGCAGCAGGGAGGCACCTGGG + Intergenic
1114549556 14:23525154-23525176 CCGGCGGCCGGCAGGCACCAGGG + Exonic
1114656008 14:24316056-24316078 GCGGGTGCTGGCAGGCATCTGGG + Exonic
1114680775 14:24482129-24482151 CTGGCTGCTGGGAAGCCCCCAGG - Intergenic
1117548384 14:56811231-56811253 CCGGCTTCTGGTAGGTTCCTGGG + Intergenic
1118767885 14:68922279-68922301 CAGGCTGCTGGGAGGCCACCTGG - Intronic
1121585745 14:95061831-95061853 CAGGGTGCTAGGAGGGACCTTGG - Intergenic
1122135228 14:99628926-99628948 TCGGAGGCAGGGAGGCACCTAGG - Intergenic
1122278896 14:100609898-100609920 CCGCAGGCTGGGAGGCTCCTGGG + Intergenic
1122782430 14:104149362-104149384 CAGGATGCTGGCTGGCACCTGGG + Intronic
1124015110 15:25867137-25867159 GGGGATGCTGGGAGACACCTGGG + Intergenic
1124645128 15:31433249-31433271 CTGGCTGGTGGGAGCCCCCTGGG + Intronic
1125612260 15:40979523-40979545 CTGGCTTCTGGGAGTCCCCTGGG + Exonic
1125862968 15:43015055-43015077 CCGGGAGGTGGGGGGCACCTCGG + Intronic
1128740713 15:70082095-70082117 CTGGCTGCTGGGAGGCTGCTGGG - Intronic
1128982376 15:72197219-72197241 GCGGCTGCGGGGAGGCAGCTCGG - Intronic
1129736953 15:77971976-77971998 CAGGCTGTTGGGCGGCACCCTGG - Intergenic
1129823507 15:78620070-78620092 CCCGCCGCTGGGAGGCTCTTGGG - Intronic
1132566975 16:628021-628043 CCAGCTGCGGGGACGCACTTGGG + Exonic
1133211543 16:4265972-4265994 CCAGCTGCTGGGTGTGACCTTGG - Intronic
1133784639 16:8964247-8964269 CCGGCTGCCGGGTGGCTTCTGGG - Intronic
1134090134 16:11387114-11387136 CCGCCTGCTGGCGGGCCCCTGGG - Exonic
1134133802 16:11667231-11667253 CCAGCTGCAGGGAGCCACATAGG + Intergenic
1136651218 16:31673317-31673339 GTGGCTGCTGGCAAGCACCTTGG + Intergenic
1136692633 16:32046393-32046415 CCAGCTGCAAGGAGGTACCTGGG + Intergenic
1136793130 16:32989619-32989641 CCAGCTGCAAGGAGGTACCTGGG + Intergenic
1136876723 16:33864438-33864460 CCAGCTGCAAGGAGGTACCTGGG - Intergenic
1137586082 16:49664645-49664667 ACGGCCCCTGGGAGGCCCCTGGG + Intronic
1137703010 16:50510694-50510716 CAGGCTGCTGGGAGGGTGCTTGG + Intergenic
1138383143 16:56617502-56617524 CAGGCAGCTGGAAGGCACGTTGG - Intergenic
1138521706 16:57574995-57575017 CGTGCTGCTGGGAACCACCTGGG + Exonic
1139922751 16:70470239-70470261 TCTGCTGCTGGGAGGCAGCCTGG + Intronic
1141511849 16:84517407-84517429 CTGGGTACTGGGAGGCACCCGGG - Intronic
1141521074 16:84580048-84580070 CCAGCTGCTGGCAGGTGCCTGGG + Intronic
1142117217 16:88365378-88365400 CTGGCTGCTGGGATGGACATGGG + Intergenic
1142196027 16:88739697-88739719 GGGGCTGCTGGGAGGCTCCGAGG + Intronic
1142260621 16:89041005-89041027 CCGACTGCTGGGATCCACTTGGG - Intergenic
1142382285 16:89739697-89739719 CCAGCTGCTGACAGGTACCTGGG - Intronic
1142449888 16:90168445-90168467 CGGGCTGCTGGGAGGCAGGCAGG - Intergenic
1203095386 16_KI270728v1_random:1251310-1251332 CCAGCTGCAAGGAGGTACCTGGG + Intergenic
1142457198 17:63401-63423 CGGGCTGCTGGGAGGCAGGCAGG + Intergenic
1142546665 17:708697-708719 AGGGCTGCTTGAAGGCACCTTGG - Intronic
1142968661 17:3596674-3596696 CTGGCTCCTTGGAAGCACCTGGG - Intronic
1144829514 17:18123420-18123442 GCGGCTGCTGGCAAGCACGTGGG + Intronic
1145838971 17:27977841-27977863 TCGGCTGCAGGCAGGGACCTTGG - Intergenic
1145910354 17:28538719-28538741 CAGGCTCATGGCAGGCACCTGGG - Exonic
1146257577 17:31400520-31400542 CTGGCTGCTGTGTGGCTCCTCGG + Intronic
1146574442 17:33979064-33979086 ACAGCTGCTGGGAGGGACCAAGG - Intronic
1147025429 17:37578631-37578653 CAGGGTGCTGGGAGGGATCTTGG - Intronic
1147421930 17:40326182-40326204 CCGACTGCTGAGGGGCACCAAGG + Intronic
1148440393 17:47708977-47708999 CGGGCAGCTGGGGGGCACCGGGG - Exonic
1148453941 17:47800926-47800948 CCGCCTGCCTGCAGGCACCTCGG + Intergenic
1150209901 17:63436211-63436233 CCAGCAGCAAGGAGGCACCTTGG + Intronic
1150824847 17:68465351-68465373 CCTTCTGCTGGGAGCCTCCTTGG + Intergenic
1151357620 17:73569935-73569957 CCTGCTGCAGAGAGGCTCCTCGG - Intronic
1152594059 17:81229606-81229628 CCGGCTGCTGGGAGGGGCTGGGG + Intronic
1152814669 17:82400220-82400242 CCAGCTGCCAGGAGGCCCCTTGG + Intronic
1153692063 18:7603814-7603836 CCTGCTGCTGTGTGGCACCCTGG + Intronic
1155493184 18:26419412-26419434 CCGGCTGCAGGGAGGGACCCTGG + Intergenic
1159402180 18:67953050-67953072 CCAGCTGCAGGGAGGAACCCAGG - Intergenic
1160647557 19:200506-200528 CGGGCTGCTGGGAGGCAGGCAGG + Intergenic
1160679414 19:405927-405949 CCGGCTGCTGGTGGGCACGGAGG - Exonic
1161629640 19:5346365-5346387 CCAGGTTCTGGGAGGCTCCTAGG - Intergenic
1162412320 19:10513997-10514019 CCGACTGCTGGGAGCCACTCGGG + Exonic
1163925224 19:20334920-20334942 TTGGCTGGTGGGAGTCACCTGGG + Intergenic
1165317391 19:35065261-35065283 CCGGCAGCTGGGAGGCACACAGG - Exonic
1165412972 19:35673560-35673582 CCGGGTGCTGGGAGGGCCCTGGG + Intronic
1166767856 19:45263138-45263160 CAGGCTGCTGGGATTCAGCTGGG - Exonic
1166888327 19:45974181-45974203 CAGGCTGCTGGGAGGACCCCGGG + Intergenic
1167395209 19:49223913-49223935 CTGGGTCCTGGGAGGTACCTGGG + Intergenic
926838882 2:17056450-17056472 CCTGCTGCAGGGTGGAACCTGGG + Intergenic
928127935 2:28629035-28629057 GCTACTGCTGGGAGGAACCTGGG - Intronic
928368694 2:30723107-30723129 CAGGCTGTTGGGAGACAGCTTGG + Exonic
928412569 2:31066309-31066331 CTGGCTTCTGACAGGCACCTGGG - Intronic
929952806 2:46429116-46429138 GCGGCGGCAGGGAGGCCCCTAGG + Intergenic
931386260 2:61800433-61800455 CCGGGAGCTAGGAGGAACCTGGG - Intergenic
935669726 2:105544768-105544790 CTGGCTGCTGGGATGCAACAGGG + Intergenic
941054943 2:160776938-160776960 GTGGTTGCTGGGAAGCACCTTGG - Intergenic
941112005 2:161426493-161426515 ACTGCTTCTGGGAGGCATCTGGG + Intronic
942064422 2:172257105-172257127 CTGGCTGTGGGGAGGCCCCTGGG + Intergenic
942454463 2:176128868-176128890 ACGCCGGCTGGGAGGCTCCTGGG + Intergenic
946352610 2:219165216-219165238 CGGGCTGCTGGGAAGCCCCATGG - Exonic
946843135 2:223837380-223837402 CGCGCTCCGGGGAGGCACCTGGG - Intronic
948337101 2:237218112-237218134 CAGGCTGTAAGGAGGCACCTTGG + Intergenic
948568077 2:238898911-238898933 CCGGCTCCTGGTGGGCCCCTTGG + Intronic
948867238 2:240782337-240782359 GGGGCTGCTGGGAGACACCGAGG - Intronic
1168892101 20:1301243-1301265 GGGGCTCCTGGGAGACACCTGGG - Intronic
1169088314 20:2840741-2840763 ACGGCAGCTGGGAAGCACCGAGG - Exonic
1169149707 20:3279774-3279796 CAGGCAGCTGGGAGGCAGCAGGG + Intronic
1172445936 20:34993453-34993475 GCGCCTGCTGGGAGGCAGGTGGG + Exonic
1173026347 20:39310831-39310853 CGGGCTGCTGGGAGGCCTCCTGG + Intergenic
1176031951 20:63017072-63017094 CTGGCTGCCGGGAGGCAGCAAGG + Intergenic
1176214200 20:63940576-63940598 CCGGCTGCCCCCAGGCACCTCGG + Exonic
1178518305 21:33266653-33266675 CCGGCTGCTGAGACGCAACTAGG + Intronic
1178914642 21:36699571-36699593 GCGGCTGCGGGGAGGCGTCTCGG + Exonic
1180934441 22:19615479-19615501 ACGGCTGTCGGGATGCACCTGGG + Intergenic
1181273268 22:21673232-21673254 TCTGCTGCTGGGAGCCACATTGG + Intronic
1181968785 22:26674678-26674700 TTGGCTGCTGGCAGGGACCTTGG + Intergenic
1182499932 22:30739368-30739390 TCTCCTGCTGGGAGGCACCTGGG - Intronic
1183086274 22:35489225-35489247 CGGGCTGCTGTGAGGCACTGAGG + Intergenic
1184248257 22:43246373-43246395 CAGGCAGCTGGGAAGCAGCTGGG + Intronic
1184593733 22:45502499-45502521 CCGGCTGCTGGGGGGCACTGGGG - Intronic
1184828633 22:46970121-46970143 CCAGCTGCTTTGAGGCAGCTTGG + Intronic
1184982213 22:48102727-48102749 CCAGCAGCTCGGAGCCACCTGGG - Intergenic
1185179034 22:49348793-49348815 CCGGCTCCTCGGAGGCAGCCAGG - Intergenic
1185383200 22:50519611-50519633 CCGACTGCAGAGAGGCGCCTTGG - Intronic
950094028 3:10317817-10317839 CTCTCTGCTGGGAGGAACCTGGG - Intronic
950139282 3:10604122-10604144 CAGGGAGCTGGCAGGCACCTTGG + Intronic
950364146 3:12471305-12471327 CCTGCTTCTGGAACGCACCTAGG - Intergenic
950708991 3:14801893-14801915 CCCCCTGCTGGAAGGCAGCTTGG + Intergenic
954644909 3:52125329-52125351 CTGGCTGCAGGCAGGCTCCTGGG - Intronic
954778929 3:53045540-53045562 CCGGCTGCAGGGGCGCGCCTGGG - Intronic
954808159 3:53232175-53232197 CGGGCTGCTGGGTGCTACCTGGG - Intronic
955195728 3:56803141-56803163 GTGGCTGAAGGGAGGCACCTGGG + Intronic
955532804 3:59891646-59891668 CCTGCTGCTGGGAGACACAAAGG - Intronic
962748209 3:138413245-138413267 CCCACAGCTGGGAGGCCCCTCGG + Intergenic
963247798 3:143078633-143078655 TCTGCTCCTGGGAGCCACCTGGG - Intergenic
963642876 3:147880372-147880394 CAGGCTGCTGGGCTGGACCTTGG + Intergenic
964438152 3:156675139-156675161 CCGGGTGCTCTGAGGCGCCTAGG + Exonic
964518904 3:157542912-157542934 CCGGCTGCTGCGTGGCACACGGG + Intergenic
967054917 3:185823694-185823716 CCCGCTCCTGGGTGTCACCTTGG + Intronic
967171290 3:186825329-186825351 CCGGATGCTGGCAGGCTCCAAGG - Intergenic
967392573 3:188971684-188971706 GCAGCTGCTGAGAGGCACCCAGG - Intronic
968370285 3:198219607-198219629 CGGGCTGCTGGGAGGCAGGCAGG - Intergenic
968481829 4:836729-836751 CAGTGTGCTGGGAGGGACCTGGG - Intergenic
968525736 4:1055820-1055842 CCGGCTGGCGGGAGAGACCTGGG + Intergenic
968976431 4:3824535-3824557 CCGGCTCCTGCCAGCCACCTTGG + Intergenic
973888562 4:55346726-55346748 CCGGCTGCTGCGTGGCTCCGGGG + Intronic
982081926 4:151798671-151798693 CCCCCAGCTGGGAGGCATCTAGG - Intergenic
984019571 4:174468610-174468632 GAGGCTGCAGGGAGGCACCCAGG + Intergenic
985645042 5:1080798-1080820 CAGGCTGTTAGGAGACACCTAGG - Intronic
985661869 5:1161427-1161449 CAGGCTGCGGGGAGGGAGCTGGG - Intergenic
985996918 5:3602231-3602253 CGGGCAGCGGGGAGGCAGCTGGG + Intergenic
986608014 5:9542180-9542202 GTGGCTGCTGGGAAGCACTTTGG - Intronic
988492630 5:31717761-31717783 CCAGCTGCTGGTGGGCATCTGGG + Intronic
989779532 5:45247421-45247443 CTGGCTGCTGAGAAGCACCTTGG + Intergenic
990816743 5:59794441-59794463 CAGGCTGCCGGGAAGCACCAGGG - Intronic
991674101 5:69075169-69075191 GCGGGTGCTGGAAGGCACCGCGG - Intergenic
998177645 5:139911660-139911682 CCATCTGCAGGGAGACACCTGGG + Intronic
998647262 5:144076161-144076183 GTGGCTGCTGGCAAGCACCTTGG - Intergenic
999454911 5:151707205-151707227 CTGGGTGCTGGGATGCAGCTGGG + Intergenic
1000561333 5:162792672-162792694 CAGGCTGCCGGGAGGCATTTTGG + Intergenic
1001087896 5:168714780-168714802 CCAGCCGCTGGGAGGCATCAGGG - Intronic
1001091960 5:168748270-168748292 CAGGGTGCTTGGAGGCAGCTGGG + Intronic
1002548049 5:179965220-179965242 CCGGCTGCAGGGGGGCACTGTGG - Intronic
1002729817 5:181326367-181326389 CGGGCTGCTGGGAGGCAGGCAGG - Intergenic
1003424239 6:5986611-5986633 CCGGCTCCTGGGATACATCTCGG + Intergenic
1006297759 6:33177599-33177621 CAGGATGCTGGCAGGGACCTCGG + Intronic
1006429480 6:33986159-33986181 CCTCCTCCTGGGAGGCACCCTGG + Intergenic
1006453789 6:34120672-34120694 CCTGCTCCTGGGAGGCTGCTGGG - Intronic
1006706335 6:36024477-36024499 GCCGCTGCTGGGAGACGCCTGGG - Intronic
1006942615 6:37763000-37763022 CGGGCTGCTGGCAGGGCCCTCGG + Intergenic
1006987046 6:38182752-38182774 CTCACTGCTGGGAGGCTCCTGGG + Intronic
1007113151 6:39325199-39325221 ACGGCGGATGGGAGGCACCTGGG - Intergenic
1007125767 6:39424304-39424326 CAGGGTGCTGGGGAGCACCTGGG - Intronic
1007169083 6:39849898-39849920 CGTGCTGCTGGGAGTCACCCAGG - Intronic
1011492480 6:87906658-87906680 GTGGCTGCAGGGAAGCACCTTGG + Intergenic
1017815958 6:158016910-158016932 CCAGCTGGGGGCAGGCACCTGGG - Intronic
1018437798 6:163778402-163778424 CCAGCTACTGAGAGGCATCTGGG + Intergenic
1018705863 6:166462625-166462647 CCCGGTGCTGCGAGTCACCTGGG + Intronic
1018956014 6:168410979-168411001 CCCACTGCTGGGAGGCAGCTAGG + Intergenic
1018961767 6:168454545-168454567 TCTGCAGATGGGAGGCACCTGGG + Intronic
1019348405 7:541668-541690 GGGGCCGCTGAGAGGCACCTGGG + Intergenic
1019408773 7:897684-897706 AGGGGTGCTGGGGGGCACCTCGG + Intergenic
1019413070 7:914993-915015 CCGGCTGCAGGGAGGCTGCTGGG - Intronic
1019540127 7:1547591-1547613 CCGGCTCCGGACAGGCACCTGGG - Intronic
1019642054 7:2108837-2108859 CCGGCTCCTGGAGGCCACCTGGG - Intronic
1019817802 7:3213934-3213956 CAGGCTCCTGGGAGGCAGCGTGG - Intergenic
1023221143 7:37920987-37921009 CTGGCTGCTGGGCGGCCTCTGGG + Exonic
1023858427 7:44201024-44201046 CCGGCTGCTGAGAGGCCGGTAGG + Intronic
1024223084 7:47303356-47303378 CTGGCTGCTGGGAGGCGCCAGGG + Exonic
1024260934 7:47573363-47573385 CGGGCTGGTGGGAGGCAGCGTGG - Intronic
1024279245 7:47705835-47705857 CCAGCTTCTGGGATGCCCCTAGG - Intronic
1024965545 7:55019713-55019735 CCGGGTGCTGGTGGGCGCCTGGG + Intronic
1025052923 7:55743908-55743930 CGGGCTGCTGGGAGGCAGGCAGG + Intergenic
1025178120 7:56812097-56812119 CAGGCTGCTGGGAGGCAGGCAGG + Intergenic
1025178550 7:56813836-56813858 CAGGCTGCTGGGAGGCAGGCAGG + Intergenic
1025178988 7:56815626-56815648 CAGGCTGCTGGGAGGCAGGCAGG + Intergenic
1025179444 7:56817512-56817534 CTGGCTGCTGGGAGGCAGGCAGG + Intergenic
1025179893 7:56819350-56819372 CAGGCTGCTGGGAGGCAGGCAGG + Intergenic
1025180368 7:56821332-56821354 CAGGCTGCTGGGAGGCAGGCAGG + Intergenic
1025180811 7:56823170-56823192 CAGGCTGCTGGGAGGCAGGCAGG + Exonic
1025181238 7:56824921-56824943 CAGGCTGCTGGGAGGCAGGCAGG + Intronic
1025689125 7:63744805-63744827 GAGGCTGCTGGGAGGCAGGTAGG - Intergenic
1025690231 7:63750236-63750258 CAGGCTGCTGGGAGGCAGGCAGG - Intergenic
1025690679 7:63752059-63752081 CAGGCTGCTGGGAGGCAGGCAGG - Intergenic
1025691130 7:63753882-63753904 CAGGCTGCTGGGAGGCAGGCAGG - Intergenic
1025691562 7:63755658-63755680 CAGGCTGCTGGGAGGCAGGCAGG - Intergenic
1025692004 7:63757481-63757503 CAGGCTGCTGGGAGGCAGGCAGG - Exonic
1025692453 7:63759304-63759326 CAGGCTGCTGGGAGGCAGGCAGG - Intergenic
1025692897 7:63761127-63761149 CAGGCTGCTGGGAGGCAGGCAGG - Intergenic
1025693313 7:63762806-63762828 CAGGCTGCTGGGAGGCAGGCAGG - Intergenic
1025693756 7:63764629-63764651 CAGGCTGCTGGGAGGCAGGCAGG - Intergenic
1032712610 7:134473898-134473920 CAGGCTACTGAGAGGCAACTGGG - Intergenic
1033227298 7:139572226-139572248 CAGGCTGCTGGAAGGCCCCCGGG - Exonic
1034497427 7:151431163-151431185 CCGGCAGCAGGGAGTTACCTGGG + Intronic
1034546604 7:151793687-151793709 CCCTCTGCTGGGAGGCACGGGGG + Intronic
1039542524 8:38383054-38383076 CCCGCGGCTGGGGGGCACCCGGG - Intergenic
1044016055 8:87049931-87049953 CAGACTGCTGGGATGGACCTTGG + Intronic
1045856404 8:106770019-106770041 CTGGCTGCCGGGAGGGACCCAGG - Exonic
1047206204 8:122804530-122804552 CAGTCTCCTGGGAGGCACATAGG + Intronic
1047759935 8:127946931-127946953 CCTGCTGCTTGGAGGAAGCTAGG - Intergenic
1049113886 8:140669054-140669076 CTGACTGCTGGAAAGCACCTGGG + Intronic
1053576117 9:39358305-39358327 CTGGTGGCTGGGAGGCACTTAGG - Exonic
1053840634 9:42186242-42186264 CTGGTGGCTGGGAGGCACTTAGG - Exonic
1054097690 9:60916996-60917018 CTGGTGGCTGGGAGGCACTTAGG - Intergenic
1054119092 9:61192626-61192648 CTGGTGGCTGGGAGGCACTTAGG - Exonic
1054588661 9:66989936-66989958 CTGGTGGCTGGGAGGCACTTAGG + Intergenic
1055986683 9:82061101-82061123 CTGGTGGCTGGGAGGCACTTAGG + Intergenic
1056584718 9:87920483-87920505 CTGGTGGCTGGGAGGCACTTAGG - Intergenic
1056612156 9:88132457-88132479 CTGGTGGCTGGGAGGCACTTAGG + Intergenic
1057160493 9:92885113-92885135 CTGGTGGCTGGGAGGCACTTAGG - Intergenic
1058058613 9:100473441-100473463 GCGGCTGCTAGGAGGCACCGAGG + Exonic
1058754306 9:108070401-108070423 CCAGCTGCAGGGAGGCACTGAGG - Intergenic
1059470683 9:114503162-114503184 CTGGCTGCTGGGAAACTCCTAGG - Intronic
1060225341 9:121786812-121786834 ACGGCTGTTGGGTGGCCCCTAGG - Intergenic
1060414532 9:123421058-123421080 CTTGCTGCTGGGATGCATCTAGG + Intronic
1060480109 9:124012634-124012656 CCGGCTGCTGGGACGCAGAAGGG + Intronic
1060778604 9:126394997-126395019 GCGGCGTCTGGGAGGCCCCTTGG + Intronic
1060797619 9:126523172-126523194 CTGGCTGGTGGGAGGGAACTTGG - Intergenic
1061038094 9:128124589-128124611 CCAGCCGCTGGGAGTCACCAGGG + Intronic
1061196697 9:129110685-129110707 CGGGCTGCGGGAAGGCACCCGGG + Exonic
1061396932 9:130348539-130348561 CCGGATGCTGGGGGGCACTTGGG - Intronic
1061592016 9:131603802-131603824 CAGGCTGCTGGGAGCCAGCTCGG - Intronic
1061943961 9:133898118-133898140 CCTGAGGCTGGGAGGGACCTCGG + Intronic
1062074195 9:134575605-134575627 GAGGCTGCAGGGAGGCACCCAGG - Intergenic
1062366179 9:136210242-136210264 CAAGCTCCTGGGAGGCCCCTCGG - Intronic
1062372795 9:136248852-136248874 CTGGGTTCTGGGAGGCACGTGGG - Intergenic
1062453283 9:136624417-136624439 TCAGCTGCTGGGAGGCTCCCAGG + Intergenic
1062518886 9:136949539-136949561 CTGGGCGCTGGGAGGCCCCTTGG - Intronic
1062754229 9:138278879-138278901 CGGGCTGCTGGGAGGCAGGCAGG - Intergenic
1203577789 Un_KI270745v1:21636-21658 CGGGCTGCTGGGAGGCAGGCAGG - Intergenic
1186803899 X:13120285-13120307 CAGGGTGCTGAGAGGTACCTGGG - Intergenic
1189307036 X:39994665-39994687 CTGGCTGCTAGCAGGCACCATGG - Intergenic
1191177218 X:57517017-57517039 AGGGCTCCTGGGAAGCACCTTGG + Intergenic
1195803198 X:108735260-108735282 CTGTCCGCTAGGAGGCACCTGGG - Exonic
1196804936 X:119575104-119575126 CAGGCTCCGGGGAGGCGCCTAGG - Intronic
1199571955 X:149275048-149275070 CCTGTTGCTGGGAGGCAGCATGG - Intergenic
1201577763 Y:15478765-15478787 CCTCCTGCAGGGAGGGACCTGGG - Intergenic
1201577779 Y:15478826-15478848 CTTCCTGCTGGGAGGGACCTGGG - Intergenic
1202380884 Y:24276087-24276109 CGGGCTGCTGGGAGGCAGGCAGG + Intergenic
1202489900 Y:25394038-25394060 CGGGCTGCTGGGAGGCAGGCAGG - Intergenic