ID: 1104971453

View in Genome Browser
Species Human (GRCh38)
Location 12:132532697-132532719
Sequence CGGGGTGTTAAGCGCAGTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 49
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 46}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104971447_1104971453 -2 Left 1104971447 12:132532676-132532698 CCAAGGAGTCGCTGTCCCAGGCG 0: 1
1: 0
2: 0
3: 11
4: 114
Right 1104971453 12:132532697-132532719 CGGGGTGTTAAGCGCAGTGCAGG 0: 1
1: 0
2: 0
3: 2
4: 46
1104971445_1104971453 13 Left 1104971445 12:132532661-132532683 CCTGGGTAAGGGAAGCCAAGGAG 0: 1
1: 0
2: 1
3: 17
4: 258
Right 1104971453 12:132532697-132532719 CGGGGTGTTAAGCGCAGTGCAGG 0: 1
1: 0
2: 0
3: 2
4: 46

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104971453 Original CRISPR CGGGGTGTTAAGCGCAGTGC AGG Intronic
908030722 1:59996603-59996625 CTGTGTGTGAAGCTCAGTGCAGG - Intronic
910355812 1:86353310-86353332 CAGGGTGTTAAGAGCAGTGATGG + Intronic
913011747 1:114690165-114690187 GGAGGTGTTAAGTGCAGAGCAGG - Intronic
913570267 1:120112947-120112969 CCGAGTGTTAACAGCAGTGCAGG + Intergenic
914291075 1:146273924-146273946 CCGAGTGTTAACAGCAGTGCAGG + Intergenic
914552119 1:148724707-148724729 CCGAGTGTTAACAGCAGTGCAGG + Intergenic
915737300 1:158093271-158093293 CTGGGAGCTAAGCTCAGTGCTGG - Intronic
919770858 1:201157736-201157758 CAGGGTGGTAAGAGCTGTGCTGG + Intronic
1078469244 11:11573842-11573864 CGGGGTGCTGAGCACTGTGCTGG + Intronic
1094016969 12:25875155-25875177 AGGGGTGTTAGGAGCTGTGCTGG - Intergenic
1102246659 12:111360857-111360879 TGGGGTGTTAACCCCAGTCCTGG - Exonic
1103141658 12:118554014-118554036 CGGGGTATAAAGCCCAGGGCAGG + Intergenic
1104971453 12:132532697-132532719 CGGGGTGTTAAGCGCAGTGCAGG + Intronic
1131372858 15:91897759-91897781 CAGTGTGTTAAGGGCAGTGTTGG + Intronic
1133236527 16:4389740-4389762 CCGGGTGTTGAGGGCAGGGCTGG - Intronic
1136463947 16:30429361-30429383 CGAGATGTTAAGGGCAGTTCAGG - Intronic
1142179981 16:88663646-88663668 CGGGTTGTGAGGCGCTGTGCGGG + Intergenic
1142248708 16:88981297-88981319 CCGGGTGTTCAAGGCAGTGCAGG + Intergenic
1142545325 17:697658-697680 CGGGAAGTCAAGCCCAGTGCAGG + Intronic
1144529458 17:16022024-16022046 CGGGGGGTTAAGGGGAGTGTAGG + Intronic
1147556508 17:41482584-41482606 TGTAGTGTTAAGCACAGTGCAGG + Intergenic
1155054187 18:22170511-22170533 CGGGCTGGTCAGCGCAGTCCGGG + Intronic
1157543041 18:48525656-48525678 GGGGGTGTAAAGCCCAGTGAAGG + Intergenic
1161716027 19:5876794-5876816 TGGGGGGTTGAGGGCAGTGCTGG + Intronic
935127538 2:100237887-100237909 CCGGGTGACAGGCGCAGTGCAGG + Intergenic
937201550 2:120207345-120207367 GGCTGTGTTAGGCGCAGTGCAGG + Intergenic
945907665 2:215613396-215613418 CGCAGTGTTGAGCCCAGTGCGGG - Intergenic
1171946472 20:31382767-31382789 CCTGATGTTAAGCCCAGTGCTGG - Intronic
1176305223 21:5119663-5119685 CGGGGTGTTGAGGGCAGGGTGGG - Intronic
1179851831 21:44142367-44142389 CGGGGTGTTGAGGGCAGGGTGGG + Intronic
1184343187 22:43897416-43897438 CCGGGTGGTAAGAGCAGTGCTGG + Intergenic
964618275 3:158693905-158693927 CTTGGGCTTAAGCGCAGTGCAGG - Intergenic
967124034 3:186408794-186408816 CTGTGTGTTAAGCACTGTGCTGG + Intergenic
969539189 4:7775566-7775588 CCGGGTGCTAATCTCAGTGCTGG - Intronic
975800710 4:78057212-78057234 CGGGGTGTTCAGCGCGGAGGTGG + Intergenic
981074881 4:140580894-140580916 CAAGGTGATAAGCCCAGTGCAGG - Intergenic
983457863 4:167986572-167986594 GGGGGTCTTAAGCCCAGGGCAGG + Intergenic
986677817 5:10202297-10202319 AGGGGTGTTAAGGGGAGAGCAGG + Intergenic
997616240 5:135248059-135248081 TGGCATGTTAAGCTCAGTGCTGG + Intronic
998766420 5:145492931-145492953 CTGGGTGGTAAGCCCAGTGTTGG + Intronic
1005475619 6:26204768-26204790 GGGGGTGTCAAGCGCATTTCTGG + Exonic
1007292656 6:40798951-40798973 CGGGGAGTGAAGCGCAGAACAGG - Intergenic
1018824144 6:167396846-167396868 CGTGGTGTTAAGCGTCGTGTGGG - Intergenic
1027456777 7:78402149-78402171 CTAGGTGTCAAGCACAGTGCTGG - Intronic
1040598463 8:48862157-48862179 TGGGGTGTGAAGCACAGGGCTGG + Intergenic
1049391786 8:142375376-142375398 CGTGGTGGTCAGAGCAGTGCGGG + Intronic
1057772800 9:97983270-97983292 CGCCGGTTTAAGCGCAGTGCAGG + Intergenic
1060187930 9:121575193-121575215 GGGGGTGTTAAGTACAGTTCAGG - Intronic
1199642936 X:149881413-149881435 CTGGGGCTTAAGCGCAGGGCTGG - Intronic