ID: 1104971891

View in Genome Browser
Species Human (GRCh38)
Location 12:132534533-132534555
Sequence GTGTGGGCACATGTGGGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 398
Summary {0: 1, 1: 0, 2: 0, 3: 43, 4: 354}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104971891_1104971900 -2 Left 1104971891 12:132534533-132534555 CCCTGCCCCACATGTGCCCACAC 0: 1
1: 0
2: 0
3: 43
4: 354
Right 1104971900 12:132534554-132534576 ACAGGGCTCACTTCCCGCAGCGG 0: 1
1: 0
2: 0
3: 10
4: 117
1104971891_1104971905 29 Left 1104971891 12:132534533-132534555 CCCTGCCCCACATGTGCCCACAC 0: 1
1: 0
2: 0
3: 43
4: 354
Right 1104971905 12:132534585-132534607 TCTTTTATCTCCTGTTTTGTGGG 0: 1
1: 0
2: 4
3: 49
4: 555
1104971891_1104971901 -1 Left 1104971891 12:132534533-132534555 CCCTGCCCCACATGTGCCCACAC 0: 1
1: 0
2: 0
3: 43
4: 354
Right 1104971901 12:132534555-132534577 CAGGGCTCACTTCCCGCAGCGGG 0: 1
1: 0
2: 1
3: 20
4: 214
1104971891_1104971904 28 Left 1104971891 12:132534533-132534555 CCCTGCCCCACATGTGCCCACAC 0: 1
1: 0
2: 0
3: 43
4: 354
Right 1104971904 12:132534584-132534606 CTCTTTTATCTCCTGTTTTGTGG 0: 1
1: 0
2: 4
3: 47
4: 449

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104971891 Original CRISPR GTGTGGGCACATGTGGGGCA GGG (reversed) Intronic
900192215 1:1356403-1356425 GTGGGGGCATCTGTGGGGGAGGG + Intronic
900227376 1:1539629-1539651 GTGAGCGCACATGTGTGGCGGGG - Intronic
900293905 1:1939032-1939054 ATGTGGACACACGTGCGGCAGGG + Intronic
900869113 1:5289275-5289297 GTGGGAGCACAGGTGGGGCCAGG - Intergenic
901661979 1:10804338-10804360 GTGTGGGCCCATGTGGCACGTGG - Intergenic
902837249 1:19054921-19054943 GGGTGGGCACACGTGAGCCAAGG + Intergenic
904046629 1:27613083-27613105 GTGTTGGAACAGGTGGAGCAGGG - Exonic
904827265 1:33281658-33281680 GTGCGGGCACTTGTGGGGCTTGG - Exonic
905423615 1:37865516-37865538 GACTGGGCACATGGGAGGCAAGG + Intronic
905797834 1:40825516-40825538 GTGAGGGCACTTCTGGGCCAGGG + Intronic
908098940 1:60770840-60770862 GTGTGAGCTCAAGTGGGGCAAGG + Intergenic
909890151 1:80995213-80995235 GTCTGGGTACCTGTGGGGTAGGG - Intergenic
910929628 1:92430143-92430165 GGCTGTGCACATGTGGGGCAGGG - Intergenic
911525136 1:98975179-98975201 GTGTGGAAACATTTGAGGCACGG - Intronic
912843520 1:113059739-113059761 GGGTGGGGGCATGAGGGGCATGG + Intergenic
914863322 1:151404749-151404771 GGGTGGGAACATGTGAGGGAGGG - Exonic
915128533 1:153681655-153681677 GGGTGGGCATATGAAGGGCATGG - Intronic
915321777 1:155060486-155060508 CTGTGGGCACATATAGGGAAGGG - Intronic
915469686 1:156118405-156118427 GTATGTGCGCATGTGGGGCAGGG + Intronic
915571647 1:156748146-156748168 GTATAGGCACTTGTGGGGAAGGG + Intronic
915907200 1:159887722-159887744 GTGTGGGCAGGGGTGGGGCGGGG - Intronic
916800501 1:168211349-168211371 GTGTGGGAAGATGTGTGGGAAGG - Intergenic
916982591 1:170154470-170154492 GTGTGCCCAAATGCGGGGCATGG + Intronic
917567736 1:176230025-176230047 GAGTGGGCACTGGTGGGGGAAGG - Intergenic
918565004 1:185918634-185918656 GTGTGAGCAGATGTGAGGTAAGG - Intronic
919293825 1:195668670-195668692 GAGTGAGCACATGTGGGGTTTGG + Intergenic
921644211 1:217594789-217594811 GTGTGTGCACATGTGTGTAAAGG + Intronic
922324142 1:224512789-224512811 GTGTGGGCCCATGTGTGGGTGGG + Intronic
922345050 1:224689563-224689585 CTGTGAGCACATGTTGGGGATGG + Intronic
922721621 1:227902842-227902864 CTGTGGGCACCAGTGGGGCGGGG + Intergenic
923342895 1:233022536-233022558 GTGTGCAAGCATGTGGGGCAGGG + Intronic
923514242 1:234681248-234681270 GCGTGGGCACTTGGAGGGCAGGG + Intergenic
1063009778 10:2011161-2011183 GAGTGAGCACAGGTGGGGCTCGG + Intergenic
1064131475 10:12713673-12713695 ATGTGGTCAGATGTGGGGAAGGG + Intronic
1065177868 10:23096003-23096025 GTGGGGGCATAAGTGGGGCTCGG + Intronic
1067071472 10:43135726-43135748 GTGTGGACAGATGTGTGGAAGGG + Intergenic
1067342825 10:45418702-45418724 CTGTGGGCACAGGTGTGGCGAGG + Intronic
1069082575 10:64104106-64104128 GAGTGGGTGGATGTGGGGCAGGG - Intergenic
1069685628 10:70316617-70316639 AGGTGGACACAAGTGGGGCAGGG + Intronic
1070721226 10:78758505-78758527 GGCTGGGCCCGTGTGGGGCAGGG + Intergenic
1070764402 10:79048237-79048259 GTGTGGGCATGGGTGTGGCATGG - Intergenic
1071775757 10:88786229-88786251 GTGTGTGTACATGTGGGGCCAGG - Intergenic
1072683795 10:97525079-97525101 GTGTGGGCACATGACTAGCAGGG - Intronic
1073420706 10:103421567-103421589 GGTGGGGCACCTGTGGGGCAGGG + Exonic
1073448025 10:103592596-103592618 GTGCGTGCACATGTGGGGGCAGG + Intergenic
1074567286 10:114592067-114592089 ATGTAGGCACCAGTGGGGCAGGG - Intronic
1075002279 10:118807697-118807719 GTGTCCTCACATGAGGGGCAAGG - Intergenic
1075776801 10:124994392-124994414 TTGTGGGCACAAGAGGGACACGG - Intronic
1076238912 10:128887443-128887465 GTGTGGGCACAGGTGTGGATTGG - Intergenic
1076450506 10:130554073-130554095 GTGTGGGCTCCTCTAGGGCAGGG - Intergenic
1076500561 10:130933153-130933175 TTGTTGGCAGATATGGGGCATGG + Intergenic
1076501703 10:130942285-130942307 GTGTGGGCAGCTGTGGCTCAAGG - Intergenic
1076529459 10:131134921-131134943 GCATGGCCACATGTGGGGTAGGG - Intronic
1076539391 10:131204580-131204602 GTGTGGGCTCCAGTGGGGCACGG + Intronic
1076874513 10:133209352-133209374 GTGTGTGCACATGTGGTGTGAGG + Intronic
1077114238 11:875986-876008 GTGTGGGGGCATGTGAGGCTGGG + Intronic
1077391661 11:2303196-2303218 GTGTGGGTATATGTCGGGCAGGG + Intronic
1077444023 11:2582001-2582023 GTCAGGGCACTAGTGGGGCAGGG + Intronic
1079025631 11:16945699-16945721 GTGAGGGGACATGAGGGGAAGGG + Intronic
1080457864 11:32431772-32431794 GTGAGGGCAGATGTGGGGTGAGG - Intronic
1080700401 11:34639575-34639597 GGGTGGGCACATGAGGCCCAGGG - Intronic
1081810211 11:45910212-45910234 GTGTGGGGAGGGGTGGGGCAGGG - Intronic
1082861259 11:57858672-57858694 GTGTTGGCTCAGGCGGGGCACGG - Intergenic
1083581656 11:63828869-63828891 GTGGGGGCACAGGTGGGACTTGG + Intergenic
1083998889 11:66285360-66285382 GGGTGAGCACTTGTGGGCCAGGG - Exonic
1084270280 11:68025845-68025867 GTGATGGTACAGGTGGGGCAGGG - Intronic
1084276175 11:68052039-68052061 GGGTGGGCACCTCTGGGGCATGG + Intergenic
1084288874 11:68148921-68148943 GTTTGGGAACAAGTGAGGCAGGG + Intergenic
1084349667 11:68586949-68586971 GGGTGAGCCCATGAGGGGCAGGG - Intronic
1085374709 11:76049176-76049198 GAGTGGGTGGATGTGGGGCAGGG - Intronic
1089632253 11:119791196-119791218 GTGTGTGCACATGTGGGCAGGGG + Intergenic
1090404117 11:126467023-126467045 GTGTGTGCAGATATGGGCCAGGG + Intronic
1091386839 12:101292-101314 ATGTAGGTAGATGTGGGGCAGGG + Intronic
1092123868 12:6062690-6062712 GGGTGGGCTCTTGTGGGGCTGGG - Intronic
1092214787 12:6673347-6673369 ATGTGGGCACTTGTGGGGCTTGG + Exonic
1095681344 12:44980118-44980140 GGCTGTGCACGTGTGGGGCAGGG - Intergenic
1096113927 12:49044168-49044190 GTGAGGGCACCAGTGGGGCCTGG - Intronic
1098302639 12:69069649-69069671 GTGTGGGCTGAGCTGGGGCAGGG + Intergenic
1099366339 12:81769165-81769187 GTCTGGTCACATGTGGGCCAAGG - Intergenic
1100284529 12:93152647-93152669 CTGTGGAGACATGTGGGGCCAGG - Intergenic
1102119589 12:110429809-110429831 GTGTGGGCACAGGTGGAAGATGG + Intergenic
1102222985 12:111207134-111207156 GTGTGGTCCCAAGTTGGGCAGGG - Intronic
1104597741 12:130131640-130131662 GTGTGGGCACAGATGGTGCCAGG - Intergenic
1104666797 12:130653389-130653411 GTGTGCCCGGATGTGGGGCACGG - Intronic
1104707357 12:130957133-130957155 GTGTTGGCACATGTGGGTGTGGG - Intronic
1104971891 12:132534533-132534555 GTGTGGGCACATGTGGGGCAGGG - Intronic
1105211822 13:18261534-18261556 GTGTGGGCAGGTGTGGGGGGTGG - Intergenic
1108245787 13:48512036-48512058 ATGTGGGCAGATGTGCTGCATGG - Exonic
1112710542 13:102122421-102122443 TTGTGGGCACATATGGGCTAGGG - Intronic
1113701253 13:112390260-112390282 GTGTGGGGAGATCTGGGCCATGG + Intronic
1114634552 14:24179923-24179945 GTGTGTGTGTATGTGGGGCAGGG + Intronic
1114647686 14:24264584-24264606 GTGTGAGCACATGTGGGCCCAGG + Intergenic
1116373212 14:44162640-44162662 GAGTGGGTAAACGTGGGGCAGGG - Intergenic
1117674862 14:58145107-58145129 GTATGGGATCATGTGGGCCAAGG - Intronic
1118993272 14:70814642-70814664 GTTTGGGCAGATATGTGGCAGGG + Intergenic
1119400592 14:74359725-74359747 GTGTGGGACCAGGTGGGGCAAGG + Exonic
1119652410 14:76392988-76393010 CTGTGCGGGCATGTGGGGCAGGG + Intronic
1120817125 14:88872801-88872823 ATGTGGGCGCAGGTGTGGCAGGG - Intronic
1121734921 14:96211503-96211525 GTGTGCTCACACGTGGGCCAGGG + Intronic
1121813679 14:96913099-96913121 CTGTGGGCAGATGGGGGGAAAGG + Intronic
1122694362 14:103545618-103545640 GTGGCGGCACGCGTGGGGCAAGG - Intergenic
1123054746 14:105563989-105564011 GTGTGTGCACGTGTGGGGTGTGG + Intergenic
1123079186 14:105683548-105683570 GTGTGTGCACGTGTGGGGTGTGG + Intergenic
1124250718 15:28104997-28105019 GTGTGTGCATGTGTGGGGTATGG + Intergenic
1124598988 15:31115883-31115905 GTGTAGGCAGATTTGGGGCCTGG + Intronic
1124949205 15:34300831-34300853 GTTTGGGGGCATGAGGGGCAGGG + Intronic
1125598759 15:40904055-40904077 GTGTGGGGGCATGTAGGGCCTGG - Intergenic
1125599032 15:40905712-40905734 GTGGGAGCAGATGTGGGGGAGGG + Intergenic
1129194554 15:73956163-73956185 GTGTGGGCATCTGAGGTGCAGGG - Intergenic
1129197797 15:73981534-73981556 GTGCGGGCATTTGAGGGGCAGGG - Exonic
1129265231 15:74389795-74389817 GTGTGGGGACATTTGGCTCACGG + Intergenic
1130702743 15:86201902-86201924 GTTTGGGCACATGTAGGGGGCGG + Intronic
1130741868 15:86609479-86609501 GTATTGGCACCTGTGGGGTAGGG + Intronic
1132499583 16:279579-279601 TTGTGGGCAGTTGGGGGGCAAGG + Intronic
1132670407 16:1100162-1100184 GTGTGTGAGCAGGTGGGGCAGGG - Intergenic
1133072657 16:3256810-3256832 GTGGGGGCACATGTCTGCCAAGG - Intergenic
1133503651 16:6389232-6389254 CTGTGGGCACAAGTTGGGAAAGG + Intronic
1133799998 16:9077418-9077440 GAGTGGCCACAAGTCGGGCAAGG + Intergenic
1133830764 16:9321402-9321424 TTGTGAGCACAGGTGGGGCAAGG + Intergenic
1134106834 16:11491650-11491672 GTGTGGGCAGGGGTGGGGCTGGG - Intronic
1136718042 16:32300990-32301012 GGCAGGGCACAGGTGGGGCAGGG + Intergenic
1136778221 16:32882651-32882673 GTGTGGCCACATGTGGCCCAGGG + Intergenic
1136836418 16:33507260-33507282 GGCAGGGCACAGGTGGGGCAGGG + Intergenic
1136892400 16:33978863-33978885 GTGTGGCCACATGTGGCCCAGGG - Intergenic
1137539882 16:49355103-49355125 GTGTGGGGTCATCTGGGGAATGG - Intergenic
1137580790 16:49632396-49632418 GTGTGGGCACACCTGGGGACAGG - Intronic
1138477097 16:57277827-57277849 GTGAGGGCAGCTGTGGGGCGTGG + Intronic
1139423555 16:66864486-66864508 CGGTGGGGACATGTGGGGCTTGG - Intronic
1139547892 16:67658196-67658218 GTGTGGGGACCTGGGGGTCAGGG + Exonic
1139657447 16:68397603-68397625 GAGGAGGCAGATGTGGGGCATGG - Intronic
1141395356 16:83699612-83699634 GTGTGTGCATATGTGTGCCAAGG - Intronic
1141644582 16:85360368-85360390 GGGTGGGGGCAGGTGGGGCAGGG + Intergenic
1141692230 16:85602857-85602879 GTGTGGGCCCCTGCGGGGGAGGG - Intergenic
1141763986 16:86046792-86046814 GGGTGGGCAAATGCGGGGCAGGG - Intergenic
1142003798 16:87679669-87679691 GTGTGTGCACGTGTGGGTCTGGG + Intronic
1142268371 16:89076627-89076649 GTGTGTGCACATGTGGAATATGG + Intergenic
1142416261 16:89944627-89944649 TTGTGGGGACAGGTGGGGGACGG - Intergenic
1203008386 16_KI270728v1_random:216775-216797 GGCAGGGCACAGGTGGGGCAGGG - Intergenic
1203080642 16_KI270728v1_random:1144760-1144782 GTGTGGCCACATGTGGCCCAGGG + Intergenic
1142495919 17:306268-306290 GTGGGAGCAGATGTGGGGAAGGG - Intronic
1142732158 17:1866999-1867021 GAGTGGGAAGATGTGGGGCTAGG + Intronic
1142997373 17:3768920-3768942 GAGGGGGCTCATCTGGGGCAGGG + Intronic
1143515175 17:7415953-7415975 GAGTGGGCAGATGCGGCGCACGG + Exonic
1144144836 17:12387472-12387494 GTCTGGGCACAGGTGGAGCCTGG + Intergenic
1144831199 17:18132119-18132141 GTGTGTGCACATGTGGGCTATGG + Intronic
1145056551 17:19707197-19707219 CTGGGGCCTCATGTGGGGCAGGG - Intronic
1145268489 17:21391900-21391922 GTGTGGGGTCATGTCTGGCAAGG + Intronic
1145268565 17:21392298-21392320 GTGTGCTCACTTGTGGGTCATGG + Intronic
1145390291 17:22450554-22450576 GTGTGTGCACATGTGTGGGCCGG - Intergenic
1145778648 17:27546940-27546962 CTCTGGGCACCTGAGGGGCATGG + Intronic
1146266699 17:31457698-31457720 GTGTGGCCACCTGCGGGGCTGGG - Intronic
1146275587 17:31513792-31513814 GTGTGTGCGCATGTGTGGCCAGG + Intronic
1147121423 17:38337514-38337536 GGGAGGGAACTTGTGGGGCAAGG - Intronic
1147316866 17:39625255-39625277 GGGTGGGCAGAGGTGGGGAAGGG - Intergenic
1148183014 17:45620421-45620443 GTGGGGGCACGAGTGGGCCAGGG + Intergenic
1148265840 17:46225270-46225292 GTGGGGGCACGAGTGGGCCAGGG - Intronic
1149337287 17:55649075-55649097 GTGTGGACACCTTTGGGGCATGG + Intergenic
1149597014 17:57870173-57870195 GCTTGTGTACATGTGGGGCAGGG + Intronic
1151379062 17:73712283-73712305 GTGCGTGCACATGTGGGGGCCGG + Intergenic
1152477150 17:80525899-80525921 CTGTGGGTACAAGTGGGGCAGGG - Intergenic
1152917765 17:83051024-83051046 GTGCAGGCAGGTGTGGGGCACGG + Intronic
1153082086 18:1238941-1238963 GTGTCTTCACTTGTGGGGCAGGG + Intergenic
1154009919 18:10565589-10565611 GTGTGTGGACATGAGGGGCGGGG - Intergenic
1154950699 18:21206713-21206735 TTGTGGGAACATGTAGGGGAGGG - Intergenic
1156155922 18:34301502-34301524 CTCTGTGCACATGTGGGGCCTGG + Intergenic
1156535627 18:37862039-37862061 ATAAGGGCAGATGTGGGGCAAGG + Intergenic
1158004954 18:52661639-52661661 CTGTGTGCACAAGTGGGGCTGGG - Intronic
1159702879 18:71651148-71651170 GTGTGTGCGCATGTGTGTCATGG - Intergenic
1159856775 18:73598340-73598362 GTGTGGCCATAAGTGGGGCTTGG + Intergenic
1160191988 18:76722372-76722394 GAGTGGGTGGATGTGGGGCAGGG - Intergenic
1160202391 18:76806576-76806598 GTGTGTGCACATGAGGGCCCCGG - Intronic
1160288534 18:77569246-77569268 GTGAGAGCACCTGTGGTGCATGG + Intergenic
1160748561 19:722940-722962 GTGGGGTCACCTCTGGGGCATGG + Intronic
1160833953 19:1115993-1116015 GGGTGGGGCCATGGGGGGCAGGG + Intronic
1160922776 19:1528620-1528642 GTGTGGGCAGGTGGGGGGCGTGG - Intronic
1161513237 19:4683179-4683201 GGATGGGCAGAGGTGGGGCATGG - Intronic
1161943315 19:7419258-7419280 GTGTGGGCACACCTGGGGTGCGG - Intronic
1161943346 19:7419346-7419368 GTGTGGGCGCATCTGGGGTGCGG - Intronic
1162322402 19:9977843-9977865 CTGTGAGCACCTGAGGGGCAGGG + Intronic
1163017106 19:14463338-14463360 CTGGGAGCACATGTGGGGAATGG + Intronic
1163128297 19:15256377-15256399 GTGTGGGCATAGGGGAGGCAGGG + Intronic
1163169014 19:15517845-15517867 GTGTGGGCACAGCTGAGGAAAGG + Intronic
1163215224 19:15871518-15871540 GTGTGGGTGGAAGTGGGGCAGGG - Intergenic
1163795272 19:19334334-19334356 GTGTGGGTGCATGTGTGTCAGGG + Intronic
1164156778 19:22602052-22602074 GAGGGGGCAAAGGTGGGGCAGGG - Intergenic
1164304344 19:23991094-23991116 GAGTGGGTGGATGTGGGGCAGGG + Intergenic
1164492778 19:28729683-28729705 GTGTGGGCACTTGTGGACAAAGG - Intergenic
1164761733 19:30733293-30733315 GTGTGGGTACGTGGGGTGCAGGG - Intergenic
1165121027 19:33558666-33558688 GAGTGGGCACATGCTTGGCAGGG + Intergenic
1165394133 19:35555113-35555135 GTGTGGGCACAGGAGGGAGAGGG - Intronic
1166154680 19:40901974-40901996 GTGTGGGGTCTTGTGGGCCAAGG + Intergenic
1166173389 19:41048255-41048277 GTGTGGGGTCTTGTGGGCCAAGG - Intergenic
1166869874 19:45864574-45864596 GTGTGGGCTCACATGGAGCAGGG + Intronic
1166888687 19:45976521-45976543 GTGGGGGCACAAGGGTGGCATGG - Intergenic
1167127635 19:47561537-47561559 GGGTGGGCACATGTTTGGAAAGG + Intergenic
1167502922 19:49857529-49857551 CTGTGAGCAGATGAGGGGCAGGG + Intronic
1168059203 19:53882070-53882092 GTGTGTGCACGTGTGGGGGGCGG + Intronic
924991855 2:319291-319313 GTGTGGGCACGTGTGTGCCTGGG + Intergenic
925269155 2:2590106-2590128 GTGTTGGCAAAAATGGGGCAGGG - Intergenic
925929287 2:8694161-8694183 GTGGGGGCTGATGGGGGGCAGGG + Intergenic
927208462 2:20624555-20624577 CTGTGGGCAGATGTGGGCCCTGG - Intronic
927313615 2:21657022-21657044 GTGTGGGCACATCTTGGGTTGGG + Intergenic
928838923 2:35581631-35581653 GGGTGTGCACATGTCGGGTAGGG + Intergenic
929048262 2:37811991-37812013 GTGTAAGTGCATGTGGGGCAGGG + Intergenic
929831217 2:45348166-45348188 GGGTGGGCACATGGGTGCCATGG - Intergenic
930723713 2:54662868-54662890 GTGTGCGCACAAGTGCTGCATGG - Intronic
931393524 2:61865295-61865317 GTGTGGGCTCAGGCTGGGCATGG + Intergenic
932698317 2:73975637-73975659 CTGTGGGCACTCCTGGGGCAAGG - Intergenic
933853122 2:86386729-86386751 GGCTGTGCACATGTGGCGCAGGG - Intergenic
934014623 2:87866701-87866723 GTGTCTGCACATGTGGGGCGAGG + Intergenic
934301805 2:91780920-91780942 GTGTGGGCAGGTGTGGGGGTTGG + Intergenic
934856601 2:97733727-97733749 GTGTGGGCACATGTGTGCACAGG - Intronic
936267788 2:111023553-111023575 GTGTGGGGACGTGTGGGAGAAGG + Intronic
937064150 2:119004632-119004654 CTGTGGGCACAAGTGAGCCATGG + Intergenic
937927641 2:127179462-127179484 ATGTGGGCATCTTTGGGGCAGGG + Intergenic
938049784 2:128158355-128158377 GGGTGGGCACAAGTGTGGGAGGG - Intronic
938062105 2:128262161-128262183 TTGTGGGCAGGTGTGGGGCCAGG + Intronic
938081989 2:128374957-128374979 GTGGAGGCACAGGTGGTGCAGGG + Intergenic
938168668 2:129056065-129056087 GAGGGGGCACATGAGGGTCATGG - Intergenic
938200239 2:129366809-129366831 GTGTGGACTCATGTGGGTCAAGG + Intergenic
940057605 2:149529303-149529325 GTGTAGGGATATGTGGGGAAAGG - Intergenic
940612092 2:156005716-156005738 GTGTGAGCAAGTGTGGGGCCTGG + Intergenic
940998378 2:160175137-160175159 ATATGGGCACATGTGGGGCCTGG + Intronic
941805835 2:169711668-169711690 GAGTGGGTGGATGTGGGGCAGGG + Intronic
943337117 2:186629490-186629512 GAGTGGGAAAATGTGGGGCAGGG - Intronic
943750414 2:191504244-191504266 TTCCAGGCACATGTGGGGCAAGG + Intergenic
944189635 2:196988792-196988814 GTGTGGGCACATGTGCCAAAAGG - Intronic
944478528 2:200131026-200131048 GTGGGGACACATGTGGGGGTTGG + Intergenic
946044446 2:216809991-216810013 GGGTGGTGACATGGGGGGCACGG + Intergenic
946359799 2:219212471-219212493 AGGTGGGCCCATCTGGGGCAGGG - Exonic
946369338 2:219271130-219271152 GGGAGGGGAAATGTGGGGCATGG - Intronic
947917575 2:233843864-233843886 GTGTGTGCACGTGTGTGGCAGGG + Intronic
947976887 2:234374370-234374392 GTGTGTGCACGTGTGCAGCAAGG - Intergenic
948600757 2:239106333-239106355 GTGGGGGCACATGTAGGGGAGGG + Intronic
948825918 2:240573421-240573443 CTGAGGGCACATGGGTGGCAGGG - Intronic
948858649 2:240742473-240742495 CTGTGGGAACAGGTGGGTCATGG - Intronic
948995047 2:241573792-241573814 GTGGGGGCACCTGAGGGGCTGGG - Exonic
1168848139 20:959163-959185 GTGTGGGCAAGTGTGGGGGTGGG + Exonic
1168872968 20:1146633-1146655 GTGGGGGGAGAGGTGGGGCAGGG - Intronic
1169022258 20:2339217-2339239 GTGTGAGCAGCTGTGGGGCCTGG + Intronic
1169702592 20:8464839-8464861 GAGTGGGTGGATGTGGGGCAGGG - Intronic
1170153706 20:13250787-13250809 GTGTGGGCAGATGAGCTGCAGGG - Intronic
1170579101 20:17684583-17684605 CTGTTGGCAGATGAGGGGCAAGG - Intergenic
1170752982 20:19169003-19169025 GTTTTGGCAGGTGTGGGGCAGGG + Intergenic
1173447080 20:43128828-43128850 GTGTGGGCAGCTGTGGGAGAAGG - Intronic
1173733171 20:45342372-45342394 GTGGGGGCAGATGTGGCACATGG - Intronic
1173793580 20:45843500-45843522 GTGTGGGGCCGTGTGGGACAAGG - Intronic
1173836709 20:46130612-46130634 GTGTGGGGCGATGGGGGGCAAGG + Intergenic
1173926066 20:46782264-46782286 GTGTGGGTGCATGTGGTGCAAGG - Intergenic
1175219967 20:57411316-57411338 GTGTGTGCACATGTGTGTCTGGG - Intergenic
1175520538 20:59599902-59599924 GAGAAGGGACATGTGGGGCAAGG - Intronic
1175933060 20:62502482-62502504 GGGTGGGGACATGAGGGTCAGGG + Intergenic
1176167078 20:63679971-63679993 GTGCGGGCAAATGTGGCGTAGGG + Intronic
1180171101 21:46058713-46058735 GTGTGTGGACATGTGGACCATGG - Intergenic
1180814626 22:18781799-18781821 GTGTGGGCAGGTGTGGGGGGTGG - Intergenic
1181013214 22:20054210-20054232 GTGCAGACCCATGTGGGGCAGGG - Intronic
1181200815 22:21216135-21216157 GTGTGGGCAGGTGTGGGGGGTGG - Intronic
1183358694 22:37372413-37372435 GGGTGGGCACAGGGCGGGCAGGG + Exonic
1183707149 22:39481118-39481140 GTGAGGGGACATGGGGGGCAGGG - Intronic
1184250135 22:43255419-43255441 GTGTGTGCACATGTGTGTCTCGG - Intronic
1184403269 22:44286136-44286158 ATGTAGGCAAAGGTGGGGCAGGG - Intronic
1184452724 22:44592530-44592552 GTGTGGGCAAGGGAGGGGCATGG - Intergenic
1185308947 22:50142190-50142212 GTATGTGCTCATGAGGGGCAAGG + Intronic
1185337566 22:50277559-50277581 GTGGGGGCAGGTCTGGGGCAGGG - Intronic
949173385 3:1030067-1030089 CTGTTGGGAGATGTGGGGCACGG - Intergenic
949947354 3:9201194-9201216 GAGAGGGCAAGTGTGGGGCATGG - Intronic
950021293 3:9789646-9789668 GTGGAGGCACTGGTGGGGCAGGG - Intronic
951812345 3:26714765-26714787 GTGTGGGCAAATGTGGGATGAGG - Intergenic
953181555 3:40599651-40599673 GGGTGGGGACATGAGGGGAATGG + Intergenic
953348222 3:42194083-42194105 TTATGGGCACCTGTGTGGCAGGG + Intronic
954221662 3:49158647-49158669 GAGTGGGCACCGGTGGGACAGGG - Intergenic
954646640 3:52135710-52135732 GTGTGAGTACGTATGGGGCAGGG - Intronic
955912360 3:63870381-63870403 GTGTGTGCACATGTTGGGGGTGG - Intronic
956411338 3:68983070-68983092 GTGTGTTCACAGGTGGGGCCTGG - Intronic
956517536 3:70065816-70065838 GAGTGGGCAGTTCTGGGGCAGGG - Intergenic
958597068 3:96240726-96240748 ATATGGGGAAATGTGGGGCAAGG - Intergenic
958695110 3:97517738-97517760 GTGGGGGCACCGGTGGGGAAAGG - Intronic
959117683 3:102196878-102196900 GTGTGTGCACATGTGTGTGATGG - Intronic
959158993 3:102700953-102700975 GTGTGTGCACATGTGTGTGATGG - Intergenic
960534712 3:118803068-118803090 GAGTGGGTGGATGTGGGGCAGGG + Intergenic
961445021 3:126976356-126976378 GTGTGGGCAGGTGGGGGGCAGGG + Intergenic
961475801 3:127145552-127145574 TGGTGGGCACATGTGGGCCATGG - Intergenic
961551211 3:127671618-127671640 GTGTGGGGACAGGTGGGGCTGGG + Intronic
964195755 3:154062618-154062640 TTCCAGGCACATGTGGGGCAAGG - Intergenic
965066089 3:163850620-163850642 CTTTGGGGACTTGTGGGGCAGGG + Intergenic
965961289 3:174431319-174431341 GTGTAGGTAGATGTGGGGCATGG - Intergenic
966897406 3:184456256-184456278 GTGTGGGGACATCTGGCGCCTGG + Intronic
968083101 3:195860412-195860434 CTGTGGACCCATCTGGGGCACGG + Intergenic
968569929 4:1334029-1334051 GGGTGAGCACATGGTGGGCATGG - Intronic
968569961 4:1334127-1334149 GGGTGAGCACATGGTGGGCATGG - Intronic
968665867 4:1822106-1822128 TTGTGGACAGTTGTGGGGCAGGG - Intronic
970237384 4:13972550-13972572 ATGAGGGGACATGTAGGGCAAGG + Intergenic
971129830 4:23795441-23795463 GTGTGGGTACATGTGAGGACTGG - Exonic
973707102 4:53591808-53591830 TTGTGGGCAGATATGGGGAAAGG - Intronic
973853336 4:54984363-54984385 GTGTGGGGAGATGTTGGGAAAGG + Intergenic
976802492 4:89008238-89008260 CTGTGGGCACATTGGGGGCTAGG - Intronic
978106021 4:104902641-104902663 GTGTAAGCACATGTGGGGACTGG - Intergenic
979026510 4:115584251-115584273 GTCAGGGCATATGTGGGCCAAGG - Intergenic
981635372 4:146872219-146872241 GTGTGTGCACATGTGGTGTGAGG - Intronic
982502492 4:156174188-156174210 CTGTGGTCACATGGGGGGAAGGG + Intergenic
983743774 4:171168896-171168918 GAGTGGGGACATGTGTGGGATGG - Intergenic
984631912 4:182070135-182070157 GTGGAGGCACAGGTGGGGGAAGG + Intergenic
984677958 4:182571517-182571539 GGGTGTGCATGTGTGGGGCAGGG - Intronic
985542130 5:492156-492178 GTGTGGGGACTCGTGGGGGAGGG + Intronic
985656896 5:1136984-1137006 GTGTGTGCACATGTGTGTCCTGG - Intergenic
985702435 5:1381769-1381791 GTGTGTGCACATGTGGGTGTGGG - Intergenic
985834462 5:2260470-2260492 GTGAGGCCACCTGAGGGGCAGGG - Intergenic
990609268 5:57441281-57441303 GTGAGGGCAAATGTGGGGAGTGG + Intergenic
994186521 5:96821459-96821481 CTGTGGGCACACGTAGGGGAAGG + Intronic
996249995 5:121317602-121317624 GTGGTGGCACAGGTGGGGCAGGG + Intergenic
998817068 5:146025406-146025428 GGGAGGGAACATGTGGGCCAAGG - Intronic
999410598 5:151346658-151346680 GTGGGGTCAGATGTGGGGAAGGG + Intronic
1001686264 5:173597094-173597116 GTGTGGACACACCAGGGGCATGG - Intergenic
1002587142 5:180256385-180256407 ATGTGGGCAGGGGTGGGGCAGGG + Intronic
1002711918 5:181200286-181200308 GTGTGGGTGCATCTGTGGCAGGG - Intronic
1003051232 6:2782855-2782877 GTGGGGACACCTGTGTGGCAGGG - Intronic
1003625265 6:7735660-7735682 GTCTGTGCACCTGTGGGGCAGGG - Intronic
1003985069 6:11427237-11427259 GTGTGTGCACATGTGGTGTTGGG - Intergenic
1006112608 6:31757637-31757659 CTGTGAGCACATCTGGGACAGGG + Intronic
1007749243 6:44062131-44062153 CTGAGGGCACATGATGGGCAAGG - Intergenic
1007789413 6:44300645-44300667 GTGCAGCCACATGGGGGGCAAGG - Exonic
1009322720 6:62312203-62312225 GTGTGAGCAGAAGTAGGGCAAGG + Intergenic
1010120579 6:72371169-72371191 GTGTGTGCACATGTGTGGTCTGG + Intronic
1010553469 6:77251685-77251707 GTGTGAGCCCATGTAGGGCAAGG + Intergenic
1013910164 6:115266429-115266451 GTGTGGCAAGATGTGGGGCAGGG + Intergenic
1013969382 6:115998450-115998472 GTGTGGGTGCATGTGGGGAGTGG - Intronic
1014995069 6:128132535-128132557 GTGTGGGCCCCGGTGGGGAAAGG - Intronic
1015549489 6:134397127-134397149 GTGTGGAAAAATGAGGGGCAAGG - Intergenic
1017817849 6:158028137-158028159 GTCTGCCCACGTGTGGGGCAGGG + Intronic
1018250667 6:161866792-161866814 GTGTGGGAGGATGTGGGGTAAGG + Intronic
1018949057 6:168366702-168366724 GTGTGGCCAGATATGGCGCAGGG - Intergenic
1018967846 6:168502425-168502447 CTGTGGGCAGATGCAGGGCATGG - Intronic
1019057567 6:169234376-169234398 GTGTGGGTAGTTGTGTGGCATGG - Intronic
1019057572 6:169234407-169234429 ATGTGGGCAGTTGTGTGGCATGG - Intronic
1019327276 7:444675-444697 GTGTGGGCAAGCTTGGGGCAGGG - Intergenic
1019519827 7:1455570-1455592 GTGTGGTCACACGTGGCTCAAGG + Intronic
1019555028 7:1625020-1625042 GTGTGACAACATGTGGGACATGG + Intergenic
1019557799 7:1641281-1641303 GTGTGAGGACAGATGGGGCAGGG - Intergenic
1019641471 7:2105982-2106004 GCGGGGCCATATGTGGGGCAGGG - Intronic
1022544693 7:31175207-31175229 GAGTGGGTGCATGTGGGGTAAGG + Intergenic
1023763323 7:43487522-43487544 GTGTGGGCACATGTGGTAAGGGG - Intronic
1024207172 7:47173668-47173690 CTGTTGGCACATGGAGGGCATGG + Intergenic
1024730782 7:52251569-52251591 CTTTGGGCACATGTGGGGACAGG - Intergenic
1027185686 7:75969293-75969315 GTGTGGGCACGAGAGGGGCGGGG + Intronic
1027269293 7:76511362-76511384 ATGTGGCCTCCTGTGGGGCAGGG + Intronic
1027320006 7:77005257-77005279 ATGTGGCCTCCTGTGGGGCAGGG + Intergenic
1030619139 7:111770382-111770404 TTGTGGGGCCATCTGGGGCAAGG - Intronic
1032831019 7:135625961-135625983 ATGTGGGCCCATGGAGGGCAAGG - Intronic
1033313867 7:140282117-140282139 GGGTTGGCCCAAGTGGGGCATGG + Intergenic
1033602171 7:142896380-142896402 GTGGGGGCACAGGAGAGGCAGGG - Intergenic
1034345766 7:150384288-150384310 GTGTGGGCACTGGTGGGAGATGG + Intronic
1035175311 7:157045920-157045942 GTGTGTGCATGCGTGGGGCATGG - Intergenic
1036620048 8:10419073-10419095 CTGTGGGCACATGCGTGGGAGGG - Intronic
1036784004 8:11673337-11673359 TTGTAGGCACATGTGGAGGAGGG + Intergenic
1038263320 8:26017233-26017255 GGGTGGGCACATGAGGGACCTGG - Intronic
1038670316 8:29577813-29577835 GTGTGGGCACAGATGGGGGTGGG - Intergenic
1039374948 8:37023894-37023916 GTCTAGGGACATGTGGTGCAGGG + Intergenic
1039473992 8:37829787-37829809 GTGTGGGCTCATGGGTGGCCTGG - Intronic
1039589825 8:38736990-38737012 GCGTGGGGACATTTAGGGCATGG + Intronic
1040410940 8:47153464-47153486 GTTTGGCCACATGGGGGTCAGGG - Intergenic
1040597086 8:48848888-48848910 GACTGGTCAGATGTGGGGCAAGG - Intergenic
1041715589 8:60929107-60929129 GTGTGGGCAGATGGGGGCCAGGG - Intergenic
1044363446 8:91315474-91315496 GTGTGGGCACAAGTGGAACATGG - Intronic
1044630277 8:94271883-94271905 GTGTGTGCACATGTGGGGGGAGG + Intergenic
1044630284 8:94271918-94271940 GTGTGTGCACATGTGGGGGGAGG + Intergenic
1044630290 8:94271953-94271975 GTGTGTGCACATGTCGGGGGAGG + Intergenic
1048259443 8:132933462-132933484 GTGTTTGGGCATGTGGGGCAGGG + Intronic
1048896889 8:139000396-139000418 ATGTGTGCACTTGTGGGGCTGGG + Intergenic
1049030756 8:140035801-140035823 CTGTGGGCTCACGTGGAGCAAGG - Intronic
1049106596 8:140617665-140617687 GGGTGGGCTCCTGTGGGACAGGG - Intronic
1049398582 8:142413300-142413322 GTGTGTGTGCATGTGGGGCAGGG - Intergenic
1049443122 8:142618193-142618215 GAGTGGTCACATGTGGGGGGCGG - Intergenic
1049445877 8:142631267-142631289 GTGTGGGGACAGGTGGAGAAGGG - Intergenic
1049591933 8:143466625-143466647 GTGGTGGCCCATGAGGGGCAGGG - Intronic
1050036791 9:1444869-1444891 GTGTGGGCACTGGTGGCTCAAGG + Intergenic
1050839723 9:10133169-10133191 GTGTGGGCAGATTTTGGGGATGG + Intronic
1054459755 9:65456284-65456306 TGCTGGGCACCTGTGGGGCAGGG + Intergenic
1055436307 9:76295514-76295536 GTGTGGGCACCTCTGGCCCAAGG + Intronic
1055681469 9:78720228-78720250 GTGTTGGCAGATGTGGTGCCTGG + Intergenic
1056554368 9:87676662-87676684 GAGTGGGCACATCTTGGCCAAGG + Intronic
1056687277 9:88777075-88777097 GTATGGGCCCACGTTGGGCATGG + Intergenic
1056802386 9:89701594-89701616 GTGAGGGACCATGTGGGGCTGGG + Intergenic
1056949959 9:91034039-91034061 GTGTGAGCACATATGGGTCCAGG + Intergenic
1057786990 9:98095032-98095054 GTGTGGGCACACGGGGGTGAGGG + Intronic
1057802824 9:98200386-98200408 GTGGGGGCTCAGGTAGGGCATGG + Intronic
1062161455 9:135082620-135082642 GTGTGTGCATATTTGGGGCTGGG - Intronic
1188433256 X:30130929-30130951 GTGTGTGCACATTTTTGGCAAGG - Intergenic
1188923243 X:36005671-36005693 GTGTGTGCACATGTGTGCAATGG + Intergenic
1189934340 X:46051631-46051653 GGCTGTGCACATGTGGGGGAAGG + Intergenic
1190517038 X:51234652-51234674 ATGTGGGCACTTTTGGGGGAGGG - Intergenic
1193082816 X:77422603-77422625 GTGTGGGCAGAGGTGGGGGTGGG - Intergenic
1194934909 X:99937268-99937290 TGGTGAGCACATGTGGGGTAAGG + Intergenic
1195298561 X:103504183-103504205 GAGTGGGGAGAGGTGGGGCAAGG + Intronic
1198962497 X:142197018-142197040 GTGCGTGCACACATGGGGCAGGG - Intergenic
1199129855 X:144171810-144171832 GTGTCTGCACATGTGGGGCGAGG - Intergenic
1199711480 X:150472830-150472852 GTGTAGGCACATGTGTGACCTGG - Intronic
1200101615 X:153691411-153691433 GTGTGGCCACATGTGGCCCAGGG - Exonic
1202061706 Y:20896096-20896118 TGCTAGGCACATGTGGGGCAAGG - Intergenic