ID: 1104973564

View in Genome Browser
Species Human (GRCh38)
Location 12:132542132-132542154
Sequence CAGGATGACCAGATGGCACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 273
Summary {0: 1, 1: 0, 2: 2, 3: 34, 4: 236}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104973564 Original CRISPR CAGGATGACCAGATGGCACA GGG Intronic
901403201 1:9028586-9028608 CAGGAGGAGGAGGTGGCACAGGG + Intergenic
901703611 1:11058638-11058660 TAGGAAAACCAGATGGCAGAGGG - Intronic
902229498 1:15018977-15018999 CTGGATGTCCTGAAGGCACATGG + Intronic
902295536 1:15464310-15464332 CAGCAAGACCTAATGGCACAGGG - Intronic
902298427 1:15484211-15484233 TAGCAAGACCAAATGGCACAGGG - Intronic
902648410 1:17820144-17820166 GGGGATGACCAGAGGGGACATGG - Intronic
903517933 1:23924967-23924989 CAGGATCATCAGATGTCACCTGG - Intergenic
904042916 1:27594465-27594487 CAGGATGACCAGGTGCCAAGGGG + Intronic
906605368 1:47166168-47166190 AGGGGTGACCAGATGGCACCTGG + Intergenic
907040650 1:51256208-51256230 AGGGATGAACAGATGGAACACGG - Intronic
907727269 1:57031354-57031376 CAGTATTATCAGATGGAACATGG - Intronic
908618224 1:65947125-65947147 CAGAATGTCCAGATGACTCAAGG + Intronic
909184303 1:72466241-72466263 CAGGATGACCATTTGGAATAAGG - Intergenic
910191239 1:84598120-84598142 TAGGATGGCCAGATGACAGAGGG - Intergenic
914390271 1:147215001-147215023 CAGGATGATCAGAAGGCAGAAGG + Intronic
915102975 1:153513908-153513930 CAAGATGAACAGATGGTCCAAGG + Intergenic
915727772 1:158030912-158030934 CAGGATGAGCAGATGGAGCTGGG - Intronic
916585770 1:166148714-166148736 CAGGAAGATCAGATGACAAAGGG + Intronic
919840620 1:201606464-201606486 CAGGATGACAAGATGACCCGTGG - Intergenic
920092683 1:203465485-203465507 CAGGATGATCTGAGGGCACCAGG - Intergenic
920793517 1:209115497-209115519 CAGGATGATCAGATAGCATGGGG + Intergenic
922224880 1:223637472-223637494 CAGGCTGACCAGGTGGCACATGG + Intronic
922683090 1:227617178-227617200 CATGATAACCTGGTGGCACATGG - Intronic
923488721 1:234462855-234462877 TAGGATGACAAGATGGCCAATGG - Intronic
924373524 1:243382306-243382328 CAGGAAGACCAGTTAGCCCAAGG + Intronic
1063172962 10:3526243-3526265 CAAGGTGACCGGATAGCACAGGG + Intergenic
1063957517 10:11280690-11280712 CAGGATGGACAGAGGACACATGG + Intronic
1064437570 10:15324557-15324579 CAGGATGGCCAGCTAGCGCACGG - Intronic
1064444239 10:15379401-15379423 CTGGAGCACAAGATGGCACAGGG + Intergenic
1067045627 10:42983671-42983693 CAGGAAGGGCAGATGGCACAGGG + Intergenic
1068114525 10:52722755-52722777 CAGGAGGAACAGAGGGAACAGGG + Intergenic
1068283652 10:54908931-54908953 CAGGATGACCAGCTGCAACAAGG - Intronic
1070569470 10:77630336-77630358 CAGAATGACCAACTGGCACGAGG + Intronic
1070740016 10:78896737-78896759 CAGGGTGACCTGCTGACACATGG + Intergenic
1070780382 10:79134174-79134196 CAGGAGCACCAGATGCCACTGGG + Intronic
1073549354 10:104382988-104383010 CAGGATGGCCAGGTGGGACCTGG - Intronic
1075563459 10:123485781-123485803 AAGGATGACATGATGGCAGATGG + Intergenic
1075925784 10:126251116-126251138 GAACATGACCAGATGACACAAGG + Intronic
1078005327 11:7528179-7528201 GAAGATGGTCAGATGGCACATGG + Intronic
1078144353 11:8712874-8712896 CAGGAGGACCGGCAGGCACAAGG + Intronic
1079955033 11:26851821-26851843 CAGGATGACTAGATAGAAAATGG + Intergenic
1080369277 11:31615834-31615856 TGGGATGACTAGATGGAACAAGG - Intronic
1081453364 11:43195154-43195176 CAAGATAACAAGAGGGCACAAGG - Intergenic
1082648323 11:55755758-55755780 CAGGATGACCCCATGGAAAATGG - Intergenic
1084045094 11:66563792-66563814 CAGGGTGAGCAGAGGGCACTGGG - Exonic
1085730239 11:78991688-78991710 CAGGGAGACCAGGTGGCACCTGG + Intronic
1087324645 11:96706749-96706771 CAGCATAACCACATGGCCCAGGG + Intergenic
1087906611 11:103704765-103704787 CAGGCTGACCAGCTGTTACAGGG - Intergenic
1088207323 11:107408100-107408122 CTGGATGCCCAGATTGCACTAGG + Intronic
1091640870 12:2236193-2236215 CAGGATCCCCAGATGGCTCTTGG - Intronic
1092507364 12:9117341-9117363 CAGGAAGACCAGATGGGAGCTGG + Intergenic
1093228848 12:16518073-16518095 AAGAATGACCTGAAGGCACATGG - Intronic
1095370710 12:41463995-41464017 CAGGATGACCAGAGCTCTCATGG + Intronic
1095442886 12:42255597-42255619 CAACATGACCAGTTTGCACATGG + Intronic
1095443244 12:42259284-42259306 CAGGGTGACCAGATATCACCTGG + Intronic
1096477851 12:51919287-51919309 CAGAATGACCAGATGGCCCTGGG - Intronic
1096514324 12:52147858-52147880 CAGTTTGGACAGATGGCACATGG - Intergenic
1097250935 12:57632091-57632113 CAGAAGGACCAGAGCGCACAGGG + Exonic
1100397372 12:94196793-94196815 CAGGAGGACTAAATGGAACATGG - Intronic
1103685597 12:122729905-122729927 CAGGATGACCAGGGCCCACAGGG + Exonic
1103806472 12:123577546-123577568 CAGGACAAACAGCTGGCACATGG - Intergenic
1104879452 12:132060252-132060274 TGGGATGACAAGATGACACATGG + Intronic
1104973564 12:132542132-132542154 CAGGATGACCAGATGGCACAGGG + Intronic
1105284416 13:18992967-18992989 CCAGATGGCCAGAAGGCACAAGG + Intergenic
1105451055 13:20500751-20500773 ATGGATGACCAGATGCCCCATGG + Intronic
1106160779 13:27199510-27199532 CAGGGTGTCCAGCTTGCACATGG + Intergenic
1106442271 13:29786444-29786466 CAGGATGATTAGATGGCCAAAGG - Intronic
1106736410 13:32592089-32592111 CAGGATAAGCAGATGGTACAAGG - Intronic
1108027891 13:46197532-46197554 CAGGTTGCACAGATGTCACAGGG + Intronic
1112203244 13:97298920-97298942 CAGGATCACCTGAGGTCACATGG + Intronic
1113048708 13:106184931-106184953 CAGGATGAGCACATGACCCAAGG + Intergenic
1113853070 13:113428955-113428977 CAGGAAGACCATCCGGCACACGG - Exonic
1113896326 13:113766542-113766564 CAGGGTGACCAGAGGGCAGGAGG + Intronic
1115520515 14:34228841-34228863 GAGGATGAGCTGATTGCACAGGG + Intronic
1116350460 14:43855830-43855852 CAGGCAGACCATCTGGCACAGGG - Intergenic
1117095787 14:52296044-52296066 CTGGGTGACCAGATGGCAAAAGG - Intergenic
1117677701 14:58171230-58171252 CAGGAGGAACAGCTGCCACACGG + Intronic
1119722650 14:76901572-76901594 CAGGAGGGCAAGATGGAACATGG + Intergenic
1120728271 14:87971231-87971253 CAGGATCAGCAGATGGTATATGG + Intronic
1124631630 15:31340978-31341000 CAGGATGAACACAGGGCACAGGG - Intronic
1124661642 15:31554794-31554816 CAGGATCAGCTGATGGCAAAAGG + Intronic
1126215579 15:46150577-46150599 CAGGAAAACTAGATGGCAAAAGG - Intergenic
1127831205 15:62753159-62753181 CAAGAGGACAAGAGGGCACAAGG - Intronic
1129785139 15:78304760-78304782 CAGGATAACCAGTGGGCAGAGGG + Intergenic
1131390584 15:92044622-92044644 CAGGATGACCTGAAGACACATGG - Intronic
1131785299 15:95905735-95905757 TGTGATGACCAGATGGCACAGGG - Intergenic
1132691826 16:1185101-1185123 CAGAAGGACCACATGTCACACGG - Intronic
1133667002 16:7978463-7978485 CAGGACCACCAGATGCAACAGGG + Intergenic
1135215257 16:20560845-20560867 CAGGCTGACCAGATTTCAAATGG + Intronic
1136375182 16:29861189-29861211 CAGGTTGACCAACAGGCACATGG + Exonic
1137749949 16:50853671-50853693 CAAGCTGACAACATGGCACATGG - Intergenic
1139170892 16:64628090-64628112 CAGAAGGACCAGATCACACATGG - Intergenic
1141262936 16:82470142-82470164 CAGCATCCCCAGATGTCACATGG + Intergenic
1142289125 16:89184718-89184740 CAGGCTGAACAGAGGACACACGG - Intronic
1142408642 16:89904949-89904971 CAGGTTCACCAGCTGGCTCAGGG - Exonic
1142730535 17:1852525-1852547 CAGGAAGGCCAGAGGGCAGAGGG + Intronic
1146295021 17:31642690-31642712 GAGGATGACCAGAGGTCACTTGG - Intergenic
1148621499 17:49038229-49038251 CCCGATGAGCAGATAGCACAGGG + Exonic
1149181380 17:53941440-53941462 CAAGCTGGCCAGTTGGCACATGG + Intergenic
1151214144 17:72566125-72566147 CAGGAGGACCACTGGGCACAAGG - Intergenic
1152601737 17:81265791-81265813 CATGCTGAGCGGATGGCACACGG + Intronic
1152807289 17:82362149-82362171 CATGCTGACCGGAGGGCACATGG - Exonic
1153095308 18:1394663-1394685 CAGGATGACCAGACATCACATGG + Intergenic
1154453544 18:14501248-14501270 CAGGAAAAGCAGATGGCACTGGG - Intergenic
1155611903 18:27675708-27675730 CAGTATAGCCAGATGGCTCACGG + Intergenic
1156506011 18:37593798-37593820 CAGGAAGAGCAGATTTCACATGG - Intergenic
1156541670 18:37918008-37918030 CAGAATGACCAGATGCACCATGG + Intergenic
1159377439 18:67611527-67611549 AAAGAAGCCCAGATGGCACATGG + Intergenic
1160805264 19:989769-989791 CAGGATGACCAGAAGGTTCCCGG - Exonic
1161076316 19:2287504-2287526 CACGATGTACAGATGGCCCAGGG - Intronic
1161633657 19:5373398-5373420 CTGGATGAATGGATGGCACATGG + Intergenic
1163596422 19:18223728-18223750 CTGGATGACCATATTGCAAAGGG + Intronic
1164893893 19:31852053-31852075 CAGGATGACTACATGTAACATGG + Intergenic
1164898729 19:31899889-31899911 GAGGAGGACTGGATGGCACAGGG - Intergenic
1165061378 19:33206833-33206855 CAGGGTGACCTGAGGGCCCATGG + Intronic
1166274083 19:41739441-41739463 CTGCTTGACCAGATTGCACAGGG + Intronic
1167483956 19:49749369-49749391 AATGATGACCAGAGGCCACATGG - Intronic
925321568 2:2974189-2974211 TAGAATGACCAGATTGCACAGGG - Intergenic
925380548 2:3422377-3422399 CACGAGGAGCAAATGGCACATGG - Intronic
925841635 2:7997474-7997496 CAGCGAGACCACATGGCACATGG - Intergenic
927519363 2:23689762-23689784 GAGGTTGACCAGATGGCTCTGGG + Intronic
928675947 2:33651407-33651429 CAGGATGATCAGACATCACATGG + Intergenic
929949421 2:46395045-46395067 CAGGATGACCAGAGGGGAACTGG + Intergenic
930111524 2:47682849-47682871 CAGGGTGACCAGATGTCACCTGG + Intergenic
938294073 2:130166439-130166461 CATGATGCCCAGATGGCTCTTGG - Intronic
938462573 2:131507447-131507469 CATGATGCCCAGATGGCTCTTGG + Intergenic
938629833 2:133154630-133154652 CTGGAAGACCAGATGTCTCAAGG + Intronic
939726744 2:145729985-145730007 CAGGATGACCATATGGTAAGGGG + Intergenic
940898025 2:159099710-159099732 CAGGGTGACCAGATGTCACCTGG - Intronic
943229448 2:185229234-185229256 CATGATGACAAGAAGGCACATGG + Intergenic
943523608 2:188988104-188988126 CAGGATGACCAGATGTACCAGGG - Exonic
945176988 2:207053031-207053053 CAGGAAGAGCAGATGCCACAAGG + Intergenic
946938961 2:224751271-224751293 CAGGTTTACCAGCTGGCACTAGG + Intergenic
947135414 2:226972521-226972543 CAGGGTCACTAGATGGCACCAGG + Intronic
949049545 2:241890090-241890112 CAGTATAACCAAATGGCACTAGG + Intergenic
1169636741 20:7700829-7700851 CATCATGACCAGATGTCACATGG + Intergenic
1170137076 20:13086672-13086694 CAGGATTTCCAGTGGGCACATGG - Intronic
1172037379 20:32019372-32019394 CAGGATGACCAGGTTGCAGTAGG - Exonic
1173372173 20:42446861-42446883 CAGGATTACCAGATGGAAGGAGG - Intronic
1173841516 20:46160490-46160512 CAGGGTGACCAGATGGCAACAGG - Intergenic
1173891085 20:46510898-46510920 AAGGATGTCCAGAAGGCACATGG - Intronic
1175648912 20:60699653-60699675 CAGGATCACTGGATGGCAGAGGG - Intergenic
1175738848 20:61406452-61406474 CAGGCAGAGCAGATGGCAGATGG - Intronic
1175738853 20:61406480-61406502 CAGGCAGAGCAGATGGCAGATGG - Intronic
1175738867 20:61406550-61406572 CAGGCAGAGCAGATGGCAGATGG - Intronic
1175738880 20:61406620-61406642 CAGGCAGAACAGATGGCAGATGG - Intronic
1175738895 20:61406690-61406712 CAGGCAGAGCAGATGGCAGATGG - Intronic
1175738942 20:61406921-61406943 CAGGCAGAGCAGATGGCAGATGG - Intronic
1176820637 21:13652057-13652079 CAGGAAGAGCAGATGGCACTGGG + Intergenic
1177112246 21:17042467-17042489 GAGGTTGACCAGATGTCACAAGG - Intergenic
1178996381 21:37404449-37404471 CATGAGGACCAGAATGCACATGG - Intronic
1179269094 21:39835614-39835636 TGGGATGAACAGATTGCACATGG - Intergenic
1179642083 21:42754347-42754369 CAGGATGAGCAGATGGCTCGGGG - Intronic
1180800415 22:18629239-18629261 CAGGATGGCCAGACCGCACCTGG + Intergenic
1180833584 22:18918829-18918851 CCGGATGCCCAGAGGACACAGGG - Intronic
1180851649 22:19024795-19024817 CAGGATGGCCAGACCGCACCTGG + Intergenic
1181221304 22:21366023-21366045 CAGGATGGCCAGACCGCACCTGG - Intergenic
1181260033 22:21591081-21591103 CAGGAGGACCAGGTGGCAGTTGG + Intronic
1181487050 22:23238134-23238156 CGGGATGACCAGAGGGCCCAGGG - Intronic
1181543623 22:23587967-23587989 CAGGGTGACCAGATGTCACCTGG - Intergenic
1181615296 22:24050069-24050091 AAGGAAGACCAGAGGGCAAAAGG - Intronic
1181748556 22:24973074-24973096 CTGGAAGACCTGAAGGCACAGGG + Intronic
1183558200 22:38548238-38548260 GAGGATATCCAGATGGCACTGGG - Intronic
1184803069 22:46774296-46774318 CAGGAGGCCCAGAGGGAACAGGG + Intronic
1203283669 22_KI270734v1_random:144127-144149 CCGGATGCCCAGAGGACACAGGG - Intergenic
950550634 3:13663970-13663992 CAGGCTGCCCCGATGGCTCAGGG + Intergenic
950804184 3:15583547-15583569 CAAGATCTCCAGATGGCACGTGG + Intronic
952408162 3:33024026-33024048 CAGGATGAGCAGATGAGACATGG - Intronic
952421451 3:33135242-33135264 CAGGATCCCAAGATGCCACAGGG + Intronic
952974034 3:38679047-38679069 CAGGATGCCCAGAAGGACCAAGG + Intergenic
953095752 3:39774518-39774540 CATGATGACCATATGTAACATGG + Intergenic
953807829 3:46086610-46086632 CAGGAGGAGAAGAAGGCACAGGG - Intergenic
954190370 3:48955752-48955774 CAGGAGGCCAAGATGGCTCAAGG + Intronic
954339225 3:49939881-49939903 CAAGAGGACCAGGTGTCACAGGG + Intergenic
956353654 3:68366375-68366397 CAGAAAGAACAGAGGGCACAAGG + Intronic
958892177 3:99794881-99794903 CAGGATTTCCAGGTGGCAAAGGG + Exonic
960088588 3:113616273-113616295 CAAGAAGGCCAGATGGCCCAGGG + Intronic
961792059 3:129383406-129383428 CAGGCTCACCAGTTTGCACAGGG + Intergenic
963125569 3:141812735-141812757 CAGGATGAACAGTTCTCACATGG - Intronic
965151792 3:164987170-164987192 GATGATAATCAGATGGCACAGGG - Exonic
965504397 3:169496574-169496596 CAGGAAGAACAACTGGCACAAGG - Intronic
966146946 3:176823231-176823253 CAGGATGACCATCTTGCCCAGGG - Intergenic
966819838 3:183915684-183915706 CAGGATGATCTCAGGGCACAGGG + Intergenic
967081653 3:186055086-186055108 AATGATGAACAGATGGCAAAGGG - Intronic
967433734 3:189419909-189419931 CAGGATGACTGGATAGAACATGG - Intergenic
970142099 4:12994049-12994071 CATCATTCCCAGATGGCACAGGG + Intergenic
974262137 4:59539620-59539642 CAGGAGGAGCAGATGCCACCTGG + Intergenic
976194869 4:82522868-82522890 CAGGGTGATCAGATGTCACCTGG + Intronic
976315286 4:83653423-83653445 CCAGAAGAGCAGATGGCACAGGG - Intergenic
977309066 4:95362294-95362316 CAGGATGAGCACATGACCCAAGG + Intronic
979637836 4:122977818-122977840 CAGGACGACCTGATGGCAGAAGG - Intronic
982829335 4:160041790-160041812 CAGGATGAAAAGATGGCAGAAGG + Intergenic
984237555 4:177179060-177179082 CAGGAAGAGCAGATGGAAGATGG - Intergenic
985081506 4:186269731-186269753 CAAGATGGCTACATGGCACATGG + Intronic
985670372 5:1203692-1203714 CAGCATGACCAAAAGGCACAGGG - Intronic
985937000 5:3105047-3105069 CAGGATGGTCAGAGGGCACTGGG - Intergenic
988629590 5:32914671-32914693 CAGTATGACCAGAACTCACATGG - Intergenic
988993396 5:36692818-36692840 CAGCAGGTCCAGATGGCACCGGG - Intergenic
991931406 5:71756437-71756459 CATGATGAGCAGATGGAAAAAGG - Intergenic
991955724 5:71994488-71994510 CAGGATGGCAAGATGGCTAATGG - Intergenic
994043119 5:95280772-95280794 CAAGAGGACCAGCAGGCACATGG + Intronic
994664897 5:102694671-102694693 CAGGATTATCAGATGGCTCCTGG - Intergenic
996200915 5:120672104-120672126 CTGGATCACCAAGTGGCACAAGG + Intronic
998761266 5:145434676-145434698 CAGGTTGACCAGGTGGCAGTGGG - Intergenic
1000158073 5:158571549-158571571 CAGGGTGACCAGTTTGAACATGG - Intergenic
1001170803 5:169417280-169417302 CAGATTGACCAGATTGCAAATGG - Intergenic
1001957551 5:175858491-175858513 CAGCGTGAACAGATGCCACAAGG + Intronic
1002420375 5:179143598-179143620 CAGGATGACCTCATGGCCTAAGG - Intronic
1003192078 6:3883116-3883138 CAGGAGGCACAGAAGGCACAGGG - Intergenic
1004254468 6:14050330-14050352 CAGCATAACTAGATGGCACAAGG - Intergenic
1005840932 6:29744258-29744280 CAGGCTCACCAGAGGGCACAGGG + Intergenic
1005898694 6:30198882-30198904 CAGGCTGGCCAGTTGCCACACGG + Exonic
1006059951 6:31412212-31412234 TAGGCTCACCAGAGGGCACAGGG - Exonic
1006072440 6:31507287-31507309 CAGGCTCACCAGAGGGCACAGGG - Exonic
1011627622 6:89296406-89296428 CTGGATGCCCAGATGTCACTTGG - Intronic
1012451469 6:99356556-99356578 CTGGGTGATCAGATGCCACATGG + Intergenic
1014048627 6:116925574-116925596 CAGGTTGACTGGATGGCAGAGGG - Exonic
1018059820 6:160081419-160081441 AAGGATGACAAGAGGTCACAAGG + Intronic
1018352256 6:162972044-162972066 GAGGATGGTCAGATGGCAGAGGG + Intronic
1019256742 7:57285-57307 CGGGAAGACCAGGAGGCACAGGG - Intergenic
1019624543 7:2009332-2009354 GAGGAGGACCAGAGGGCACCAGG + Intronic
1020345058 7:7153746-7153768 CAACATGCCCAGATGGCCCATGG - Intergenic
1021773086 7:24024757-24024779 CAGGCTGAACAGATGGAACACGG - Intergenic
1022037132 7:26545140-26545162 CAGGGTGACAAAATGGAACACGG + Intergenic
1022549104 7:31220169-31220191 CAGGGTGACCAGTTGGAAGAAGG - Intergenic
1023344695 7:39259591-39259613 AAGGATGATCAGGCGGCACAGGG + Intronic
1030084015 7:105802090-105802112 GAGGATGACCACAGAGCACAAGG - Intronic
1030243840 7:107359834-107359856 CAGGATGACCAGCTTGCAGATGG + Intronic
1032420948 7:131778635-131778657 CAGGATGGCCAGAGGGCCTAGGG - Intergenic
1034277258 7:149829355-149829377 CAGGAGGAGGAGATGGCAGAGGG - Intergenic
1034386110 7:150742564-150742586 GAGGATGACCACATGTCTCATGG - Exonic
1035042120 7:155936515-155936537 CAGGATGACCACTGGGCAGAGGG - Intergenic
1036581706 8:10081297-10081319 CAGGAGGCCCAAATGGCACGTGG - Intronic
1038005595 8:23427253-23427275 CAGCAAGAACAGCTGGCACAAGG + Intronic
1038187720 8:25290904-25290926 CAGAATTACCAGTTGGCAGAGGG + Intronic
1039849104 8:41346916-41346938 CAGGATGACCAGAGGAGCCATGG - Intergenic
1043609949 8:82050233-82050255 CAGAAGGACAAGATGCCACATGG - Intergenic
1043728519 8:83644625-83644647 CAGGATGATCAGATGTCACATGG + Intergenic
1045470959 8:102511699-102511721 CAGGATGAACAGCTTGCTCAGGG - Intergenic
1045628665 8:104088289-104088311 CAGGATGACGAAAATGCACATGG + Intronic
1046711090 8:117512385-117512407 CAGGATGACCATCTGGCCCAAGG - Intergenic
1047806555 8:128367036-128367058 CAGGATGAACCCAAGGCACATGG - Intergenic
1048270349 8:133023182-133023204 CTGGATGACCACATGGCATGAGG + Intronic
1048408188 8:134143886-134143908 CATGTTGATCAGTTGGCACAGGG - Intergenic
1048443255 8:134475467-134475489 CAGGGAGACAGGATGGCACAGGG + Intergenic
1049213021 8:141395454-141395476 AGGGATGACCACATGGCTCAGGG + Intronic
1049401439 8:142429294-142429316 CAGGATGACCAGGGCACACAGGG - Intergenic
1049425858 8:142537595-142537617 CAGGATGGCCAGGGGCCACAAGG - Intronic
1052364315 9:27595186-27595208 CAGGACGACTAGATGGGAGAGGG + Intergenic
1053624836 9:39858775-39858797 CAGGCTGACTAGATTGCACTAGG + Intergenic
1053880033 9:42584453-42584475 CAGGCTGACTAGATTGCACTAGG - Intergenic
1054219060 9:62391923-62391945 CAGGCTGACTAGATTGCACTAGG - Intergenic
1054231656 9:62517246-62517268 CAGGCTGACTAGATTGCACTAGG + Intergenic
1057007656 9:91574796-91574818 CAGGATGACCAGACATCACCTGG - Intronic
1057283528 9:93729436-93729458 CAGAATGAACTGATGGGACAGGG - Intergenic
1060496836 9:124125527-124125549 CAGGCTGACCGGCGGGCACATGG - Intergenic
1060782684 9:126424480-126424502 CAGGATGACTACCTGGCCCAGGG - Intronic
1061314908 9:129789033-129789055 AGGGATGACAAGGTGGCACAAGG + Intergenic
1062363887 9:136199838-136199860 CGGGATGCCCAGCTGGCACGCGG + Exonic
1062722635 9:138052402-138052424 CAGCAGGACCAGGCGGCACAGGG + Intronic
1185449166 X:273713-273735 CATGAGGACCAGAGGTCACAGGG - Intergenic
1185449459 X:274894-274916 CATGAGGACCAGAGGTCACAGGG - Intergenic
1185857124 X:3546206-3546228 AAGCATGCCCAGAGGGCACATGG + Intergenic
1186858821 X:13651602-13651624 CAGGGTGATCAGATGTCACCTGG - Intergenic
1188262586 X:28037519-28037541 CAGGATGACTGGATGCCAAATGG + Intergenic
1188539620 X:31234983-31235005 CAGGGTGATCAGACGTCACATGG + Intronic
1195008714 X:100713984-100714006 AAGGATTACAACATGGCACAAGG + Intronic
1196009327 X:110870332-110870354 CAGGATTGACAGATGGCATAGGG + Intergenic
1196421050 X:115521531-115521553 TGTGATTACCAGATGGCACAAGG + Intergenic
1199237636 X:145509450-145509472 CAGGAAGCCAAGATGTCACATGG - Intergenic
1199833808 X:151568866-151568888 CAGGAGGATCAGATACCACACGG - Intronic
1199948958 X:152690208-152690230 CAGGATGATCAGATGTCTAAAGG - Intergenic
1199960718 X:152778241-152778263 CAGGATGATCAGATGTCTAAAGG + Intergenic