ID: 1104974932

View in Genome Browser
Species Human (GRCh38)
Location 12:132548146-132548168
Sequence TCCCCCCGCCCGGTGGGTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 169}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104974922_1104974932 5 Left 1104974922 12:132548118-132548140 CCAGGCAGAAGATCGGGCCTTGG 0: 1
1: 0
2: 0
3: 14
4: 111
Right 1104974932 12:132548146-132548168 TCCCCCCGCCCGGTGGGTGCAGG 0: 1
1: 0
2: 1
3: 8
4: 169
1104974915_1104974932 28 Left 1104974915 12:132548095-132548117 CCCTGTGAGGTGGGCCCTGGAGA 0: 1
1: 0
2: 3
3: 29
4: 525
Right 1104974932 12:132548146-132548168 TCCCCCCGCCCGGTGGGTGCAGG 0: 1
1: 0
2: 1
3: 8
4: 169
1104974918_1104974932 14 Left 1104974918 12:132548109-132548131 CCCTGGAGACCAGGCAGAAGATC 0: 1
1: 0
2: 0
3: 20
4: 228
Right 1104974932 12:132548146-132548168 TCCCCCCGCCCGGTGGGTGCAGG 0: 1
1: 0
2: 1
3: 8
4: 169
1104974916_1104974932 27 Left 1104974916 12:132548096-132548118 CCTGTGAGGTGGGCCCTGGAGAC 0: 1
1: 0
2: 1
3: 33
4: 290
Right 1104974932 12:132548146-132548168 TCCCCCCGCCCGGTGGGTGCAGG 0: 1
1: 0
2: 1
3: 8
4: 169
1104974919_1104974932 13 Left 1104974919 12:132548110-132548132 CCTGGAGACCAGGCAGAAGATCG 0: 1
1: 0
2: 1
3: 21
4: 144
Right 1104974932 12:132548146-132548168 TCCCCCCGCCCGGTGGGTGCAGG 0: 1
1: 0
2: 1
3: 8
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104974932 Original CRISPR TCCCCCCGCCCGGTGGGTGC AGG Intronic
900160554 1:1221293-1221315 TCCCCCCGTCCTGGGGTTGCAGG - Intronic
900433354 1:2613167-2613189 GCCCCCCGCCCGGTGGAAACAGG + Intronic
900511521 1:3063150-3063172 TCTCCTCGCCCGCTGGGTGGAGG - Intergenic
901063771 1:6485523-6485545 TCCCCGCGCTCGGCGGGGGCGGG - Intronic
901776697 1:11565180-11565202 TGCCCTTGCCCTGTGGGTGCAGG - Intergenic
901928153 1:12579964-12579986 TCCCCAGGCCCTGTGGCTGCTGG - Intronic
903174910 1:21575021-21575043 TCCCACCTCCGGGTGAGTGCAGG - Intronic
903332273 1:22602272-22602294 TCCCCCGCCCCCATGGGTGCTGG - Exonic
903651916 1:24927730-24927752 TCCCCCCGCCCCGTGTCTTCAGG - Exonic
905182283 1:36174886-36174908 TTCCCCCTCCAGGTGGGAGCAGG + Exonic
905891525 1:41521396-41521418 TGCCCCCGCCACGGGGGTGCAGG + Intronic
906345090 1:45009975-45009997 TCCTCCTACACGGTGGGTGCTGG - Exonic
907159985 1:52362598-52362620 TCACCCTGCCCCTTGGGTGCTGG + Exonic
921389321 1:214603442-214603464 TCTCCCGGCCCTGTAGGTGCCGG + Intronic
922594385 1:226802814-226802836 TCCCCCTGCCCCGTGAGTGAGGG + Intergenic
922644950 1:227276517-227276539 TCACCCCGTCCGGGAGGTGCGGG + Intronic
924763283 1:247008273-247008295 TCCCCCAGGCAGGTGGGTCCAGG - Intergenic
1070668287 10:78360713-78360735 TCTCCCAGCCAGGAGGGTGCAGG - Intergenic
1071565256 10:86668333-86668355 TCCTCCCCCCTGGGGGGTGCTGG + Intergenic
1073115175 10:101087797-101087819 GCACCTCGCCCGGTGGGTGGGGG + Intergenic
1075105882 10:119539667-119539689 TCCACCCGTCCTGTGGGTTCAGG - Intronic
1075712148 10:124536478-124536500 GCCCCCAGCCCGGTGGGTCAGGG + Intronic
1076298617 10:129406621-129406643 GCCCCCCGCCCCATTGGTGCAGG - Intergenic
1077510698 11:2960302-2960324 TCCCCCAGCAGGGTGGGGGCTGG - Intronic
1081774078 11:45665771-45665793 TGCCCCCGGCGGGTGGGTGGGGG - Intergenic
1081864278 11:46351133-46351155 TCCTCCTTCCCGGTGGGTCCTGG - Intronic
1083266823 11:61550689-61550711 GTCCCCCGCCAGGTGGGTGGGGG + Intronic
1083891579 11:65598305-65598327 TGCCCAGGCCCCGTGGGTGCCGG - Exonic
1084564353 11:69920817-69920839 TCCCCCCGCCCCATGGCTGCAGG - Intergenic
1085312962 11:75526709-75526731 CCACCCCGCGCGTTGGGTGCAGG + Intergenic
1089443187 11:118532512-118532534 ACCACCTGCCTGGTGGGTGCTGG - Intronic
1091402534 12:189540-189562 ACCCCCCGCCCAGGGGCTGCAGG - Intergenic
1092365356 12:7872767-7872789 TCCCTGCGGCCGGGGGGTGCGGG - Intronic
1094199134 12:27779827-27779849 TCCGCCCGCCCGGGGCGCGCCGG - Intergenic
1095957034 12:47812971-47812993 GCCCCTCGCCCGGTGGGGGTGGG + Intronic
1096143832 12:49264693-49264715 GCCCCGTCCCCGGTGGGTGCGGG - Intronic
1104974932 12:132548146-132548168 TCCCCCCGCCCGGTGGGTGCAGG + Intronic
1108403878 13:50081184-50081206 TCCCCCGGCGCGCTGGGTCCCGG - Intergenic
1109378329 13:61525618-61525640 TCACCCCGCCCCGTTTGTGCTGG + Intergenic
1115331672 14:32204253-32204275 TACCCCTGACCTGTGGGTGCAGG + Intergenic
1117298192 14:54397467-54397489 TCCCCAGGCCCTGTGGGCGCAGG - Intronic
1119380626 14:74225948-74225970 CCCCCGCGCACTGTGGGTGCTGG - Intergenic
1119494742 14:75069260-75069282 TCCGCCCGCCTGGCGGGAGCGGG - Exonic
1122415581 14:101548128-101548150 ACCCCCCACCCGGCCGGTGCTGG - Intergenic
1122635294 14:103126946-103126968 CCGCCCCGCCCGGTGGGCGGTGG + Intronic
1123441569 15:20295447-20295469 CCCCCACCCCCGGTGTGTGCAGG - Intergenic
1123705953 15:22951375-22951397 AGCCCCGGCCGGGTGGGTGCAGG + Intronic
1123781328 15:23631906-23631928 TCCCCAGGTCAGGTGGGTGCTGG - Intergenic
1128072803 15:64807903-64807925 TCCCCGCCCCCAGTGGGTGTTGG - Intergenic
1129431770 15:75504699-75504721 GCCCCCCGCCCGGGAGGTGAGGG + Intronic
1130272128 15:82457514-82457536 GCCCCCTTCCCCGTGGGTGCTGG + Intergenic
1130464480 15:84184867-84184889 GCCCCCTTCCCCGTGGGTGCTGG + Intergenic
1130488207 15:84409937-84409959 GCCCCCTTCCCCGTGGGTGCTGG - Intergenic
1130499787 15:84488670-84488692 GCCCCCTTCCCCGTGGGTGCTGG - Intergenic
1130586772 15:85189481-85189503 GCCCCCTTCCCCGTGGGTGCTGG + Intergenic
1135136123 16:19886070-19886092 TCCCCTCTCCCGGGGGCTGCAGG + Intronic
1136180475 16:28548485-28548507 TCCAGCCGCCTGGTGGGTACCGG + Intergenic
1137665306 16:50246121-50246143 TCCCCGCCCGCGGTGAGTGCCGG + Intronic
1138343963 16:56308733-56308755 GCGCCCAGCCCCGTGGGTGCCGG - Intronic
1139529880 16:67537828-67537850 TCCCCCTGCCTGGAGGGCGCCGG + Intronic
1141670624 16:85489933-85489955 TTCCCACTCCCGGTGGGTGTGGG - Intergenic
1142047199 16:87933051-87933073 TCCCCACTCTGGGTGGGTGCAGG - Intronic
1142261279 16:89043553-89043575 TGCCCCAGCCCGGGAGGTGCTGG - Intergenic
1143554417 17:7651641-7651663 TTCCCCCGCCCCTTGCGTGCCGG - Intronic
1143784167 17:9244378-9244400 TCCGCCCACCCGGGGGTTGCAGG - Intergenic
1144391083 17:14793944-14793966 GCCCCCCGCGCAGTGGCTGCCGG - Intergenic
1144678508 17:17177009-17177031 TCTCCAGGCCCGGTGAGTGCAGG - Intronic
1145210688 17:21011120-21011142 CGCCCCCGCCGTGTGGGTGCAGG + Intronic
1146048844 17:29532996-29533018 GCCCCCCGCCCGGTTGGAGGTGG - Intronic
1151662502 17:75526108-75526130 TGCCCCGGCCGGCTGGGTGCGGG + Intronic
1151869795 17:76828552-76828574 TCCCTCGGCCAGGAGGGTGCAGG - Intergenic
1152593894 17:81229049-81229071 TGTCCCCGCCTGGTGGGGGCTGG - Exonic
1152638045 17:81438230-81438252 TCCCCCCGGCGGCTGCGTGCTGG + Intronic
1152724157 17:81937049-81937071 TCCACCCCTCCAGTGGGTGCGGG - Intronic
1155571196 18:27195850-27195872 TCCCACTGCCCGGTGGATGCTGG + Intergenic
1158137783 18:54224801-54224823 TCCGCGCGCCCAGTGGGGGCCGG - Intergenic
1158543560 18:58377644-58377666 CCCCTCCTCCCGGTGGGGGCAGG - Intronic
1159100386 18:63951432-63951454 TCCCCCCTGCTGGTGAGTGCAGG - Intronic
1160829601 19:1097380-1097402 CCACCCCGCCCGGTCTGTGCAGG + Intergenic
1160961768 19:1725411-1725433 TCCCCCCGCCCCGAGGTAGCGGG + Intergenic
1161055999 19:2190874-2190896 TCCCCCTGCAGGGTGGCTGCCGG - Intronic
1161479244 19:4502465-4502487 CCCCCCAGCCTCGTGGGTGCGGG - Exonic
1161574502 19:5048180-5048202 TGCCCCTGCCCGGGAGGTGCCGG + Intronic
1162007161 19:7788255-7788277 TTCCCTTGCCCGGGGGGTGCGGG - Intergenic
1162904869 19:13817578-13817600 TCCCCCAACCCCGTGAGTGCTGG + Intronic
1163645844 19:18488541-18488563 AGCCCCCGCCCCGTGGATGCTGG - Intronic
1165924711 19:39320107-39320129 TTCCCCTTCCCGGTGGTTGCGGG - Intergenic
1166121801 19:40691023-40691045 TTCCCCAGCCCGGCGGGGGCGGG + Intergenic
1166361205 19:42253750-42253772 TCCCCCTGCTCGGCGGGTGGGGG - Intronic
1166367402 19:42284477-42284499 TCCCGCCGCCCGGGGGGCGGGGG - Intronic
1166856722 19:45785986-45786008 TGCCCCCGCCAGCTGGGTGCGGG + Exonic
1166861665 19:45815119-45815141 TCCTCCGGCCCGGAGGCTGCTGG + Exonic
1167578464 19:50328895-50328917 TCCCCGGGCCCGCGGGGTGCCGG + Exonic
927937980 2:27086160-27086182 TCCCCACGCCCGGGGCGCGCCGG + Exonic
932635779 2:73386393-73386415 TCCTCCCCCTCGGTGGGTCCTGG + Intronic
934951688 2:98580161-98580183 TCCACCCTGCCCGTGGGTGCAGG + Intronic
935399401 2:102644425-102644447 CCCCCCCGCCCAGTGGCTCCTGG + Intronic
937046515 2:118854870-118854892 ACCCCCTTCCCGGTGGGTGTCGG + Intergenic
937100601 2:119265168-119265190 TCCCCAACCCCGGTGGGTACTGG + Exonic
948588706 2:239036397-239036419 TCCCCCAGCCCGCTGGGCCCAGG - Intergenic
948749719 2:240124743-240124765 CCCCTCTGCCCAGTGGGTGCAGG + Intergenic
948749734 2:240124781-240124803 ACACTCTGCCCGGTGGGTGCAGG + Intergenic
948795788 2:240401481-240401503 GCCCCCCGCTCCGTGGGTACAGG - Intergenic
948902766 2:240964663-240964685 CCCTCCCGCCTGGTGGGTCCCGG + Intronic
1168806927 20:676935-676957 GCCCCCTGCCCAGAGGGTGCTGG + Intergenic
1170674533 20:18467050-18467072 GCGCCCCGCCCACTGGGTGCTGG + Exonic
1173838365 20:46140156-46140178 ACCCACCGCCCCCTGGGTGCAGG - Intergenic
1173846671 20:46192914-46192936 TGCCCCCCCCCAGTGGGAGCAGG + Intronic
1173859564 20:46273939-46273961 TCCCTCCTCCCAGTGGCTGCAGG - Intronic
1173939155 20:46895025-46895047 TCCCCCCGCCCGGCGAATCCCGG - Intronic
1175907149 20:62386586-62386608 TCCCCCGGGCCGGTGGGCGAAGG - Intergenic
1175911214 20:62406396-62406418 ACCCCCAGCCCTGTGGGTTCTGG - Intronic
1180171913 21:46063981-46064003 GGCTCCCTCCCGGTGGGTGCAGG - Intergenic
1180758208 22:18177890-18177912 TCCCCCACCCAGGTTGGTGCCGG - Intergenic
1180768496 22:18361682-18361704 TCCCCCGCCCAGGTTGGTGCCGG - Intergenic
1180777814 22:18500709-18500731 TCCCCCACCCAGGTTGGTGCCGG + Intergenic
1180810540 22:18758020-18758042 TCCCCCGCCCAGGTTGGTGCCGG + Intergenic
1180826372 22:18864906-18864928 TCCCCCCGCCAGGTTGGTGCCGG - Intergenic
1181196683 22:21192275-21192297 TCCCCCGCCCAGGTTGGTGCCGG + Intergenic
1181212842 22:21300849-21300871 TCCCCCGCCCAGGTTGGTGCCGG - Intergenic
1183748160 22:39704165-39704187 TGCCCCCGCCAGGAGGGAGCTGG + Intergenic
1184778020 22:46632977-46632999 GCCCCCCGCCCGGTGGGGATGGG + Intronic
1184865021 22:47197451-47197473 CGCCCCCGCCCTGTGGGTGCCGG + Intergenic
1185266013 22:49904326-49904348 CCCCCCAGACAGGTGGGTGCTGG - Exonic
1203230114 22_KI270731v1_random:102570-102592 TCCCCCGCCCAGGTTGGTGCCGG - Intergenic
1203276515 22_KI270734v1_random:90812-90834 TCCCCCCCCCAGGTTGGTGCCGG - Intergenic
950164197 3:10781133-10781155 GCCCCCCGCCCTCTGGCTGCTGG - Intergenic
950168110 3:10816554-10816576 GCCAACCGCCCGGTGGGGGCGGG + Intronic
952788090 3:37176022-37176044 CCCGCCAGCCCGGTGGGAGCAGG - Intronic
954795790 3:53160918-53160940 TCCCTCCGCCCGCTGGGGCCTGG - Intronic
966355055 3:179071367-179071389 TGCCCCCGCCCCGTGGGAGTCGG - Intronic
968230441 3:197002456-197002478 TCCCCAGGCCCAGCGGGTGCGGG + Exonic
969317822 4:6392684-6392706 TCTCCCGGCCTGCTGGGTGCAGG - Intronic
969865013 4:10069578-10069600 TCCCCCCGCCTTGTGTCTGCAGG + Intergenic
979495847 4:121381119-121381141 TTCCCTCGCCCTGAGGGTGCGGG - Intergenic
985998773 5:3613770-3613792 ACCCCCCGCCCGGTGTGTACGGG + Intergenic
990165504 5:52989331-52989353 CTCCCCCGCCCGGTGAGAGCAGG - Exonic
997461144 5:134053363-134053385 TCCCCAGGCATGGTGGGTGCGGG - Intergenic
997528141 5:134566604-134566626 ACCCCCTGCCTGGTGGGTCCAGG + Intronic
997674473 5:135702432-135702454 TCCCACCTTCTGGTGGGTGCTGG - Intergenic
998174627 5:139894206-139894228 TGCCCCTGCCCGCTGGGTGCCGG - Intronic
1001382138 5:171311872-171311894 GCGCCCGGCCCGGGGGGTGCGGG - Exonic
1002457753 5:179355430-179355452 TCCCCCGGCCAGGTGGCTCCAGG + Intergenic
1003573700 6:7273872-7273894 TCCCCCCGCCCTCGGCGTGCTGG + Intronic
1013803124 6:113970244-113970266 CCCCTCCTCCCGGTGGGCGCTGG - Intronic
1015937586 6:138418649-138418671 TCCCCCCTCCCTGTGGTTGTTGG + Exonic
1016915141 6:149237742-149237764 TCCCCTCCCACTGTGGGTGCTGG + Intronic
1016923572 6:149318213-149318235 TCCCCCAGTCCGGTGGGGGTGGG + Intronic
1017914204 6:158819162-158819184 TCCACCTGCCCCGGGGGTGCCGG + Intronic
1018787151 6:167116981-167117003 TCCCCTCCCGCGGTGGGTGGAGG + Intergenic
1019421386 7:952886-952908 CCTCCCCTCCCAGTGGGTGCAGG - Intronic
1019531142 7:1504109-1504131 TCGCCCCGCCGGGCGGGCGCGGG - Intronic
1023923873 7:44650925-44650947 TCCCACCTCCCTGTGGATGCAGG + Intronic
1027269830 7:76513242-76513264 GCCCCCAGCCCTGTGGGAGCAGG - Intronic
1027774215 7:82444080-82444102 TCCCGCCGCCCGGCGTGCGCAGG + Intergenic
1028685426 7:93585813-93585835 GCCCCCCGCCCGGGAGGTGAGGG - Intergenic
1029560482 7:101299840-101299862 TCCCCGCGCGCGGGGGCTGCAGG - Intergenic
1032074516 7:128830220-128830242 TCCCGCCGCCCGGGCGGCGCGGG + Intergenic
1035221939 7:157411261-157411283 TCCCCACGCCCGCTCAGTGCAGG - Intronic
1035221963 7:157411336-157411358 TCCCCACGCCCGCTCAGTGCAGG - Intronic
1035221974 7:157411373-157411395 TCCCCACGCCCGCTCAGTGCAGG - Intronic
1037579442 8:20235977-20235999 TCCCCCCACCCCCAGGGTGCTGG + Intergenic
1038020830 8:23550836-23550858 TCCCGCCAGCCCGTGGGTGCGGG - Intronic
1049044289 8:140137110-140137132 TGCCCGAGCCCTGTGGGTGCTGG - Intronic
1049427121 8:142542534-142542556 TCCCCCAGGCTGGGGGGTGCCGG - Exonic
1049570024 8:143365301-143365323 GCCCCTTGCCCAGTGGGTGCTGG - Intergenic
1049617098 8:143580408-143580430 TCCCCCTGCCCTCTGGGTTCTGG - Intronic
1056475098 9:86945888-86945910 TGCCCGGGCGCGGTGGGTGCGGG + Exonic
1060917945 9:127402546-127402568 ACCCCCCGCAGGCTGGGTGCTGG + Exonic
1061455323 9:130693282-130693304 TGCGGCCGCCCCGTGGGTGCTGG - Intergenic
1061515509 9:131087706-131087728 TCCCCCTGAAAGGTGGGTGCTGG + Exonic
1061808376 9:133148881-133148903 TCCCTCCCCCCGGTGGGTGTGGG + Intronic
1062013567 9:134280129-134280151 TCCCCACTCCCGGGGGCTGCTGG - Intergenic
1062272133 9:135714450-135714472 CCCGCCCGCCCGGTGGGTCGCGG + Intronic
1062289379 9:135787684-135787706 GCCCCCAGCCCTGTGGGCGCTGG + Intronic
1062360063 9:136183399-136183421 TCCCCGCTCCTGGTGGCTGCTGG + Intergenic
1185874486 X:3691421-3691443 TCCCCCCGCCCCGGGGGAGTGGG + Intronic
1202370739 Y:24193803-24193825 GCCCCCTTCCCTGTGGGTGCTGG - Intergenic
1202500045 Y:25476314-25476336 GCCCCCTTCCCTGTGGGTGCTGG + Intergenic