ID: 1104976271

View in Genome Browser
Species Human (GRCh38)
Location 12:132553309-132553331
Sequence CCTGAGCCTGCACTTTGACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 171}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104976259_1104976271 29 Left 1104976259 12:132553257-132553279 CCGTGGGGTGACCTCACAGGGTG 0: 1
1: 0
2: 1
3: 15
4: 158
Right 1104976271 12:132553309-132553331 CCTGAGCCTGCACTTTGACCTGG 0: 1
1: 0
2: 0
3: 16
4: 171
1104976265_1104976271 -9 Left 1104976265 12:132553295-132553317 CCGCCACCCTCCTTCCTGAGCCT 0: 1
1: 1
2: 5
3: 132
4: 1708
Right 1104976271 12:132553309-132553331 CCTGAGCCTGCACTTTGACCTGG 0: 1
1: 0
2: 0
3: 16
4: 171
1104976263_1104976271 18 Left 1104976263 12:132553268-132553290 CCTCACAGGGTGTGTGGGGTTCC 0: 1
1: 1
2: 3
3: 11
4: 221
Right 1104976271 12:132553309-132553331 CCTGAGCCTGCACTTTGACCTGG 0: 1
1: 0
2: 0
3: 16
4: 171
1104976264_1104976271 -3 Left 1104976264 12:132553289-132553311 CCGAAGCCGCCACCCTCCTTCCT 0: 1
1: 0
2: 2
3: 29
4: 371
Right 1104976271 12:132553309-132553331 CCTGAGCCTGCACTTTGACCTGG 0: 1
1: 0
2: 0
3: 16
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104976271 Original CRISPR CCTGAGCCTGCACTTTGACC TGG Intronic
903283277 1:22262418-22262440 CCTCAGCCTGCTGTGTGACCTGG - Intergenic
905576383 1:39048077-39048099 CCTGGGCCTGCACTTTGATTTGG - Intergenic
906066005 1:42980531-42980553 CCTGAGACTGCATTCTGACGAGG - Intergenic
913481768 1:119295628-119295650 CCTGAGCCTTCAATCTGCCCTGG - Intergenic
914646009 1:149653220-149653242 TCTGAGCCTGAACTTTTCCCTGG + Intergenic
918482582 1:184994982-184995004 TCTGAGCCTGCACCTTACCCTGG + Intergenic
919461727 1:197884691-197884713 CCAGAGACTGCACTTTTCCCAGG - Intergenic
920369310 1:205467877-205467899 CCTGAGTATGCAATGTGACCAGG + Intergenic
920524772 1:206658620-206658642 CCTGCGGCTGCACTTTCACGGGG + Intronic
922730130 1:227945354-227945376 CCTGGCCCTGCACCTTGGCCTGG - Intronic
923668123 1:236016505-236016527 CCTCCTGCTGCACTTTGACCTGG - Intronic
1064091650 10:12390603-12390625 CCTGGCCCTGCACTCTTACCTGG - Intronic
1065843854 10:29728804-29728826 CCCCAGCCTGCTCTTTGACTTGG - Intronic
1067088641 10:43255524-43255546 CCAGAGCCTGCACCTGGAGCAGG + Intronic
1068053681 10:51983450-51983472 CCTGAGGCTGCACTGTAAGCAGG + Intronic
1072100693 10:92226779-92226801 CCTGAGCCCCCACTCTGCCCAGG - Intronic
1072725663 10:97811760-97811782 CCTGAGCCTGCACCTGCAGCGGG - Intergenic
1075932725 10:126313108-126313130 CCTGAGCCTGCAGCTTGGCTGGG + Intronic
1077359398 11:2134044-2134066 CCTGAGCTTGGACTCTGGCCTGG + Intronic
1081911908 11:46705188-46705210 CCTGTGCCCGCACTGTGGCCGGG + Exonic
1083208870 11:61170238-61170260 CCTGAGCTTGCACTTTCACGGGG - Intergenic
1083349900 11:62020168-62020190 ACAGAGACTGCACTTTAACCAGG - Intergenic
1083354688 11:62057529-62057551 CCTGAGGCTACATTTTGATCTGG + Intergenic
1083775292 11:64891614-64891636 GTTGAGCCTGGACTTTGCCCAGG - Intergenic
1085271770 11:75273978-75274000 CCTGAGCCTTGTCTTTGAACTGG + Intronic
1085341559 11:75734786-75734808 AATCAGCCTGCACTTTGACCTGG + Intergenic
1085692629 11:78676184-78676206 CCCGAGCCTGCTCTTTGCGCTGG + Exonic
1085740352 11:79073239-79073261 CAAGAGCCTTCATTTTGACCAGG - Intronic
1088998147 11:115021601-115021623 TCTGAGCCTGCACCTTTCCCTGG - Intergenic
1090036317 11:123252680-123252702 CCTGAGCCTGCTCTTTCCCCGGG + Intergenic
1091229019 11:133975753-133975775 CCAGAGCCTGCAAGGTGACCTGG + Intergenic
1092508435 12:9127794-9127816 CCAGAGCCCGCACCTTGTCCAGG - Intergenic
1093264197 12:16982263-16982285 TCTGAGCCTGCACCTTTCCCTGG + Intergenic
1102646065 12:114404805-114404827 CCTGAGCCTGCAGTTTTAGCAGG - Intronic
1103977944 12:124715890-124715912 CATCAGCCAGCACTTTGAGCAGG - Intergenic
1104976271 12:132553309-132553331 CCTGAGCCTGCACTTTGACCTGG + Intronic
1106119434 13:26847262-26847284 TCTGAGCCTGCACCTTTCCCTGG + Intergenic
1106236200 13:27862615-27862637 CATGAGTCTGCAATTTGACAAGG + Intergenic
1107407372 13:40127368-40127390 TCTGAGCCTGCACTGGAACCAGG + Intergenic
1110413366 13:75226865-75226887 CCTGAGACTGCATTTTTAACAGG + Intergenic
1111206162 13:85013631-85013653 CCTAAGCCTCCAGTCTGACCAGG + Intergenic
1113740566 13:112710017-112710039 CCTCTGCCTGCACTCTGCCCTGG + Intronic
1114776272 14:25485640-25485662 TCTGAGCCTGCACTTTTAAGAGG - Intergenic
1115174722 14:30548946-30548968 GCTGAGCCTGCACCTTCACCTGG + Intergenic
1115868964 14:37778763-37778785 TCTGAGGCTGCACTATGAGCAGG + Intronic
1121326364 14:93022187-93022209 CCTTTGCCTGCTCTTGGACCTGG - Intronic
1121491343 14:94363536-94363558 CCGGAGACAGCACTGTGACCTGG + Intergenic
1123083835 14:105708340-105708362 CCCCAGCCTGCCCTCTGACCTGG + Intergenic
1128131630 15:65231491-65231513 CGTGACCCTGCACTTTAGCCTGG - Intergenic
1128628754 15:69240947-69240969 CCTGAGCCTGCAATTCGAGCAGG + Intronic
1132850703 16:2023720-2023742 CCCGAGCCTGGACCTGGACCGGG - Intergenic
1138142225 16:54578601-54578623 CCAGAGCCTGAACTTTCAACAGG - Intergenic
1138392333 16:56679206-56679228 CCAAAGCCTGCACTTGGCCCAGG - Intronic
1139338154 16:66247903-66247925 CGTGAGCCAGCACTTTGGCTGGG - Intergenic
1142617849 17:1146926-1146948 CTTGAGCCTGCTCTGTGGCCAGG - Intronic
1144377339 17:14657423-14657445 CCTGAAGCTGCCCTTTGATCTGG - Intergenic
1145780113 17:27557203-27557225 CCTGACCCTGAAGTTTGGCCTGG + Intronic
1149259430 17:54862882-54862904 CTTGAGCCTGCCATTTGACCAGG - Intergenic
1149750594 17:59141821-59141843 CATGGACCTGCACATTGACCCGG + Intronic
1152253399 17:79223548-79223570 CCCGACCCTGCACTTGGGCCAGG + Intronic
1152591253 17:81213747-81213769 CCTGACCCTCCACCTTGGCCAGG + Intronic
1155558571 18:27049968-27049990 CCGGAGCCTGCACTTTGTTGAGG - Intronic
1157892727 18:51433405-51433427 ACTGAGCCTTCACTTTGAAAAGG + Intergenic
1160741407 19:687821-687843 CCTCAGCCTCCCCTTTGGCCAGG + Intronic
1162472945 19:10883241-10883263 CCTGAGCCTGCTATGTGGCCTGG + Intronic
1162802393 19:13118562-13118584 CCGCAGCCTGCACTGTGCCCGGG + Intronic
1164931473 19:32179216-32179238 CCTGAGCATCCACTCTGCCCTGG + Intergenic
1165065660 19:33226585-33226607 GCTGAGCCCTCACTCTGACCTGG - Intergenic
1165149587 19:33753172-33753194 CCAGAGCCTGCACCTTCACCAGG + Intronic
1167131485 19:47588973-47588995 GCTGAGCCTGCACTCCAACCTGG + Intergenic
1168723930 19:58570509-58570531 CCTGCACCTGGACTGTGACCTGG + Exonic
925148190 2:1594955-1594977 CCTGAGCCTACTCTGTGATCAGG + Intergenic
925232308 2:2244632-2244654 CTGGAGCCTGCAGTTTGAGCAGG - Intronic
926261426 2:11267221-11267243 CCTTAGGAAGCACTTTGACCAGG + Intronic
927197586 2:20558948-20558970 CCTGAGGCTGCTGTGTGACCTGG + Intergenic
927243687 2:20940056-20940078 CCTGAGCGTGCCCTTTGAGCGGG - Intergenic
927845580 2:26470715-26470737 CCTCAGCCTGCAGGTTGGCCAGG + Exonic
930883620 2:56299466-56299488 CCTGAGGCTGCACTCTGTTCTGG + Intronic
932749314 2:74361330-74361352 CCTGCCCCTTCACCTTGACCCGG - Exonic
933461739 2:82596770-82596792 TCTGAGCCTGAACTTTCCCCTGG + Intergenic
934054392 2:88239917-88239939 CCTGAGCCTGCGGTTTCACGTGG + Intergenic
937516557 2:122661838-122661860 CCTGAGCCAGAAATTTCACCAGG - Intergenic
942784919 2:179689649-179689671 CCTCACCCTGCACTGTGCCCAGG + Intronic
948883443 2:240871629-240871651 CCTGAGCCTGCCCTGGGACCTGG - Intronic
1168765146 20:377194-377216 CATGACACTGCACTCTGACCTGG - Intronic
1169231452 20:3891695-3891717 ACTGAATCTGCACTTTTACCAGG - Intronic
1171022027 20:21593857-21593879 GCTGAGCCTGGACTCAGACCTGG + Intergenic
1171198697 20:23223979-23224001 CCTCAGCCTGGACTTTGGCCTGG - Intergenic
1172366739 20:34355797-34355819 ACTGATCCTGCATTCTGACCAGG + Intergenic
1173010387 20:39176653-39176675 GCTGAGCCAGCACTCTGTCCTGG + Intergenic
1173730128 20:45322499-45322521 CCTGTGCCTACATTTTGGCCGGG + Intergenic
1174037878 20:47679195-47679217 CCTGAGGCTGCACTGTGCCTGGG - Intronic
1174338910 20:49883871-49883893 CCTGAGCCTACACCTGGACCTGG + Exonic
1175535694 20:59709720-59709742 CTTGAGCCTCCCCTTTGTCCAGG + Intronic
1175831889 20:61969267-61969289 CCTGAGCCTTCACCTGGCCCTGG - Intronic
1176238710 20:64066059-64066081 CCTGGGGCTGCAGTTTCACCTGG + Intronic
1178607963 21:34055757-34055779 CCTCACCCTGCACTTCGCCCAGG - Intergenic
1179025553 21:37676025-37676047 TCTGAGCCTGCATTTTAACAGGG + Intronic
1181438845 22:22925353-22925375 CCTGACCCTGATATTTGACCCGG - Intergenic
1181593082 22:23896507-23896529 CCTGAGGCTGAGCTTTGCCCAGG + Intronic
1184087116 22:42271601-42271623 CCTGCCCCTGACCTTTGACCTGG + Intronic
1184429983 22:44437063-44437085 CCTGGTCCTGCCCTGTGACCCGG + Intergenic
1185305523 22:50113344-50113366 CCTAACCCTGCACTCTGAGCAGG + Intronic
949450698 3:4181741-4181763 CATGAGCCTACCCTTGGACCTGG + Intronic
953493891 3:43370441-43370463 CCAGAGCCTGCAGTATGGCCTGG - Intronic
954705948 3:52480566-52480588 CCTGAGGCTGCCCTCTGAACAGG + Intronic
956047634 3:65213417-65213439 CCTGAGCCCCCTCTTTCACCAGG - Intergenic
958115995 3:89219205-89219227 CCTGCCACTGCACTTTAACCTGG - Intronic
967864605 3:194179874-194179896 CCCGAGACAGCTCTTTGACCAGG - Intergenic
968503599 4:962016-962038 GCTGAGCCTGGACTTCCACCAGG - Exonic
968727899 4:2256736-2256758 CCTGCAGCTGCCCTTTGACCTGG - Intronic
969318744 4:6397432-6397454 CCTCACCCTGCACCTTGGCCGGG - Intronic
969716187 4:8869393-8869415 CCTGGGCCTGCCCTTTGCACGGG - Intronic
970219566 4:13796905-13796927 CCAGAGGATGCACTTTGACAAGG - Intergenic
970319599 4:14862449-14862471 CCTGAGTCTGCTTTTTGAACTGG + Intergenic
970560895 4:17281389-17281411 CCTGAGCCTGGACTTGGTCAAGG - Intergenic
973126604 4:46593416-46593438 CCTGAGCTTTCACTATTACCTGG + Intergenic
978720671 4:111905084-111905106 CCTGAGGTGACACTTTGACCTGG - Intergenic
978748598 4:112222703-112222725 CCTGAGCCTCCCCTGTGCCCTGG + Intergenic
980088576 4:128417331-128417353 CCCAAGCCTTCACTTTCACCAGG - Intergenic
980265459 4:130508559-130508581 CTTTATCCTTCACTTTGACCAGG + Intergenic
985046295 4:185943651-185943673 CCTGAGCCTCCAGTATAACCTGG + Intronic
991143182 5:63270712-63270734 TCTGAGCCTGCAATTTGTCTAGG - Intergenic
991656906 5:68913466-68913488 CCTGAGCCTTCATTCTGGCCAGG + Intergenic
993037212 5:82770922-82770944 CCTGTCCTTGCACTGTGACCTGG + Intergenic
993409386 5:87554892-87554914 CCTGAGGCTGCACACAGACCAGG + Intergenic
994541744 5:101108343-101108365 CCTGATCCTGCCCTTTGAAATGG + Intergenic
995062014 5:107821464-107821486 CCTTAGCCTGCCCTTTCACGTGG + Intergenic
995624661 5:114063259-114063281 GCTGAGGCTGCTCTTTGACAGGG + Intergenic
997451876 5:133990203-133990225 CCTGAGGCTGCACTTTCCCCAGG - Intronic
997887405 5:137642563-137642585 CTTGAGCCCTCACTTTTACCTGG - Intronic
998067183 5:139169220-139169242 TTTGAGCCTGCACTTTCCCCTGG - Intronic
998743120 5:145227786-145227808 GCTGAGCCTGCACTTCAGCCTGG - Intergenic
999245684 5:150153335-150153357 CCTGAGGCTGCACTTTCTGCTGG + Intronic
999920221 5:156310107-156310129 TCTGAGCCTGCAAATTTACCTGG + Intronic
1002763180 6:217576-217598 CCCAAGCCTGCTCTTAGACCTGG - Intergenic
1007413561 6:41679015-41679037 CCTGAGCACCCACTTTGAGCTGG - Intergenic
1007836028 6:44674414-44674436 CCTGAGCCAGGGCTTTGAGCTGG - Intergenic
1008660821 6:53665792-53665814 GCCGAGCCTGCGCTTTGGCCCGG + Intergenic
1008689000 6:53956585-53956607 ACTGAGCCCGCCCTCTGACCAGG - Intronic
1009883264 6:69595730-69595752 CATCTGCCTGCACTTTGACAGGG - Intergenic
1012502529 6:99904888-99904910 TCTGAGTCTGCGCTTCGACCTGG + Intergenic
1013959524 6:115882407-115882429 CATGAGCCTTCTCTTTGACCAGG + Intergenic
1016338968 6:143040362-143040384 CCTTAGCCTGCACTCCAACCTGG + Intergenic
1016341475 6:143066033-143066055 CCTCAGCCCGCACTTTGAGTAGG - Intronic
1017094181 6:150789954-150789976 CCTGGGCCTGCAGTTTCACATGG - Intronic
1017734079 6:157344928-157344950 TCTGAGCCTGCACTTGTCCCAGG - Intergenic
1019426582 7:980295-980317 CCTGAGCCATCTCTGTGACCAGG - Intergenic
1019481852 7:1270536-1270558 CCTGAGCAGGCACTGTGACCTGG - Intergenic
1019525001 7:1476900-1476922 CCTGGGCCTGACCTTTGCCCTGG + Exonic
1019557907 7:1641724-1641746 CGTGAGCCTGCCCTGTGGCCGGG - Intergenic
1021464834 7:20930512-20930534 CCTGAGCCTCCACTGTGGCTGGG - Intergenic
1022105468 7:27193251-27193273 CCTGAGCCTCCATTTTGAGTAGG + Intergenic
1023737755 7:43249416-43249438 TCTGAGCCTGCACTTTAAGAAGG + Intronic
1024510269 7:50198678-50198700 CAGGAACCTGCACTTTAACCAGG + Intergenic
1025991029 7:66496960-66496982 CCTGCCACTGCACTCTGACCCGG + Intergenic
1032499947 7:132392774-132392796 CCTGGACCTGCACAATGACCAGG - Intronic
1034591138 7:152140266-152140288 CCTGTGTCTGCTCTTTGCCCTGG - Intronic
1035557855 8:579779-579801 CCTGAACCTGCACTTAGCCTGGG - Intergenic
1038041646 8:23728338-23728360 CCAGAACCTGCACTGTGACAAGG - Intergenic
1039919094 8:41880735-41880757 CCTGAGCCTTCTCTGGGACCTGG - Intronic
1041157252 8:55001018-55001040 CCTGAGCCCTGACTTTGCCCAGG + Intergenic
1041748769 8:61236820-61236842 CCTGCGCCAGCTCTGTGACCTGG - Intronic
1044998152 8:97856705-97856727 CCTTAGCCTGCACTTTCTGCTGG - Intergenic
1046737874 8:117796313-117796335 CCTGATCCTGCCCTTTAAACAGG + Exonic
1048159041 8:131994418-131994440 TCTGAGCCTGCAATATGAGCAGG + Intronic
1048503144 8:134996801-134996823 CATGGGCCTGCCCTTTGTCCCGG - Intergenic
1049613374 8:143566129-143566151 CCTGAGCCAGATCTTGGACCAGG + Intergenic
1053496027 9:38548602-38548624 CCTGAGGCTGCACATAGAGCGGG + Intronic
1055258661 9:74405674-74405696 TCTGAGCATGCACCTTGCCCTGG + Intergenic
1057082358 9:92182226-92182248 CATGTGCCTGCCCTGTGACCTGG - Intergenic
1057233791 9:93342609-93342631 GCTGAGCCTGGACTGAGACCAGG + Intronic
1057866658 9:98687003-98687025 CCTTCCCCTGCACTTTAACCAGG + Intronic
1057944089 9:99309548-99309570 TCAGAGCCTGCATTTTGACAAGG - Intergenic
1062389018 9:136326836-136326858 CCTAAGCCTGCACAGTGCCCAGG + Intergenic
1203746227 Un_GL000218v1:41909-41931 CCTGTGCTTCCACTGTGACCTGG + Intergenic
1185961515 X:4550086-4550108 GCAGAGCCTGCTCTTTGTCCTGG - Intergenic
1188243230 X:27812911-27812933 CCTCAGCCTTCACTTGGAGCAGG - Intronic
1189088657 X:38054303-38054325 CCTGGGCCTAATCTTTGACCGGG + Exonic
1189361025 X:40351491-40351513 TCTGAGCCTGCACATAGTCCTGG + Intergenic
1189902091 X:45717058-45717080 CCCGTCCCTGCACTATGACCTGG - Intergenic
1192496061 X:71617312-71617334 CTTCAGCCTGAACTTCGACCGGG - Exonic
1192605658 X:72514441-72514463 CCTGAACATGCACAGTGACCAGG - Intronic
1195801172 X:108712705-108712727 CCTGAGCCTGTACATAGCCCTGG + Intergenic
1197148978 X:123198929-123198951 CCTGATCCTGCACTCAGACTAGG + Intronic
1200339298 X:155381974-155381996 CCCGAGCCTGCCCCTTGCCCTGG - Intergenic
1200347172 X:155458719-155458741 CCCGAGCCTGCCCCTTGCCCTGG + Intergenic
1202139073 Y:21702108-21702130 CCTGGCCCTGCACTTTGGCTGGG - Intergenic