ID: 1104979957

View in Genome Browser
Species Human (GRCh38)
Location 12:132569346-132569368
Sequence TTGGGCAGGGACTGGGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1318
Summary {0: 1, 1: 0, 2: 9, 3: 119, 4: 1189}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104979957_1104979976 28 Left 1104979957 12:132569346-132569368 CCTCCCACCCAGTCCCTGCCCAA 0: 1
1: 0
2: 9
3: 119
4: 1189
Right 1104979976 12:132569397-132569419 CAGGGGGTTCCAGAAAGAAAAGG 0: 1
1: 0
2: 4
3: 39
4: 311
1104979957_1104979970 10 Left 1104979957 12:132569346-132569368 CCTCCCACCCAGTCCCTGCCCAA 0: 1
1: 0
2: 9
3: 119
4: 1189
Right 1104979970 12:132569379-132569401 AGTGGTCAAGCCTTCCACCAGGG 0: 1
1: 0
2: 0
3: 5
4: 106
1104979957_1104979971 11 Left 1104979957 12:132569346-132569368 CCTCCCACCCAGTCCCTGCCCAA 0: 1
1: 0
2: 9
3: 119
4: 1189
Right 1104979971 12:132569380-132569402 GTGGTCAAGCCTTCCACCAGGGG 0: 1
1: 0
2: 0
3: 9
4: 136
1104979957_1104979965 -8 Left 1104979957 12:132569346-132569368 CCTCCCACCCAGTCCCTGCCCAA 0: 1
1: 0
2: 9
3: 119
4: 1189
Right 1104979965 12:132569361-132569383 CTGCCCAAGTTTCCAGGAAGTGG 0: 1
1: 0
2: 2
3: 27
4: 273
1104979957_1104979972 12 Left 1104979957 12:132569346-132569368 CCTCCCACCCAGTCCCTGCCCAA 0: 1
1: 0
2: 9
3: 119
4: 1189
Right 1104979972 12:132569381-132569403 TGGTCAAGCCTTCCACCAGGGGG 0: 1
1: 0
2: 0
3: 1
4: 106
1104979957_1104979969 9 Left 1104979957 12:132569346-132569368 CCTCCCACCCAGTCCCTGCCCAA 0: 1
1: 0
2: 9
3: 119
4: 1189
Right 1104979969 12:132569378-132569400 AAGTGGTCAAGCCTTCCACCAGG 0: 1
1: 0
2: 0
3: 4
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104979957 Original CRISPR TTGGGCAGGGACTGGGTGGG AGG (reversed) Intronic
900360033 1:2284027-2284049 TTGGGGAGGGTCTGGGTCTGGGG - Intronic
900495652 1:2974847-2974869 TTGGGGACTGGCTGGGTGGGTGG + Intergenic
900509360 1:3051260-3051282 GTGGGCAGGTGTTGGGTGGGTGG - Intergenic
900565483 1:3329840-3329862 TAAGGCAGGGACTGCATGGGAGG - Intronic
900708614 1:4096225-4096247 TGGGCCAGGTACAGGGTGGGTGG + Intergenic
900712464 1:4122989-4123011 ATGGGCAGGGAATGGTGGGGTGG + Intergenic
900965148 1:5952562-5952584 TGGGGCAGGGTAGGGGTGGGTGG - Intronic
900965158 1:5952582-5952604 TGGGGCAGGGTAGGGGTGGGTGG - Intronic
900965168 1:5952602-5952624 TGGGGCAGGGTAGGGGTGGGTGG - Intronic
901177951 1:7318320-7318342 TTGGTCAGTGACTGGTTGGCTGG + Intronic
901267817 1:7925493-7925515 TTTTCCACGGACTGGGTGGGTGG + Intronic
901422658 1:9161619-9161641 TGGGGCAGAGACAGGGTGGTCGG - Intergenic
901426003 1:9182684-9182706 TGGGGCCGGGACAGGGTGGTGGG + Intergenic
901866782 1:12111670-12111692 GTGGGCAGGGGCTGGTTGGGGGG + Intronic
901925603 1:12564284-12564306 TGGGGGAGGGACCTGGTGGGAGG + Intergenic
902251189 1:15154890-15154912 GTGGGCGGGGACGAGGTGGGCGG + Intronic
902608630 1:17583702-17583724 CTGGGCAGGGAGTGGGGGTGGGG - Intronic
902633527 1:17719961-17719983 TTGGGCAGGGCCTTTGAGGGAGG + Intergenic
902646489 1:17803087-17803109 TGTGGGAGGGACTTGGTGGGAGG + Intronic
902699208 1:18160122-18160144 TTGGGCAGGGCCAGGCTAGGGGG + Intronic
902728590 1:18353339-18353361 TTGGGCAGGGATTGGAGGGAAGG + Intronic
902757340 1:18557644-18557666 CTTGCCAGGGACAGGGTGGGAGG + Intergenic
902949940 1:19874347-19874369 TGAGGGAGGGACCGGGTGGGAGG + Intergenic
903220379 1:21865919-21865941 TTGGGCAGGGAGGGGGGTGGGGG - Intronic
903741475 1:25560912-25560934 CTGGGCAGGGACTGGGAGTGGGG - Intronic
903808576 1:26022161-26022183 TTGGCCAGGGACAGGCTGGAGGG - Exonic
903981635 1:27192874-27192896 TTGGGCAGGGAGTTGCAGGGTGG + Intergenic
904177719 1:28642843-28642865 TTGGGAAGGGACTGACTGAGAGG - Exonic
904293883 1:29505465-29505487 CTGGACAGGGGCGGGGTGGGTGG - Intergenic
904410281 1:30320843-30320865 AGGGGCATGGAGTGGGTGGGGGG + Intergenic
904442707 1:30542084-30542106 TGTGGGAGGGACTCGGTGGGAGG - Intergenic
904528864 1:31155169-31155191 TTGGGAAGGGGCTGGGGGTGTGG + Intergenic
905108162 1:35576284-35576306 CAGGGCAGGAAGTGGGTGGGGGG + Intronic
905171680 1:36113527-36113549 CTGGGAAGGGACTTGGCGGGGGG + Intronic
905369842 1:37477087-37477109 TTGGGCTGAGCCTGGATGGGAGG + Intronic
905406905 1:37739848-37739870 TTTGGGAGGGCCAGGGTGGGAGG + Intronic
905800384 1:40838935-40838957 TGGGGCGGGGACTTGGCGGGAGG - Exonic
906211469 1:44014564-44014586 CTAGGCAGGGAAGGGGTGGGAGG - Intronic
906290977 1:44619017-44619039 TGGGGGAGGGACTGGATGTGTGG + Intronic
906473049 1:46147003-46147025 ATGGGCAGGGACTGGAGGGAGGG + Intronic
906480178 1:46194509-46194531 TGGGGCAGGGCCTGGGCTGGGGG - Intronic
906664490 1:47609682-47609704 TGGGGGAGGGACTTGATGGGAGG - Intergenic
906937443 1:50226450-50226472 TGGGGGAGGGACCTGGTGGGAGG + Intergenic
906997054 1:50807543-50807565 TGGGGGAGGGACCTGGTGGGAGG - Intronic
907337463 1:53709800-53709822 CTGCTCAGTGACTGGGTGGGTGG + Intronic
907515629 1:54991628-54991650 TGGCGCAGGGAGTGGGTGGCGGG + Intronic
907668523 1:56453823-56453845 CTGGGCTGGGACTGGCTGGAGGG - Intergenic
907765171 1:57402926-57402948 TTGGGCAGGGGTTGGGGGTGAGG - Intronic
907974489 1:59418182-59418204 TGGGGCAGGGGTTGAGTGGGAGG + Intronic
908043037 1:60135707-60135729 TGGGGGAGGGACCTGGTGGGAGG + Intergenic
908131952 1:61082868-61082890 CAGGGCTGGGGCTGGGTGGGGGG + Intronic
908208640 1:61877473-61877495 TGGGGAAGGGACTTGGTAGGAGG + Intronic
908810174 1:67974132-67974154 CAGGGAAGGGACTTGGTGGGAGG + Intergenic
909105311 1:71398799-71398821 TGTGGGAGGGACTTGGTGGGAGG + Exonic
909561586 1:77014462-77014484 CTGGGCAGGGCCTGGGTGGGGGG - Intronic
909750017 1:79147575-79147597 TGTGGGAGGGACTCGGTGGGAGG - Intergenic
909952620 1:81737480-81737502 TGGGGGAGGGACCTGGTGGGAGG - Intronic
911537397 1:99116831-99116853 TTTGGGAGGGACACGGTGGGAGG - Intergenic
912136060 1:106661420-106661442 TGGGGGAGGGACCTGGTGGGAGG + Intergenic
912498886 1:110108760-110108782 CTGGGCAGTGTCTGGCTGGGTGG + Intergenic
912508406 1:110172231-110172253 TGGGGCAGGCACTGAGTGGGAGG + Intronic
912750653 1:112284425-112284447 ATGGGCAGGGAATAGGAGGGTGG - Intergenic
913009583 1:114670053-114670075 TTCGGCAGGGCCTGCGGGGGCGG - Intronic
913313585 1:117530223-117530245 TGTGGGAGGGACTTGGTGGGAGG - Intergenic
913464732 1:119128570-119128592 TGGGGGTGGGAGTGGGTGGGTGG - Intronic
913583073 1:120246247-120246269 GTGGGCTGGGACAGGGTGGTTGG - Intergenic
913625099 1:120652113-120652135 GTGGGCTGGGACAGGGTGGTTGG + Intergenic
913962970 1:143353727-143353749 CGGGACAGGGGCTGGGTGGGTGG + Intergenic
914057325 1:144179312-144179334 CGGGACAGGGGCTGGGTGGGTGG + Intergenic
914121821 1:144787054-144787076 CGGGACAGGGGCTGGGTGGGTGG - Intergenic
914565061 1:148858065-148858087 GTGGGCTGGGACAGGGTGGTTGG - Intronic
914607763 1:149272177-149272199 GTGGGCTGGGACAGGGTGGTTGG + Intergenic
914842820 1:151262526-151262548 TTGGGCAGGGCTAGGGTAGGGGG + Intronic
915217713 1:154350939-154350961 GTGGGCAGGGAATGGGAGAGGGG + Exonic
915574765 1:156768082-156768104 TTGGGGAGGGACTGGGATTGGGG + Exonic
915589565 1:156862803-156862825 CTGGGCAGGGGCTGGGGGGTGGG + Intronic
915648503 1:157290811-157290833 TTGGGCTGGGGCTGAGTGAGAGG + Intergenic
915684505 1:157617716-157617738 GTGGGCTGGGGGTGGGTGGGGGG + Intergenic
915722703 1:157995880-157995902 TTGGCAAGGGACTGGGGAGGAGG + Intronic
915991303 1:160519775-160519797 TTTGCCAGGGGCTGGGGGGGAGG + Intronic
916076130 1:161200932-161200954 TTGAGCTGGGACTGGGGTGGGGG - Intronic
916579046 1:166091324-166091346 TGGGGGAGGGACTCAGTGGGAGG + Intronic
916680672 1:167102146-167102168 TAGGGCAGGGAGGGGGTGAGAGG + Intronic
916844082 1:168630554-168630576 GTGTGCAGGGAATGGGTGGGTGG + Intergenic
916877595 1:168986452-168986474 TGGGGAAGGGACCTGGTGGGAGG - Intergenic
916962610 1:169904511-169904533 TGGGGGAGGGACCTGGTGGGAGG + Intergenic
917133804 1:171768745-171768767 TGGGGGAGGGACCTGGTGGGAGG - Intergenic
917363664 1:174204696-174204718 TAGGGGAGGGACCTGGTGGGAGG + Intronic
917642864 1:176999707-176999729 ATGGGGAGGGACCCGGTGGGAGG + Intronic
917906266 1:179589306-179589328 GTGGGGTGGGAGTGGGTGGGTGG - Intergenic
918314509 1:183311850-183311872 TGTGGGAGGGACTCGGTGGGAGG + Intronic
918374039 1:183890796-183890818 TAGGGCTGGGACTGGGAGGACGG + Intronic
918403899 1:184192784-184192806 TTGGGCCGGGGCAGGGTTGGGGG + Intergenic
918550871 1:185740677-185740699 TTGGGCAGGGGGTGGGGGGTAGG + Intronic
918592037 1:186250855-186250877 GTGGGGAGGGACCTGGTGGGAGG - Intergenic
918668355 1:187179777-187179799 TGGGGGAGGGACATGGTGGGAGG - Intergenic
918724037 1:187894410-187894432 TGCGGCAGGGACCTGGTGGGAGG + Intergenic
918770334 1:188549352-188549374 TTGCTGGGGGACTGGGTGGGGGG + Intergenic
919118921 1:193314881-193314903 TTTGCCAGGGATTGGTTGGGTGG + Intergenic
919447867 1:197732126-197732148 TTGGGAAGGTCCTGGGTGAGGGG - Intronic
919522039 1:198600553-198600575 TGGGGGAGGGACCTGGTGGGAGG + Intergenic
919751217 1:201039442-201039464 TGGGGAAGGGACTGGGGAGGGGG + Intergenic
919837471 1:201585005-201585027 TGGGGTTGGGGCTGGGTGGGAGG - Intergenic
919861191 1:201740308-201740330 TGGGGCTGGGAGTGGGTGTGTGG + Intronic
919895665 1:202008342-202008364 TGGGTGAGGGACTGGGTGGAGGG + Exonic
919980214 1:202638245-202638267 CTGGGGAGGGGCTGGGGGGGAGG - Intronic
920108281 1:203569715-203569737 CTGGGCATGGGCTGGGTGTGGGG + Intergenic
920309176 1:205038530-205038552 CTGGGCTAGGACTGGGTGCGTGG - Intergenic
920435528 1:205944363-205944385 GTGGACAGGGGCTGGGAGGGTGG + Intergenic
920438742 1:205964706-205964728 TTAGGCAGGGAGTGGGAAGGAGG + Intergenic
920720968 1:208386547-208386569 TTGGGGAGGAACCTGGTGGGAGG - Intergenic
920853348 1:209644187-209644209 TAGTGCAGGCGCTGGGTGGGAGG + Intronic
921314380 1:213876436-213876458 TCGGGCAGGGGGTGGGTGGGAGG + Intergenic
921364495 1:214360853-214360875 TGGGGGAGGGACCTGGTGGGAGG + Intronic
921457635 1:215391051-215391073 TTAGGGAGGGTCTGGGTGGGAGG - Intergenic
921715878 1:218416761-218416783 TGTGGGAGGGACTGGGTGGGAGG + Intronic
921801552 1:219408605-219408627 TCTGGCAGGGGCTGGGGGGGTGG + Intergenic
922456101 1:225774840-225774862 TGGGGGAGGGACCTGGTGGGAGG + Intergenic
922560215 1:226564348-226564370 TAGGGAAGGGAGTGGGTGAGTGG + Intronic
922577873 1:226674951-226674973 TTTGGAAGGAACTGGGTCGGAGG - Intronic
922675147 1:227544987-227545009 ATGGGCAGGCACTGGGCAGGGGG + Intergenic
922737336 1:227994512-227994534 ATGCTCAGGGCCTGGGTGGGAGG - Intergenic
923130806 1:231073152-231073174 TTGGGCAGGAAATGGGAGGATGG + Intergenic
923698330 1:236276881-236276903 TTGGGGAGGGGCCTGGTGGGAGG + Intronic
923873693 1:238023803-238023825 TGGGGGAGGGACCTGGTGGGAGG - Intergenic
924018404 1:239753592-239753614 TGGGGAAGGGACCTGGTGGGAGG - Intronic
924617412 1:245623951-245623973 TGGGGGAGGGACCTGGTGGGAGG + Intronic
1062772194 10:111123-111145 TGGGGGAGGGACTTGGTGGGAGG - Intergenic
1062921500 10:1283791-1283813 CTGGGTAGGGACTGGGAGTGGGG + Intronic
1063048666 10:2420659-2420681 TTGGGGAAGGACCCGGTGGGAGG + Intergenic
1063153921 10:3360905-3360927 TTTGCGAGGGACTTGGTGGGAGG + Intergenic
1063391033 10:5649995-5650017 TGGGGCTGGGGCTGGGTGTGAGG - Intronic
1063623321 10:7667523-7667545 TGGGGCCGGGACTGGGGAGGTGG - Intergenic
1064710513 10:18119142-18119164 TTTGGGAGGGACCTGGTGGGAGG + Intergenic
1064723325 10:18251883-18251905 TGGGGGAGGGACTTGGTGGGAGG - Intronic
1064819234 10:19306916-19306938 TTTGGGAGGGACCTGGTGGGAGG - Intronic
1065073212 10:22049183-22049205 TTGGGTAGGGGCTGGGAGGATGG - Intergenic
1065249653 10:23797753-23797775 TGGGGGAGGGACCTGGTGGGAGG - Intronic
1065252739 10:23832996-23833018 TGTGGGAGGGACCGGGTGGGAGG - Intronic
1065360997 10:24889020-24889042 TGGGGCAGGGTCGGGGAGGGGGG - Intronic
1065464103 10:26001074-26001096 TGGGGGAGGGACCTGGTGGGAGG - Intronic
1065668525 10:28088326-28088348 TGGGGGAGGGACCTGGTGGGAGG + Intronic
1065738448 10:28774833-28774855 TAGGGGAGGGACCTGGTGGGAGG + Intergenic
1065825155 10:29564054-29564076 GTGTGGAGGGCCTGGGTGGGCGG - Intronic
1066201087 10:33143191-33143213 TGGGTCAAGGACTGGGTTGGGGG + Intergenic
1067225952 10:44375702-44375724 TTGTGCAGAGACTGGGGCGGGGG - Intronic
1067427852 10:46223070-46223092 AGGGACAGGCACTGGGTGGGTGG - Intergenic
1067666275 10:48282017-48282039 TGTGGGAGGGACTCGGTGGGAGG - Intergenic
1067711034 10:48651417-48651439 TTGTGCAGGTGCTGGCTGGGTGG - Intronic
1067828792 10:49598072-49598094 CAGGGCAGGGCCTGGGAGGGAGG + Intergenic
1068110583 10:52675512-52675534 TGGGGGAGGGACCTGGTGGGAGG + Intergenic
1068536049 10:58242818-58242840 TGGGGGAGGGACTTGGTGGGAGG + Intronic
1068898559 10:62236958-62236980 ATGGGCAAGGACTGGGGGAGAGG + Intronic
1068931665 10:62596558-62596580 TTGGCCATGGGGTGGGTGGGTGG - Intronic
1069872373 10:71540960-71540982 TTGGGTAGGGCCTGCGTGGGAGG - Intronic
1070162147 10:73873305-73873327 TTGCCCAGGGACTGGATGAGGGG - Intronic
1070487192 10:76942382-76942404 TTTGGCAGGGAGTAGGTGGAGGG + Intronic
1070607381 10:77908399-77908421 TTGGGTTGGCATTGGGTGGGAGG - Intronic
1070697174 10:78572015-78572037 CTGGGCAGGGAGTGGGTGGTGGG + Intergenic
1070761389 10:79026532-79026554 GTGGGCAGGGCCTGGCTGGGGGG + Intergenic
1070814944 10:79317189-79317211 GAGGGCAGGGACTGGCTGCGGGG - Intergenic
1071271326 10:84010253-84010275 TGTGGGAGGGACTTGGTGGGAGG - Intergenic
1071531419 10:86392568-86392590 TTGGCCAGGTACTGGGGTGGGGG - Intergenic
1071837778 10:89436564-89436586 TTAGGCAGGCAGTGGGTGGCAGG - Intronic
1072538035 10:96378043-96378065 TGGCGGAGGGGCTGGGTGGGAGG - Intronic
1072617466 10:97059331-97059353 GTGGGCAGGGGCTGTGTGGAGGG + Intronic
1073112283 10:101069914-101069936 TTGGGGAGGGATGGGGTGGTGGG + Intergenic
1073208622 10:101781522-101781544 TTGGGTGGGGGTTGGGTGGGAGG - Exonic
1073248860 10:102109569-102109591 TGGGGCAGAAACTGGGTGGTCGG + Intronic
1073325706 10:102643222-102643244 TTGGACAGGACCGGGGTGGGTGG + Intergenic
1073667287 10:105547751-105547773 TGGGGGAGGGACCTGGTGGGAGG + Intergenic
1073741935 10:106417201-106417223 TGGGGCAGGGACCTGGTGGGAGG - Intergenic
1073748172 10:106493779-106493801 TATGGGAGGGACCGGGTGGGAGG - Intergenic
1074079547 10:110156818-110156840 TGGGGCAGCCACTGGGTGGAGGG + Intergenic
1074130315 10:110567947-110567969 CTGGGCGGGGACTGTGGGGGAGG + Intronic
1074787289 10:116852022-116852044 GTGGGGAGGGACCGGGTGGGAGG + Intronic
1075411096 10:122228487-122228509 CTGTGCAGGGACTGGGGGGTAGG - Intronic
1075605804 10:123806852-123806874 TAGGGGAGGGACGTGGTGGGAGG - Intronic
1075841740 10:125510435-125510457 TGTGGCAGGGACCTGGTGGGAGG + Intergenic
1075987880 10:126803701-126803723 TTGGTTAGGGACTGGGAGGGAGG - Intergenic
1076022110 10:127082587-127082609 TGTGGGAGGGACTCGGTGGGAGG - Intronic
1076258762 10:129049427-129049449 TTTGCCAGGAACTGGATGGGAGG - Intergenic
1076585193 10:131542235-131542257 CAGGGGAGGGACTTGGTGGGAGG + Intergenic
1076586703 10:131553654-131553676 ATGGGCAGGGAGTGAGTGTGTGG + Intergenic
1076640018 10:131909058-131909080 TTGGGTAGGGAGTGGAGGGGAGG + Intronic
1076727004 10:132418701-132418723 GTGGGCAGGGCCGGGGAGGGAGG - Intergenic
1076757527 10:132580245-132580267 TGGGGGAGGGACCTGGTGGGAGG + Intronic
1076820140 10:132934254-132934276 GTGGGCACGGGGTGGGTGGGGGG - Intronic
1077023694 11:430606-430628 TGGGGGAGGGACAGGGTGGGAGG + Intronic
1077252890 11:1568364-1568386 GTGGGCAGGGGCTGGAGGGGCGG + Intronic
1077281107 11:1746684-1746706 CTGGGCAGAGGCTGGCTGGGAGG - Intronic
1077315999 11:1919625-1919647 TTGGCCAGTGACTGGGTGGCCGG - Exonic
1077348234 11:2074498-2074520 GTGGCCAAGGGCTGGGTGGGGGG - Intergenic
1077504910 11:2925502-2925524 TTGGGCAGGCACACTGTGGGCGG - Intergenic
1077544507 11:3163513-3163535 CTGGGTAGGGGTTGGGTGGGGGG + Intronic
1077614402 11:3664710-3664732 GAGGGAAGGGACTGGGTCGGAGG + Intergenic
1078522058 11:12071297-12071319 TGGTACAGGGACTGGGTGGAAGG - Intergenic
1078611061 11:12819987-12820009 GTGGGCAGAGACTGGGTGGTTGG + Intronic
1078629516 11:12989648-12989670 TTAGGGAGGGACCTGGTGGGAGG - Intergenic
1078639284 11:13080317-13080339 TGAGGCAGGGGCTGGCTGGGGGG - Intergenic
1078721359 11:13886846-13886868 TGGGGGAGGGACCTGGTGGGAGG + Intergenic
1078733238 11:13995582-13995604 TAGGGGAGGGACCTGGTGGGAGG - Intronic
1078946911 11:16078605-16078627 GTGGGCAGTGACTTTGTGGGAGG + Intronic
1079058979 11:17231076-17231098 GTTGCCAGGGACTAGGTGGGAGG - Intronic
1079713838 11:23719217-23719239 TGGGGGAGGGGCTTGGTGGGAGG + Intergenic
1079744281 11:24105830-24105852 TAGGGGAGGGACCAGGTGGGAGG + Intergenic
1080283903 11:30586458-30586480 GTGGGCAGGGACTGCGGGAGGGG - Intronic
1080332363 11:31153986-31154008 TGGGGGAGGGACCTGGTGGGAGG + Intronic
1081166571 11:39815151-39815173 TGGGGGAGGGACCTGGTGGGAGG + Intergenic
1081271914 11:41095313-41095335 TGAGGGAGGGACTTGGTGGGAGG - Intronic
1081547691 11:44083412-44083434 TTGGGCAGGTACTGAGAGGGTGG - Exonic
1081549258 11:44096423-44096445 TAGGCCGGGGACTGGGTGGCCGG + Intronic
1081583905 11:44371144-44371166 TGGGGGAGGGACCTGGTGGGAGG + Intergenic
1081655455 11:44854188-44854210 TGGGGCAGGGGGTGGGGGGGGGG + Intronic
1081752844 11:45524453-45524475 TGGGGGAGGGACCTGGTGGGAGG - Intergenic
1081812487 11:45921930-45921952 CAGGCCAGGGAATGGGTGGGGGG - Intronic
1081915948 11:46730369-46730391 CTGGGCAGGGACTGGAAGAGGGG + Intronic
1082630955 11:55541455-55541477 TGGGAGAGGGACTTGGTGGGAGG - Intergenic
1082787746 11:57326184-57326206 TTGGGGAGAGATAGGGTGGGAGG - Exonic
1083090763 11:60197767-60197789 TGGGGGAGGGACCTGGTGGGAGG + Intergenic
1083653930 11:64220026-64220048 AGGGCCAGGGGCTGGGTGGGGGG + Intronic
1083680258 11:64348422-64348444 CAGGGCAGGGGCTGGGCGGGAGG + Intronic
1083702303 11:64487457-64487479 TTGGGCAGGGGGTGGGTGAGTGG + Intergenic
1083742315 11:64717427-64717449 GTGGGTAGGGGCAGGGTGGGAGG - Intronic
1083961114 11:66015560-66015582 TGGGGCAGGCACAGGGTGGGTGG + Intergenic
1084145576 11:67263421-67263443 TTGGACAGGGGCTGGGTAGTGGG + Intergenic
1084149689 11:67282373-67282395 GTGGGGAGGGAGAGGGTGGGGGG - Intronic
1084154849 11:67307749-67307771 GAGGGGAGGGACTGGGTGGAGGG + Intronic
1084407001 11:68979932-68979954 CTTGGCAGGGACGAGGTGGGAGG + Intergenic
1084461641 11:69299561-69299583 AGGGGAAGGGACTGGCTGGGAGG + Intronic
1084483589 11:69435502-69435524 CGGGGCAGGCACGGGGTGGGAGG + Intergenic
1084550889 11:69840984-69841006 AAGGGCTGGGGCTGGGTGGGGGG + Intergenic
1084650158 11:70484886-70484908 GAGGGCAGCGAGTGGGTGGGCGG - Intronic
1084726196 11:70943806-70943828 TGAGGAAGGGATTGGGTGGGAGG - Intronic
1084797655 11:71519108-71519130 TGGGGCAGGGACCTGGTGGACGG + Intronic
1085152777 11:74265463-74265485 TAGTGCAAGGACTGGGTGGTTGG - Intronic
1085497901 11:76988605-76988627 TGGGGAAGGGACTTTGTGGGAGG - Intronic
1085508668 11:77074368-77074390 GTGGGAGGGCACTGGGTGGGCGG - Intronic
1085594104 11:77792272-77792294 TGTGGGAGGGACTTGGTGGGAGG - Intronic
1085643688 11:78209107-78209129 AAGGGCAGGGACTGAGTGTGAGG + Intronic
1085875876 11:80405449-80405471 CATGGGAGGGACTGGGTGGGAGG + Intergenic
1085911176 11:80828802-80828824 TTGGGCTGGGATTGGGAGGGGGG - Intergenic
1086053220 11:82618402-82618424 TTGGGGAGGGACCTGATGGGAGG + Intergenic
1086333944 11:85781349-85781371 TGTGGGAGGGACTTGGTGGGAGG - Intronic
1086826607 11:91507128-91507150 TGTGGGAGGGACTTGGTGGGGGG - Intergenic
1086879707 11:92138943-92138965 TTGGCCATGGACTAGGTTGGGGG + Intergenic
1087474196 11:98617237-98617259 TGGGGCAGGGACCCGGTGGGAGG - Intergenic
1087668819 11:101082001-101082023 TTGGGGAGGGACCTGATGGGAGG + Intronic
1088184764 11:107154188-107154210 GAGGGCAGGGACCTGGTGGGAGG - Intergenic
1088426829 11:109713973-109713995 TGTGGGAGGGACTCGGTGGGAGG - Intergenic
1089084404 11:115804857-115804879 TTGGGGTGGGACAGGGTAGGGGG - Intergenic
1089138887 11:116270791-116270813 CTGGGCAGGGCCCGGGTGGATGG + Intergenic
1089693590 11:120201813-120201835 GGGGGCAGGGAGGGGGTGGGGGG - Intergenic
1089846969 11:121466269-121466291 CTGGCCTGGGAGTGGGTGGGAGG - Intronic
1089851220 11:121498263-121498285 TTGGGCAGGGATGGGGTGATGGG + Intronic
1090204178 11:124875695-124875717 TTGAGGAGGGACTGGATGGGAGG + Intronic
1090521891 11:127488706-127488728 TGTGGGAGGGACTTGGTGGGAGG - Intergenic
1090756488 11:129796277-129796299 TGGGGGAGGGACCTGGTGGGAGG - Intergenic
1091123801 11:133079055-133079077 CACGGCAGGAACTGGGTGGGAGG - Intronic
1092125241 12:6070796-6070818 CAGGGCAGGGACAGGATGGGAGG + Intronic
1092226892 12:6753396-6753418 TTCGGGAGGGACCGGGTTGGAGG + Exonic
1092913716 12:13171157-13171179 TTTGGCAGTGGGTGGGTGGGGGG + Intergenic
1092928233 12:13291473-13291495 GTCTGCAGGGACTGGCTGGGAGG - Intergenic
1092944473 12:13440088-13440110 TGAGGGAGGGACTTGGTGGGAGG - Intergenic
1092964779 12:13631091-13631113 TTGGGGAGGGACCTGGTGGGAGG - Intronic
1093047908 12:14471776-14471798 GGTGGGAGGGACTGGGTGGGAGG - Intronic
1093220720 12:16417364-16417386 TTGGGGAGGGACTTCATGGGAGG - Intronic
1093510525 12:19921799-19921821 TGGTGGAGGGACTTGGTGGGAGG + Intergenic
1093961592 12:25279294-25279316 GTGGGAAGGGACTGTGAGGGTGG + Intergenic
1094023001 12:25934107-25934129 TGGGGGAGGGACCTGGTGGGAGG + Intergenic
1094623410 12:32101296-32101318 GTTGAGAGGGACTGGGTGGGGGG - Intergenic
1095150231 12:38785439-38785461 TTGTGGAGGGACCTGGTGGGAGG + Intronic
1095345196 12:41141830-41141852 GAGGGAAGGGACGGGGTGGGAGG + Intergenic
1095803729 12:46295597-46295619 TTGGGAAGGGTCAGGGTAGGGGG + Intergenic
1095955601 12:47803979-47804001 CTGGGTAGGGACTGGGGAGGTGG - Intronic
1096069091 12:48764835-48764857 TTGGGAACTGAATGGGTGGGGGG - Intergenic
1096069840 12:48768804-48768826 TGGGGCAGGGACTGGGGGAAGGG - Intronic
1096214987 12:49793702-49793724 TGGGGTAGGGACTGGGTGGACGG - Intronic
1096227724 12:49877208-49877230 TTGAGCAGGGTGTGGGTTGGGGG + Intronic
1096242521 12:49967069-49967091 GTGGGAAGGGACACGGTGGGTGG - Intergenic
1096384976 12:51189280-51189302 TTGGGTTGGGAATGGGTGTGGGG + Exonic
1096468987 12:51864532-51864554 ATGGGGACGGACTGGGTTGGAGG + Intergenic
1096886759 12:54726292-54726314 TGGGGAAGGGACTTGGTGGGAGG - Intergenic
1097338824 12:58414731-58414753 GTGGGTGGGGAGTGGGTGGGGGG + Intergenic
1097399346 12:59110054-59110076 TGGGGCAGGGAGTGGGGAGGTGG + Intergenic
1097979647 12:65724786-65724808 TGGGGGAGGGACCTGGTGGGAGG + Intergenic
1098235007 12:68409979-68410001 CTGGGCAGGGAGTGGGGTGGTGG + Intergenic
1099811281 12:87585134-87585156 TTTGGGAGGGACCTGGTGGGAGG - Intergenic
1100054492 12:90491786-90491808 TTTGGGAGGGACCCGGTGGGAGG + Intergenic
1100619154 12:96255157-96255179 TTGGTGACTGACTGGGTGGGAGG + Intronic
1100781808 12:98034978-98035000 TGTGGGAGGGACTAGGTGGGAGG - Intergenic
1100959133 12:99943686-99943708 TGTGGCAGGGACCTGGTGGGGGG - Intronic
1101032221 12:100671759-100671781 TAGGGCAGGGACTGGTGGGTGGG + Intergenic
1102204329 12:111079814-111079836 TGGGTTTGGGACTGGGTGGGAGG + Intronic
1102346287 12:112163304-112163326 CTGGGGAGGCACTGGGTAGGTGG - Intronic
1103231471 12:119334681-119334703 TTGGGCCGGGTGGGGGTGGGGGG - Intergenic
1103494708 12:121352618-121352640 GTGGACAGGGACCGGATGGGAGG + Intronic
1103505906 12:121442340-121442362 TTGGGCGGGGACACGGAGGGTGG + Exonic
1103526894 12:121575201-121575223 TTGGGCAGGGGCAGGGGAGGAGG - Intronic
1103614037 12:122141089-122141111 TGGGGCAGTGCCAGGGTGGGGGG + Intronic
1103730904 12:123027165-123027187 GTGGCCAAGGGCTGGGTGGGAGG - Intronic
1104019364 12:124981347-124981369 GTGGGGTGGGACTGGGTGGGAGG + Intronic
1104146412 12:126038085-126038107 CATGGGAGGGACTGGGTGGGAGG - Intergenic
1104726263 12:131077439-131077461 TGGGGCAGGGGCTAGGAGGGCGG - Intronic
1104750291 12:131234109-131234131 TTGGGCAGGGCCCAGCTGGGTGG - Intergenic
1104753444 12:131254345-131254367 TTGTGCAGGCAGTGGGTAGGTGG - Intergenic
1104973078 12:132540313-132540335 TGGGGGCAGGACTGGGTGGGTGG - Intronic
1104975244 12:132549253-132549275 TTGGGCAGGGACATCGTGGCTGG - Intronic
1104979957 12:132569346-132569368 TTGGGCAGGGACTGGGTGGGAGG - Intronic
1105702652 13:22944557-22944579 TGCGGCGGGGACTGGATGGGTGG - Intergenic
1105719193 13:23097149-23097171 TAGAGCAGGGTATGGGTGGGTGG - Intergenic
1106346070 13:28879443-28879465 TAGGGCAGGGCCTGGTGGGGGGG + Intronic
1106350134 13:28922021-28922043 TTGGGTAGGGACCTGGTAGGAGG + Intronic
1106753446 13:32797629-32797651 TTGGGCGGGGGGTGGGGGGGTGG - Intergenic
1107103336 13:36617633-36617655 TGTGGGAGGGACTGGGTGAGAGG + Intergenic
1107596536 13:41968900-41968922 GTGGGCAGGGGCTGGGAGTGGGG - Intergenic
1107672190 13:42757602-42757624 TGAGGCAGGGACCTGGTGGGAGG - Intergenic
1107676404 13:42802315-42802337 TGGGGGAGGGACTTGATGGGAGG + Intergenic
1108178601 13:47819379-47819401 TGGGGGAGGGACCTGGTGGGAGG + Intergenic
1108179344 13:47825532-47825554 TTTAGGAGGGACTTGGTGGGAGG - Intergenic
1108436593 13:50406861-50406883 TTGGTCAGGGGTTGGGGGGGTGG - Intronic
1108818671 13:54319617-54319639 TGTGGGAGGGACTCGGTGGGAGG + Intergenic
1108942305 13:55971925-55971947 TTGGGAAGAGAATGGGAGGGGGG + Intergenic
1109061894 13:57631343-57631365 GTGTGCAAGGACTGGGAGGGAGG + Intergenic
1109280523 13:60350129-60350151 TGGTGAAGGGACTGGGTGAGAGG + Intergenic
1109282014 13:60367662-60367684 TGGGGGAGGGACCTGGTGGGAGG + Intergenic
1110240188 13:73258210-73258232 TTGGTCTGGGTCTGGGTGGAAGG + Intergenic
1110377267 13:74807307-74807329 TTGGGCAATGACAGGGTGGCTGG - Intergenic
1110436481 13:75482157-75482179 TGGGGCAGACACTGGGTGGCTGG + Intergenic
1111134711 13:84026043-84026065 GTTGGAAGGGACTTGGTGGGTGG + Intergenic
1111227253 13:85289846-85289868 TTGGGAAGAGACCTGGTGGGAGG - Intergenic
1111394448 13:87646853-87646875 TGTGGGAGGGACTTGGTGGGAGG - Intergenic
1111424187 13:88058037-88058059 TATGGCAGGGACCTGGTGGGAGG + Intergenic
1111546647 13:89746792-89746814 CAAGGCAGGGACTTGGTGGGAGG - Intergenic
1111792181 13:92871571-92871593 TTAGGAAGGGACCTGGTGGGAGG - Intronic
1112480902 13:99774492-99774514 TTGGGCTGGGAATGGGTCGTGGG + Intronic
1113250830 13:108450598-108450620 TGGGGGAGGGACCTGGTGGGAGG + Intergenic
1113376231 13:109767066-109767088 TTGGTCAGGGACATGGAGGGAGG + Intronic
1113496834 13:110737599-110737621 TTGGGAAGGGGCCTGGTGGGAGG + Intergenic
1113529152 13:111007452-111007474 TGGGGGAGGGACCTGGTGGGAGG - Intergenic
1113699659 13:112375142-112375164 TGAGGGAGGGACTTGGTGGGAGG + Intergenic
1114282268 14:21204117-21204139 TGAGGGAGGGACTCGGTGGGAGG - Intergenic
1114986867 14:28239737-28239759 TGGGGAAGGGACCTGGTGGGAGG + Intergenic
1115068996 14:29298238-29298260 CATGGCAGGGACTGGGTGAGAGG - Intergenic
1115236186 14:31210386-31210408 GCGGGCAGGAAGTGGGTGGGTGG - Intergenic
1115354950 14:32437259-32437281 TTGGGCAGGGATTGGCAGTGAGG + Intronic
1115944552 14:38644599-38644621 TAGGGGAGGGACCTGGTGGGAGG + Intergenic
1115976813 14:39005631-39005653 TGGGGCTGGGGCTGGGTGGCAGG - Intergenic
1116076478 14:40117593-40117615 TGGGGGAGGGACCTGGTGGGAGG + Intergenic
1116173751 14:41437835-41437857 TTAGGGAGGGACCTGGTGGGAGG + Intergenic
1116649005 14:47565869-47565891 TGGGGCAGGGAATGGGGGTGCGG + Intronic
1116789582 14:49326374-49326396 TGAGGGAGGGACTTGGTGGGAGG + Intergenic
1116898714 14:50341444-50341466 CTGGGGAGGGTCTGGGGGGGGGG + Intronic
1116973564 14:51093693-51093715 TCGGGGAGGGACTGGGATGGGGG - Intronic
1117241592 14:53839137-53839159 TTGGGAAGAGACCTGGTGGGAGG - Intergenic
1117508473 14:56425449-56425471 TGTGGGAGGGACTTGGTGGGAGG + Intergenic
1117693975 14:58339983-58340005 TCGGGGAGGGACCTGGTGGGAGG - Intronic
1118137599 14:63045972-63045994 CAGGGCAGGGACTGGCTGGGCGG + Intronic
1118300405 14:64610378-64610400 TGTGCCAGGGACTGGGTTGGAGG + Intergenic
1118365093 14:65087886-65087908 TGTGGCAGGAACTCGGTGGGAGG + Intronic
1118489145 14:66242550-66242572 TTGGGTAGTGTGTGGGTGGGTGG - Intergenic
1118603403 14:67486177-67486199 TGTGGGAGGAACTGGGTGGGAGG + Intronic
1118764558 14:68901101-68901123 CAGGGGAGGGAGTGGGTGGGAGG + Intronic
1119024798 14:71144062-71144084 TTTTGCAGGGAGTGGGAGGGCGG - Intergenic
1119037034 14:71239166-71239188 GCTGCCAGGGACTGGGTGGGAGG + Intergenic
1119190571 14:72679443-72679465 TGGGGCTGGGGCTGGGTGGTGGG - Intronic
1119455513 14:74752085-74752107 TGGGGGAGGGACCTGGTGGGAGG - Intergenic
1119474847 14:74921241-74921263 CTGGGCAGGGCTGGGGTGGGTGG - Intronic
1119488738 14:75011399-75011421 TTGTGCAGTGTCTGTGTGGGTGG + Exonic
1119621712 14:76136599-76136621 TTTGGGAAGGACTGGGTTGGGGG - Intergenic
1119649683 14:76374919-76374941 CTGGGCAGGGGCTGGGAGAGTGG - Intronic
1119694080 14:76698677-76698699 TGGGGGAGGGACATGGTGGGAGG + Intergenic
1119747689 14:77056041-77056063 TTGGGCAGGGCTTGGCTGGGTGG + Intergenic
1120160631 14:81141261-81141283 CTGGACAAGGGCTGGGTGGGAGG + Intronic
1120229106 14:81823433-81823455 TGTGGGAGGGACTCGGTGGGAGG - Intergenic
1120377774 14:83731108-83731130 TGGGGGAGGGACCTGGTGGGAGG - Intergenic
1120480878 14:85047584-85047606 TATGGGAGGGACTTGGTGGGAGG + Intergenic
1120573092 14:86145957-86145979 TGTGGGAGGGACCGGGTGGGAGG + Intergenic
1120799651 14:88674545-88674567 TGTGGGAGGGACTTGGTGGGAGG - Intronic
1120817824 14:88882006-88882028 TTTGGGAGGGACCTGGTGGGAGG + Intergenic
1120856357 14:89216180-89216202 TAGGGTAGGGGCTGGGAGGGAGG + Intronic
1120920935 14:89755031-89755053 TGTGGGAGGGACTTGGTGGGAGG - Intergenic
1120963781 14:90149581-90149603 TGTGGGAGGGACTTGGTGGGAGG - Intronic
1121318921 14:92979520-92979542 TGGGGGAGGGACCTGGTGGGAGG + Intronic
1121408261 14:93732566-93732588 ATGGGCAGGGACTGTGCCGGTGG + Intronic
1122674803 14:103403039-103403061 AGGGGCAGGGATGGGGTGGGGGG - Intronic
1122765674 14:104067927-104067949 TGGGGGAGGGACCTGGTGGGAGG - Intergenic
1122781424 14:104145420-104145442 TAGGGCTGGGGATGGGTGGGTGG + Intronic
1122789672 14:104178961-104178983 TTGGGCAGTGGGTGGGTGGCTGG + Intronic
1122882269 14:104695470-104695492 GTGTGCAGGGCCTGGGTGGGTGG - Intronic
1122889541 14:104725980-104726002 CTGTGGGGGGACTGGGTGGGGGG - Intronic
1122908167 14:104812377-104812399 ATGAGCAGGGACTGGGAGGGAGG + Intergenic
1122940393 14:104978521-104978543 TGGGGCGGGGCCTGGCTGGGAGG - Intergenic
1123002744 14:105304906-105304928 TTGTGGAGGGACCTGGTGGGAGG - Exonic
1123008010 14:105333682-105333704 TTGGGGAGGGAGGAGGTGGGAGG + Intronic
1123044309 14:105503967-105503989 TTGGGGAGGCACTGGGCTGGAGG + Intergenic
1123125372 14:105942096-105942118 ACGCGCAGGCACTGGGTGGGTGG - Intergenic
1123127059 14:105954247-105954269 GTTGGCAGGGACAGGGTGGTGGG - Intergenic
1202903621 14_GL000194v1_random:56491-56513 TGGGGCAGGGCCTTGGTGTGTGG + Intergenic
1123407520 15:20030067-20030089 GTTGGCAGGGACAGGGTGGCGGG - Intergenic
1123516848 15:21036723-21036745 GTTGGCAGGGACAGGGTGGCGGG - Intergenic
1123815867 15:23978226-23978248 TGGGGGAGGGGCTGAGTGGGAGG - Intergenic
1123973153 15:25527998-25528020 TGGTGGAGGGACAGGGTGGGTGG + Intergenic
1124048606 15:26174697-26174719 TTGGTCAGGGAATGGGAGGAGGG + Intergenic
1125202253 15:37110499-37110521 CTGGGCAGGGCCAAGGTGGGAGG - Intergenic
1125225232 15:37388848-37388870 TTGGGGAGGGACCTGGTGGGAGG - Intergenic
1125317132 15:38442802-38442824 TAAGGGAGGGACTTGGTGGGAGG + Intergenic
1125383501 15:39112562-39112584 TGGGGGAGGGACCTGGTGGGAGG + Intergenic
1125672694 15:41485316-41485338 TTGGGCTGGGGTTGGGAGGGGGG + Intergenic
1126441514 15:48694538-48694560 TTGGGGAGGGACCTGGTTGGAGG + Intergenic
1127009553 15:54607851-54607873 TGGGGGAGGGAACGGGTGGGAGG - Intronic
1127480641 15:59373612-59373634 TTGGGGTGGGGCGGGGTGGGGGG + Intronic
1127559079 15:60118087-60118109 TGGGGAAGGGAATGTGTGGGTGG + Intergenic
1127761157 15:62140196-62140218 TTGGTGAGGGTCGGGGTGGGGGG + Intergenic
1128240016 15:66095530-66095552 TAGGCCAGGCAGTGGGTGGGAGG - Intronic
1129549074 15:76428984-76429006 TGAGGGAGGGACTTGGTGGGAGG + Intronic
1129549355 15:76430911-76430933 TTTGGGAGGGACCCGGTGGGAGG + Intronic
1129661143 15:77553820-77553842 TTGTGCAGGGTCTGGGGCGGGGG - Intergenic
1129668441 15:77592767-77592789 TTAGGCAGGGAGTGGTGGGGTGG + Intergenic
1129669078 15:77597171-77597193 CTGAGCAGGGACAGGGTGGGGGG + Intergenic
1129705579 15:77792288-77792310 TGGGGCCGGGCCTGGGTGGGAGG - Intronic
1130074997 15:80681056-80681078 TGGGGGAGGGACCTGGTGGGAGG - Intronic
1130652478 15:85769911-85769933 GTGAGCAGAGAGTGGGTGGGAGG - Intronic
1130685137 15:86030689-86030711 TTGGGCAGGGGGTAGGCGGGTGG - Intergenic
1132582854 16:693521-693543 TTGGGCAGGGAGAGGGCGGAAGG - Exonic
1132590428 16:724045-724067 TGGGGCAGTGGGTGGGTGGGGGG + Intronic
1132929980 16:2454133-2454155 AAGGGCAGGCACTGGGTGGCTGG + Intronic
1133108980 16:3534300-3534322 TTGAGCAGGGCCTGAGTGGAGGG + Intronic
1133239233 16:4404705-4404727 TTGGAGAAGGATTGGGTGGGAGG - Intronic
1133350547 16:5097957-5097979 TGGGGCAGGTCCTGGGTAGGGGG + Intergenic
1133358576 16:5155530-5155552 TTGGGCGGGGAGGGGGTGGCGGG - Intergenic
1134093845 16:11405907-11405929 CTGGGCTGGAGCTGGGTGGGTGG - Intronic
1134214552 16:12306956-12306978 TTGTGCAGGGAAAGGGTGTGAGG + Intronic
1134226187 16:12392424-12392446 TGGAGCAGGGAAAGGGTGGGAGG - Intronic
1134242765 16:12517982-12518004 TTGGTGAGGGTCGGGGTGGGAGG + Intronic
1134422432 16:14106792-14106814 TTGGGCTGGGACTCAGTGAGGGG + Intronic
1134527884 16:14958236-14958258 TAGGGGAGGGACCTGGTGGGAGG + Intergenic
1134884302 16:17776162-17776184 TGGGGCAGGGAATGGGAGGCAGG - Intergenic
1135047839 16:19168906-19168928 TTGGGGAGGGAATGGGGGGTGGG + Intronic
1135151790 16:20013710-20013732 TGTGGGAGGGACCGGGTGGGAGG + Intergenic
1135209337 16:20510753-20510775 TGGGGGAGGGACCTGGTGGGAGG + Intergenic
1136380798 16:29894429-29894451 TTCGCCAGGGAAAGGGTGGGAGG - Intronic
1136395746 16:29991594-29991616 CTGGGCAGGGCAGGGGTGGGTGG + Intronic
1136455606 16:30378241-30378263 GTGGGCGGTGTCTGGGTGGGCGG + Exonic
1136500807 16:30668989-30669011 TGGGGCAGGGGCAGGGTGGGTGG - Intronic
1136779176 16:32886228-32886250 GAGGGCAGGGACAAGGTGGGCGG - Intergenic
1136891441 16:33975290-33975312 GAGGGCAGGGACAAGGTGGGCGG + Intergenic
1137630291 16:49938607-49938629 TGTGGGAGGGACTTGGTGGGAGG - Intergenic
1137644950 16:50065935-50065957 TTGGGGCGGGGCGGGGTGGGGGG - Exonic
1137668712 16:50266796-50266818 CTGGGCAGGGTCTGGGCTGGGGG + Intronic
1137773961 16:51040665-51040687 ATGGGCAGGGACAGGCAGGGAGG + Intergenic
1137952051 16:52792691-52792713 TTGGGCAGGGGCTAGTGGGGGGG - Intergenic
1138062165 16:53903183-53903205 TTGGGAAGGGAATGAGTGGCTGG - Intronic
1138454292 16:57112513-57112535 TTGGAAATGGACTGGGTGGGAGG + Intronic
1138606566 16:58093863-58093885 TTGGGGAGGAGCAGGGTGGGTGG - Intergenic
1139030783 16:62878225-62878247 ATGGGGAGGGACATGGTGGGAGG + Intergenic
1139774916 16:69311161-69311183 GGGGGCGGGGACGGGGTGGGTGG - Intronic
1139797748 16:69496994-69497016 ATGGGGAGGGACCTGGTGGGAGG + Intergenic
1139968363 16:70758247-70758269 TGGGCCAGGGTCTGGGTGAGGGG + Intronic
1140296730 16:73716183-73716205 TAGGGGAGGGAATGGGTGGCTGG + Intergenic
1140424526 16:74849646-74849668 TGGGGGAGGGACCTGGTGGGAGG + Intergenic
1140455572 16:75103494-75103516 GTGGCCAGGGGCTGGGCGGGGGG + Intronic
1140557327 16:75936739-75936761 TGGGGGAGGGACCTGGTGGGAGG + Intergenic
1140740674 16:77938460-77938482 TGGAGGAGGGGCTGGGTGGGAGG + Intronic
1141352976 16:83316204-83316226 TTGGGGAGGGACCTCGTGGGAGG - Intronic
1141822037 16:86453102-86453124 TTGGGCAGGGATCAGCTGGGTGG - Intergenic
1141871329 16:86788652-86788674 GTGGTGAGGGCCTGGGTGGGGGG + Intergenic
1142028605 16:87827352-87827374 TTGGGCAGGGCCAGGGCTGGTGG + Intergenic
1142190817 16:88716522-88716544 TGGGGCAGTGCCTGGGTGGGTGG - Intronic
1142196191 16:88740370-88740392 CTGGGAAGGGGCTGGGTGGCTGG - Intronic
1142241563 16:88949588-88949610 ATGGGCTGGGAGTGGGTGTGGGG + Intronic
1142368127 16:89661258-89661280 TGTGGGAGGAACTGGGTGGGAGG + Intronic
1142445566 16:90133870-90133892 TTTGGTAGGGACGGGGTGGGGGG + Intergenic
1142687631 17:1586881-1586903 TTGAACAGAGACTGGCTGGGAGG + Intronic
1142714013 17:1738207-1738229 CTGGCCAGGGCCTGGATGGGTGG - Exonic
1142958133 17:3535087-3535109 TAAGGCAGGGACAGTGTGGGTGG + Intronic
1143102894 17:4513950-4513972 CTGGGCCGGGACAGTGTGGGAGG + Intronic
1143400468 17:6639537-6639559 GTGGACAGGGACAGGCTGGGAGG - Intronic
1143463291 17:7117783-7117805 TTGGGCAGGGCTAGGCTGGGCGG - Intergenic
1144222788 17:13115032-13115054 TGAGGTAGGGACTGGGCGGGGGG - Intergenic
1144831093 17:18131560-18131582 TTGGGCAGGGTCGGGGTGGGAGG + Intronic
1144966127 17:19078188-19078210 GTGGATGGGGACTGGGTGGGTGG + Intergenic
1144966195 17:19078364-19078386 GTGGGTGGGGACTGGGTGGATGG + Intergenic
1144981723 17:19173693-19173715 GTGGGTGGGGACTGGGTGGATGG - Intergenic
1144981769 17:19173811-19173833 GTGGGTGGGGACTGGGTGGATGG - Intergenic
1144981775 17:19173826-19173848 GTGGATGGGGACTGGGTGGGTGG - Intergenic
1144981819 17:19173942-19173964 GTGGATGGGGACTGGGTGGGTGG - Intergenic
1144981842 17:19174001-19174023 GTGGATGGGGACTGGGTGGGTGG - Intergenic
1144986382 17:19204238-19204260 GTGGATGGGGACTGGGTGGGTGG + Intergenic
1144986405 17:19204297-19204319 GTGGATGGGGACTGGGTGGGTGG + Intergenic
1144986449 17:19204413-19204435 GTGGATGGGGACTGGGTGGGTGG + Intergenic
1144986455 17:19204428-19204450 GTGGGTGGGGACTGGGTGGATGG + Intergenic
1144986501 17:19204546-19204568 GTGGGTGGGGACTGGGTGGATGG + Intergenic
1145073416 17:19831271-19831293 ATGGGGAGGGGCTTGGTGGGAGG - Intronic
1145167015 17:20621660-20621682 TTTGGCTGGGACAGGGTTGGAGG - Intergenic
1145993251 17:29091751-29091773 TTGGGCAGGGAATGGGGCAGGGG - Intronic
1146464444 17:33075107-33075129 TGTGGGAGGGACTAGGTGGGAGG + Intronic
1146513784 17:33473184-33473206 TGGGGCAGGGACTGGCATGGGGG + Intronic
1146684573 17:34832675-34832697 TGGGGAGGGCACTGGGTGGGTGG + Intergenic
1146916701 17:36682595-36682617 TGGGGCAGGGACAGGGGAGGTGG + Intergenic
1147302436 17:39540731-39540753 TTGGGCTGGGACTGGGGCGGGGG + Intronic
1147324943 17:39665648-39665670 CTGGGCACAGGCTGGGTGGGGGG - Intronic
1147574070 17:41588610-41588632 TAGGGCTGGGCCAGGGTGGGGGG - Intergenic
1147715785 17:42507322-42507344 TTGGGCTGGGGCTGGGGAGGCGG + Intronic
1148104175 17:45110603-45110625 CTGGCCAGGGGCTGGCTGGGGGG - Exonic
1148129828 17:45256136-45256158 TGGGGCAGGGACTCGGTGCCAGG - Intronic
1148324162 17:46773624-46773646 GGGGGGAGGGGCTGGGTGGGGGG - Intronic
1148693056 17:49544158-49544180 TGGGGGAGGGACCTGGTGGGAGG - Intergenic
1148905330 17:50908330-50908352 TTGAGCTGGGCCTGGGCGGGTGG - Intergenic
1149028656 17:52059510-52059532 TTGGGCAGGGAGTGTGTGTGTGG - Intronic
1149113642 17:53064114-53064136 TTGTGGAGGGACCTGGTGGGAGG + Intergenic
1149145683 17:53490311-53490333 TGGAGGAGGGACTTGGTGGGAGG - Intergenic
1150135371 17:62692462-62692484 GTGGGCAGGGCCAGGGCGGGAGG + Exonic
1150319730 17:64202494-64202516 TTGGTCAGATCCTGGGTGGGGGG - Intronic
1150458243 17:65325620-65325642 TTGGCCAGGGATAGGGTGGAGGG + Intergenic
1150509851 17:65739231-65739253 TTGGGCAGGGATCAGCTGGGTGG - Intronic
1150849658 17:68692634-68692656 TTGGCCAGGGATTGGGTAGATGG + Intergenic
1151029633 17:70721622-70721644 TGTGGGAGGGACTTGGTGGGAGG + Intergenic
1151104512 17:71596984-71597006 ATGGGCTGGGAGTGGGTGAGTGG - Intergenic
1151373682 17:73667540-73667562 TTGGGAGGGGACTGAGTGAGTGG - Intergenic
1151459090 17:74244056-74244078 TGGGGGAGGGAGTGGGTGGTGGG + Intronic
1151679073 17:75614464-75614486 TTGGGAGGAGGCTGGGTGGGAGG - Intergenic
1151788217 17:76287011-76287033 GTGGGCAGGGGGTGGGGGGGCGG - Intronic
1152252710 17:79220069-79220091 CTGGGAAGGCACGGGGTGGGGGG + Intronic
1152292460 17:79447865-79447887 TGGGGGAGGGACCTGGTGGGAGG + Intronic
1152362114 17:79837574-79837596 TTGGGAAGGGTGTGTGTGGGTGG - Intronic
1152411039 17:80123247-80123269 GTGGGAAGGGACAGGGTCGGAGG + Intergenic
1152572068 17:81125235-81125257 CTGGGGAGGGACTGTGTGCGTGG + Intronic
1152887506 17:82860942-82860964 GTGGCCAGGGACTTGGCGGGGGG + Intronic
1152901165 17:82941836-82941858 TGGGGCCGGGGCTGGGTGAGAGG + Intronic
1152929112 17:83100940-83100962 TTGAGCAGGGGCAGGCTGGGCGG + Intergenic
1152932640 17:83117958-83117980 TTGGGCTGGGACAGGCTGTGGGG + Intergenic
1152933080 17:83120132-83120154 TTGGGGAGGGATTGGGGGAGGGG + Intergenic
1153698369 18:7666854-7666876 TTTGGCAGGGGGTAGGTGGGAGG + Intronic
1153712165 18:7810606-7810628 TTGGGGAGAGACTGGGGTGGGGG + Intronic
1155086418 18:22463566-22463588 ATGGGCAGGGATTGGGAGGTGGG - Intergenic
1155125682 18:22873174-22873196 TGGGGTAGGGACCTGGTGGGAGG - Intronic
1155267075 18:24104498-24104520 CTGGGCAGGGATGAGGTGGGTGG - Intronic
1155728976 18:29128035-29128057 TAGGGAAGGGACCTGGTGGGAGG - Intergenic
1155750415 18:29416201-29416223 TGTGGGAGGGACTGGGTGAGAGG + Intergenic
1156084530 18:33382752-33382774 TTGGGCAGGCACTGGGCTGCAGG + Intronic
1156281779 18:35646279-35646301 TGGGGAAGGGACCTGGTGGGAGG - Intronic
1156502616 18:37569023-37569045 TGGGGCAGGAGCTGGGAGGGAGG - Intergenic
1157018022 18:43743176-43743198 TGGGGCAGGGAGTAAGTGGGTGG + Intergenic
1157068790 18:44382070-44382092 TGGGGGAGGGACCTGGTGGGAGG - Intergenic
1157068875 18:44382713-44382735 TGGGGGAGGGACCTGGTGGGAGG - Intergenic
1157698871 18:49746736-49746758 TGGGGATGGGACTTGGTGGGAGG + Intergenic
1157861226 18:51142460-51142482 GTGGGGAGGGACCTGGTGGGAGG - Intergenic
1157891396 18:51421542-51421564 TAGGGGAGGGACTTGGTAGGAGG - Intergenic
1158264185 18:55641506-55641528 TGTGGGAGGGACTCGGTGGGAGG - Intronic
1158846228 18:61445788-61445810 GTGGGCAGGGCTTGGGAGGGAGG + Intronic
1158854090 18:61525076-61525098 TTTGCCAGGGGCTGGGTGGGAGG + Intronic
1158930705 18:62323426-62323448 TGTGGCAGGGACCTGGTGGGAGG + Intergenic
1159055512 18:63459483-63459505 GTGGGGAGGGACCCGGTGGGAGG - Intergenic
1159494885 18:69189906-69189928 TGTGGAAGGGACTGGGTCGGAGG + Intergenic
1159667873 18:71185608-71185630 ATGGGCAGGGTCTGGGTGGAGGG + Intergenic
1159802919 18:72923195-72923217 TAGGGAAGGGACCTGGTGGGAGG - Intergenic
1160000816 18:75019939-75019961 TGGGGGAGGGACCTGGTGGGAGG - Intronic
1160224397 18:77001143-77001165 GTGGGCGGGGACCCGGTGGGCGG - Intronic
1160570064 18:79810035-79810057 TTGCGCTGGGCCTGGGTGGAAGG + Intergenic
1160611119 18:80085990-80086012 TAGGGGAGGGACCTGGTGGGAGG + Intronic
1160715501 19:574687-574709 TTGGGCAGAGGCTGGGGAGGGGG + Intronic
1160745621 19:709629-709651 TTGGGAAGGGCGGGGGTGGGGGG - Intronic
1160847186 19:1171750-1171772 TTAGGCAGCAAGTGGGTGGGGGG + Intronic
1160882504 19:1327757-1327779 TGGGGCAGGGAATGGGAGTGAGG - Intergenic
1160909703 19:1468942-1468964 CTGGGCAGGGGCTGGGAGGCGGG - Exonic
1160941338 19:1621768-1621790 CCAGGCAGGGTCTGGGTGGGGGG - Intronic
1160976093 19:1793444-1793466 TGGGGAAGGCACCGGGTGGGTGG - Intronic
1161169114 19:2804255-2804277 TCGGGCAGGGGCCAGGTGGGAGG + Intronic
1161733217 19:5974946-5974968 TGGAGGAGGGACTGGGTGTGAGG + Intronic
1162015468 19:7844521-7844543 CTGGGCAGGGAGGGGCTGGGAGG - Intronic
1162061989 19:8101661-8101683 CTGGGCTGGGATAGGGTGGGAGG - Intronic
1162135806 19:8554630-8554652 TGAGGCTGGGGCTGGGTGGGAGG - Intronic
1162293009 19:9792868-9792890 CCGGGCAGGGACTCGGTGAGGGG - Intronic
1162332482 19:10038832-10038854 TTGGGCAGTGGCGGGGTGGGGGG - Intergenic
1162552347 19:11364698-11364720 CTGGGCAGATTCTGGGTGGGTGG - Exonic
1162781497 19:13009300-13009322 CTGGGCAGCGGGTGGGTGGGGGG + Intronic
1162936961 19:13986213-13986235 GTGGGCAGGGAGTGGGGGGCTGG + Intronic
1163268347 19:16234539-16234561 CTGGGCAGAGGCTGGGAGGGTGG - Exonic
1163604830 19:18268346-18268368 ATGGGTAGGTATTGGGTGGGGGG + Intronic
1163622211 19:18367743-18367765 CTGGGCAGGGACAGGGGGTGGGG + Exonic
1163782511 19:19257875-19257897 TGGGGCTGGGGCTGGGCGGGCGG - Exonic
1164096991 19:22020559-22020581 TTGGGCAATGACGGGGTGGCTGG + Intergenic
1164526755 19:29018683-29018705 TTGGGAAGGCACAGGGTGGCAGG + Intergenic
1164586970 19:29481982-29482004 TTAGGGAGGGACCTGGTGGGAGG - Intergenic
1164604782 19:29589951-29589973 TGTGGGAGGGACTCGGTGGGAGG - Intergenic
1164646575 19:29862688-29862710 TGTGGCAGAGAGTGGGTGGGAGG + Intergenic
1164676864 19:30106913-30106935 CTGGGCATGGGCTGGGTGAGTGG + Intergenic
1164757024 19:30697239-30697261 TGAGGCAGGGACCTGGTGGGAGG - Intronic
1164784624 19:30920142-30920164 TGTGTCAGGGACAGGGTGGGTGG + Intergenic
1164944969 19:32285854-32285876 TTGGGGAGGGACTGGGGGAAGGG - Intergenic
1165113140 19:33513651-33513673 TTGGGCAGGGAGTGTGTGCTGGG - Intronic
1165263800 19:34643411-34643433 CTGGGAAGGGTGTGGGTGGGGGG + Intronic
1165407346 19:35638967-35638989 TGGGGCAGGGACTGGGCCAGAGG + Intergenic
1165595966 19:37011496-37011518 TTGGGCTGGGGCTGGGTGCATGG + Intronic
1165921782 19:39303483-39303505 TTGGCCAGGTAGGGGGTGGGTGG - Intergenic
1166060016 19:40320362-40320384 GTGGGCAGGGGCTAGGTGGCTGG - Exonic
1166131651 19:40749439-40749461 TAGGGCAGAGCCTGGGTGGTGGG + Intronic
1166321530 19:42022101-42022123 TAGGGCAGGGGCTGGGTGTGAGG - Intronic
1166328625 19:42066180-42066202 CAGGGGCGGGACTGGGTGGGGGG - Intronic
1166380136 19:42351347-42351369 GGGTGCAGGGAGTGGGTGGGTGG + Intronic
1166532633 19:43552229-43552251 TCGGGCAGGGACTGGGGCTGTGG + Exonic
1166663946 19:44665923-44665945 TTGGCCAGGGATTGGTTGAGCGG - Intronic
1166906597 19:46114556-46114578 TTAGGGAGGGACATGGTGGGAGG + Intergenic
1166948816 19:46413079-46413101 TGAGGGAGGGACTGGATGGGGGG + Exonic
1166971944 19:46574713-46574735 TGGGGGAGGGACCTGGTGGGAGG + Intronic
1167006148 19:46777666-46777688 ATGGGCGGGATCTGGGTGGGCGG - Intronic
1167200503 19:48061958-48061980 TGGGGCCGGTCCTGGGTGGGAGG - Intronic
1167293383 19:48636294-48636316 GGGGGCAGGGACAGGGTAGGTGG + Intronic
1167439717 19:49501000-49501022 AGGGGCAGGGACAGGTTGGGGGG + Intergenic
1167620226 19:50556376-50556398 ATGGGAAGAGCCTGGGTGGGAGG - Intronic
1167679208 19:50909208-50909230 GTGGGCAGGGCCTGGGTCCGGGG - Intronic
1167684647 19:50949182-50949204 TGGGGCTGGGGCTGGGTGTGGGG - Intronic
1167740799 19:51323903-51323925 TTGGCCGGGGCCTGGCTGGGTGG + Intronic
1167761267 19:51451218-51451240 TGGGGGAGGGACCTGGTGGGAGG - Exonic
1168273697 19:55264991-55265013 TGGGGAAGGGACAGGGTGTGAGG - Intronic
1168290265 19:55354140-55354162 AGGGGCAGGGTCTGGGTAGGAGG - Exonic
1168360405 19:55735051-55735073 TTGGGAAGGGACTGGACGGAAGG + Intronic
1168405487 19:56108272-56108294 CTGGGCAGGGGCGGGGTGGAGGG - Intronic
1168405500 19:56108306-56108328 CTGGGCAGGGGCTGGGTGGTGGG - Intronic
1168405514 19:56108341-56108363 CTGGGCAGGGGCGGGGTGGAGGG - Intronic
1168405528 19:56108376-56108398 CTGGGCAGGGGTTGGGTGGAGGG - Intronic
1168405541 19:56108411-56108433 CTGGGCAGGGGCAGGGTGGAGGG - Intronic
1168712635 19:58510782-58510804 GTCAGCAGGCACTGGGTGGGAGG + Exonic
1202696808 1_KI270712v1_random:131985-132007 CGGGACAGGGGCTGGGTGGGTGG + Intergenic
925035971 2:686087-686109 CTGGGCAGGGACTCTGTGTGGGG - Intergenic
925123672 2:1438573-1438595 TGGGGCAGGGTGGGGGTGGGTGG - Intronic
925225174 2:2177789-2177811 TTGGGGAGGAACCTGGTGGGAGG - Intronic
925274771 2:2641012-2641034 TGGGGCAGGAACTGGGAGAGTGG + Intergenic
925473886 2:4191853-4191875 CATGGCAGGGACTCGGTGGGAGG - Intergenic
925498454 2:4478832-4478854 TTGGGCTTGGGCTTGGTGGGAGG - Intergenic
926913971 2:17876362-17876384 CTGGGCAGGAAGTGGGTGTGTGG + Intergenic
927257224 2:21050122-21050144 TTAGGGAGGGACCTGGTGGGAGG - Intergenic
927710768 2:25324599-25324621 TTGGGCAGGGGGTGGGGGTGGGG - Intronic
927718119 2:25365507-25365529 TTGGGCTGGGGTGGGGTGGGTGG + Intergenic
927925810 2:27012848-27012870 TTGGGAGGGGACTGGATGTGGGG + Intronic
927956283 2:27209755-27209777 TTGGGCAGACACTGGCTGGCTGG + Intronic
928439936 2:31284022-31284044 CTGGGAAGTGGCTGGGTGGGAGG - Intergenic
928555799 2:32423672-32423694 AGGGGCAGGGATTGGGGGGGTGG - Intronic
928709778 2:33990915-33990937 TTTGGCGGGGATGGGGTGGGGGG + Intergenic
928797170 2:35035640-35035662 TTGAGGAGGGACCTGGTGGGAGG - Intergenic
928886706 2:36157421-36157443 TTGGGGAAGGACCTGGTGGGAGG - Intergenic
928917886 2:36492840-36492862 TTGGGCAGGGATTGGGGGGTTGG - Intronic
928954264 2:36845976-36845998 TTGGGGAGGGGGTGGGAGGGGGG - Exonic
929020520 2:37548140-37548162 TGTGGGAGGGACTTGGTGGGAGG - Intergenic
929854599 2:45626114-45626136 TTAGGCAGGGACTTGGTGCCTGG + Intergenic
930247745 2:49002672-49002694 TTGGGGAGGGACTTCATGGGAGG - Intronic
930254874 2:49078361-49078383 TATGGCAGGGACCTGGTGGGAGG - Intronic
930276951 2:49322781-49322803 TGGGGAAGGGACCTGGTGGGAGG + Intergenic
931070070 2:58636907-58636929 TAGGTCAGGGACTGGGTTGCAGG + Intergenic
931132967 2:59359816-59359838 TTAGGGAGGGACCTGGTGGGAGG + Intergenic
931269567 2:60689512-60689534 TTGGGGAGGGACCTGGTGGAAGG + Intergenic
932003527 2:67906252-67906274 TCGGGGTGGGGCTGGGTGGGAGG - Intergenic
932166720 2:69514480-69514502 CTGGGCAGGGGCTGGCTGTGGGG + Exonic
932343145 2:70979089-70979111 TCGGGCAGGGGCTGGCTGGAGGG - Exonic
932375134 2:71228393-71228415 TGGGGGAGGGACTTGGTGGGAGG + Intergenic
932657449 2:73622465-73622487 TTGTGGAGGGACCTGGTGGGAGG + Intergenic
932719744 2:74130428-74130450 TTGGGCAGGGAGTGGAGAGGCGG + Intergenic
933949228 2:87313960-87313982 TTTGGCAGGGACAGGGGGTGGGG + Intergenic
933966363 2:87432576-87432598 GAGGGCAGGCACTGAGTGGGTGG + Intergenic
934277963 2:91588999-91589021 CCGGACAGGGGCTGGGTGGGTGG + Intergenic
934573519 2:95385989-95386011 TTGGCCACGGCCTGGGAGGGTGG + Exonic
934574687 2:95392513-95392535 GTGGGCAGGGAATGGGGTGGGGG - Intergenic
934949602 2:98567298-98567320 TGGGGCTGGGGCTGAGTGGGAGG + Intronic
935018773 2:99210962-99210984 TAGGGGAGGGACCTGGTGGGAGG - Intronic
935192587 2:100790893-100790915 GTTGCCAGGGACTGGGAGGGAGG - Intergenic
935194504 2:100804459-100804481 TGGGGGAGGGACCTGGTGGGAGG - Intergenic
935395819 2:102607510-102607532 TGGGGGAGGGACCTGGTGGGAGG + Intergenic
935488963 2:103694027-103694049 TTGGGAAGGGGTGGGGTGGGAGG - Intergenic
935489449 2:103698611-103698633 TTGGGCAGGCACTGGGCTGCAGG - Intergenic
935498455 2:103809519-103809541 TGGGGGAGGGATCGGGTGGGAGG + Intergenic
935548909 2:104430843-104430865 GTGGGCTGGGCCTGGGTGAGAGG + Intergenic
935597225 2:104888708-104888730 TGGGGAAGGAAGTGGGTGGGTGG - Intergenic
935691414 2:105735669-105735691 TGGGGGAGGGACCTGGTGGGAGG - Intergenic
935874994 2:107496877-107496899 TGGGGGAGGGATGGGGTGGGTGG - Intergenic
936285132 2:111175781-111175803 TTGGGGAGGGGCTGGGGTGGAGG + Intergenic
936327432 2:111517909-111517931 GAGGGCAGGCACTGAGTGGGTGG - Intergenic
936330969 2:111547637-111547659 TTTGGCAGGGACAGGGGGTGGGG - Intergenic
936586907 2:113766014-113766036 TTGGACAGGGGCCTGGTGGGGGG - Intergenic
937095057 2:119229818-119229840 GTGGGCAGGGACTGGAAGGAGGG + Intronic
937209130 2:120256444-120256466 TGTGGGAGGGACTCGGTGGGAGG + Intronic
937263618 2:120601997-120602019 CTGGGCAGGGGCATGGTGGGTGG - Intergenic
937712249 2:124991335-124991357 TAGGGGAGGGACCTGGTGGGAGG - Intergenic
938302195 2:130224243-130224265 TTGGGTGGGAATTGGGTGGGTGG - Intergenic
938442836 2:131351934-131351956 GTGGGCATGGATGGGGTGGGAGG + Intronic
938454485 2:131450025-131450047 TTTGGGGGGGATTGGGTGGGTGG + Intergenic
938701789 2:133886032-133886054 TGGGGCGGGGCCTGGCTGGGAGG - Intergenic
939136097 2:138296132-138296154 TGTGGCAGGGACCTGGTGGGAGG - Intergenic
939385375 2:141489141-141489163 GTGAGTGGGGACTGGGTGGGGGG + Intronic
939551363 2:143619657-143619679 TGGGGGAGGGACCTGGTGGGAGG + Intronic
940682686 2:156806250-156806272 TGGAGGAGGGACTTGGTGGGAGG - Intergenic
941888236 2:170551797-170551819 TGGGGGAGGGACCTGGTGGGAGG + Intronic
941904010 2:170704058-170704080 TGGGGGAGGGACTTGGTGGGAGG - Intergenic
942169484 2:173276086-173276108 CAGGGGAGGGACTGGGTGAGAGG - Intergenic
942289502 2:174454924-174454946 TTGGGCAGGTAGGGGGTGGCAGG + Intronic
942991313 2:182206723-182206745 TAGGGGAGGGACCTGGTGGGAGG + Intronic
943622904 2:190169274-190169296 TGTGGAAGGGACTCGGTGGGAGG - Intronic
944808999 2:203309517-203309539 TGTGGGAGGGACTGGGTGGTGGG + Intergenic
944880713 2:204010189-204010211 TGGGGGAGGGACCTGGTGGGAGG + Intergenic
945114073 2:206393711-206393733 TGTGGGAGGGACTGGGTGGGAGG + Intergenic
945120678 2:206454389-206454411 TGGGGTAGGGACCTGGTGGGAGG - Intronic
945147411 2:206752926-206752948 AGGGGCAGGGGGTGGGTGGGTGG - Intronic
945441298 2:209883391-209883413 GTTGCCAGGGACTTGGTGGGAGG - Intronic
946139116 2:217673117-217673139 ATAGTCATGGACTGGGTGGGAGG + Intronic
946742049 2:222812489-222812511 TTGAGCATTTACTGGGTGGGAGG - Intergenic
947138679 2:227000771-227000793 ATGGGAGGGGACTCGGTGGGAGG + Intergenic
947257152 2:228180140-228180162 TGGGGCAGGGATCGGGAGGGTGG + Intronic
947443021 2:230139919-230139941 TTGGGGAGGGACCTGGTGGGAGG + Intergenic
947466465 2:230352551-230352573 TTGGAAAGGGACCTGGTGGGAGG - Intronic
947523716 2:230866104-230866126 GCGGGCAGGGACAGGGAGGGAGG + Intronic
947749672 2:232525733-232525755 TTGGGATGGGACCTGGTGGGTGG + Intergenic
948200206 2:236124247-236124269 TTGGGGTGAGAGTGGGTGGGCGG - Exonic
1168769886 20:408263-408285 GTGGGGCGGGACTGGGAGGGGGG - Exonic
1169266023 20:4167827-4167849 CTGGGGAGGGTCTGGCTGGGAGG + Intronic
1169817780 20:9676230-9676252 TGTGGGAGGGACTCGGTGGGAGG - Intronic
1170252154 20:14295549-14295571 TTAGGAGGGGACTGTGTGGGGGG + Intronic
1170419299 20:16176624-16176646 TTGGACAGGGCCTGGCTGGGTGG - Intergenic
1170447143 20:16439886-16439908 TGTGGGAGGGACTTGGTGGGAGG - Intronic
1171101031 20:22384241-22384263 TTGGGTAGGGAGGGGTTGGGAGG + Intergenic
1171424802 20:25042743-25042765 TGGGGCCGAGAGTGGGTGGGTGG - Intronic
1171517313 20:25747716-25747738 CTGGGCAGGCACTGGGAGGGAGG + Intergenic
1172132220 20:32663673-32663695 TTGGGCTGGGGCTGGATGGCAGG + Intergenic
1172459287 20:35103768-35103790 TGTGGGAGGGACCGGGTGGGAGG + Intergenic
1173006484 20:39143224-39143246 TCAGCCAGGGGCTGGGTGGGAGG + Intergenic
1173256264 20:41396017-41396039 TTGGGCAGGGGTTGGGGGCGGGG - Intergenic
1175684029 20:61013983-61014005 TTGGGGAGGGGCTTGGTGGGAGG - Intergenic
1175770056 20:61617860-61617882 TTGAGGAGGGACCCGGTGGGAGG + Intronic
1176047750 20:63101441-63101463 ATGGGCAGGCGCTGGGTGGGTGG + Intergenic
1176061506 20:63174766-63174788 TGCTGCAGGGGCTGGGTGGGGGG + Intergenic
1176108315 20:63399737-63399759 TTGGGCAGGGAGTGGGGGCAGGG + Intergenic
1176128889 20:63487951-63487973 TTGGGCAGGGAGGGGGTCCGGGG + Intergenic
1176130840 20:63496201-63496223 GGGGGCAGGGTCTGGGTGTGGGG - Intronic
1176197542 20:63844380-63844402 TTGGCCAAGGCCTGGGTGAGGGG + Intergenic
1176253453 20:64138151-64138173 TGGGGCAGGGTCTGTGGGGGTGG + Intergenic
1176622986 21:9071260-9071282 TGGGGCAGGGTCTTGGTGTGTGG + Intergenic
1176991749 21:15505494-15505516 TGGAGGAGGGACTTGGTGGGAGG + Intergenic
1177008201 21:15699779-15699801 TGGGGGAGGGACCTGGTGGGAGG - Intergenic
1177822431 21:26046107-26046129 TGTGGAAGGGACTCGGTGGGAGG - Intronic
1177862452 21:26470417-26470439 TGGGGGAGGGACTTGGTGGGAGG + Intronic
1177957574 21:27618817-27618839 TGTGGGAGGGACTTGGTGGGAGG + Intergenic
1178307682 21:31504039-31504061 TTGGGCAGGGATTGGCAGGAGGG - Intronic
1178432743 21:32530868-32530890 TGGGGGAGGGACCCGGTGGGAGG + Intergenic
1179070106 21:38063642-38063664 TCGGGGAGGGACCTGGTGGGAGG - Intronic
1179398653 21:41064069-41064091 TTGGGCAGGGACTGCGTAACAGG - Intergenic
1179445961 21:41430452-41430474 TGGGAATGGGACTGGGTGGGTGG + Intronic
1179793566 21:43769419-43769441 GTAGACAGGGTCTGGGTGGGGGG - Intergenic
1179922379 21:44514120-44514142 CTGGGCAGAGCCTGGGCGGGAGG - Intronic
1180073935 21:45452187-45452209 CTGGGCAGGGGCTGGGAAGGAGG + Intronic
1180657670 22:17436882-17436904 TTAGGCAGGAACTGGGGGTGGGG + Intronic
1180750358 22:18120029-18120051 CAGGGCAGGGTGTGGGTGGGAGG + Intronic
1180831794 22:18910452-18910474 GTGTGCTGGGACTGGGTGGAGGG + Intronic
1180888956 22:19271283-19271305 TTGGAGAGGGACCTGGTGGGAGG + Intronic
1181011112 22:20041067-20041089 AGGGGCAGGCACTGAGTGGGGGG + Intronic
1181104624 22:20566617-20566639 TGGGGCAGAGCCTGGGAGGGCGG - Exonic
1181488158 22:23244620-23244642 ATGGGCAGGGGCTGGGTGTGCGG + Intronic
1181855647 22:25779890-25779912 TTGGGCAGGGAGTGGGTGGCAGG + Intronic
1182085811 22:27560424-27560446 CTGGGCAGTGAGTGAGTGGGCGG - Intergenic
1182110120 22:27717339-27717361 TAGGGGAGGGACCTGGTGGGCGG - Intergenic
1182410685 22:30182917-30182939 TGGCTGAGGGACTGGGTGGGAGG - Intergenic
1182523358 22:30898688-30898710 CAGGGGAGGGACCGGGTGGGAGG - Intronic
1182712584 22:32332032-32332054 TTGGCCAGGGCCTGGGGTGGGGG - Intergenic
1182786985 22:32916258-32916280 TTGGGCAGGGCTTAGCTGGGTGG - Intronic
1182958799 22:34452865-34452887 TTGGGCTGGGACTGGTGGGGTGG - Intergenic
1183351840 22:37338916-37338938 TTGGGGAGGGCCAGGGTGGCTGG - Intergenic
1183382100 22:37495484-37495506 CTGGGCAGGTAGTGGGTGGGGGG - Intronic
1183464632 22:37973452-37973474 GGGGGCAGGGGCTGGGCGGGGGG + Exonic
1183489508 22:38109060-38109082 CTGGGAGGGGCCTGGGTGGGTGG + Intronic
1183593201 22:38793808-38793830 CTGGGCAGGCCTTGGGTGGGTGG + Intronic
1183724437 22:39580646-39580668 TGGGGCAGGGGCTGGATGGCAGG + Intronic
1184107851 22:42378898-42378920 TTGGACTGGGAATGGCTGGGAGG + Intergenic
1184208933 22:43023854-43023876 TGGGGCAGGGAGTGGGCAGGTGG + Intergenic
1184255957 22:43287101-43287123 TTGGGCTAGGGCTGAGTGGGAGG + Intronic
1184312066 22:43652175-43652197 TTTGGGAGGGACCTGGTGGGAGG + Intronic
1184399828 22:44267414-44267436 TTGGCCAGGGCCTGGGGTGGGGG - Intronic
1184427047 22:44416332-44416354 TTTGGGAGGGACCTGGTGGGAGG + Intergenic
1184540206 22:45117708-45117730 TGGGGGAGGGACCTGGTGGGAGG + Intergenic
1184730428 22:46368516-46368538 TTGCGCAGGGGCTGGGTGTCAGG - Intronic
1184782248 22:46655259-46655281 TGAGGCTGGGAGTGGGTGGGTGG + Intronic
1184903577 22:47463701-47463723 TGGGGGAGGGACTTGGTGGGAGG + Intronic
1184930632 22:47678628-47678650 TTGGGCATGGAGTAGGAGGGGGG + Intergenic
1185137624 22:49081578-49081600 AGGGGCTGGGACTGTGTGGGGGG + Intergenic
1185212560 22:49579128-49579150 TGGGGGAGGGACTGGGTGGGAGG - Intronic
1185338732 22:50282383-50282405 GTGGTCAGGGCCAGGGTGGGCGG - Intronic
1185400025 22:50610858-50610880 TTTGGCAAGGACTGGATTGGGGG + Exonic
1203281874 22_KI270734v1_random:135723-135745 GTGTGCTGGGACTGGGTGGAGGG + Intergenic
950154301 3:10710093-10710115 TTGGGTAGGGACTTGGGGGATGG + Intergenic
950425470 3:12922777-12922799 TGGGGCAGGGCCTGGAGGGGCGG + Intronic
950485374 3:13270184-13270206 TTGGGCAGTGCTTGGCTGGGTGG - Intergenic
950486832 3:13278818-13278840 TTGGTGAGGGGCAGGGTGGGGGG + Intergenic
950538499 3:13595517-13595539 GTGTGGAGGGACAGGGTGGGAGG - Intronic
950838793 3:15947005-15947027 CATGGGAGGGACTGGGTGGGAGG + Intergenic
950904179 3:16522686-16522708 TTGGGCAAGGCTTGGCTGGGTGG - Intergenic
952368998 3:32701502-32701524 TAGGGGAGGGACCTGGTGGGAGG + Intronic
952520325 3:34150373-34150395 TTGTGCAGGGAGTGGGGGGCAGG + Intergenic
952941075 3:38444800-38444822 TTGGGCAGGCCAGGGGTGGGGGG - Intergenic
953320480 3:41966749-41966771 TTGAACCCGGACTGGGTGGGGGG + Intergenic
953552431 3:43913939-43913961 TCGGGGAGGGACCTGGTGGGAGG + Intergenic
953930516 3:47003565-47003587 GTGGGCAGGGGCTGGGTGAGGGG + Intronic
954009578 3:47623903-47623925 TTATGCAGGAACTTGGTGGGGGG + Intronic
954010255 3:47630163-47630185 TGGGGCAGGGTGGGGGTGGGGGG + Intronic
954361452 3:50124866-50124888 GTGGGCAGGGGCTGGGGGAGGGG - Intergenic
954377469 3:50202683-50202705 TAGGGCTGGGGCTGTGTGGGTGG + Intergenic
954588456 3:51758143-51758165 TGTGGGAGGGACCGGGTGGGAGG + Intergenic
954687446 3:52378487-52378509 TGGGGAAGGGGCTTGGTGGGGGG + Intronic
955147619 3:56335870-56335892 TTGGGGAGAAACAGGGTGGGTGG + Intronic
955204742 3:56885651-56885673 TCTGGCAGGAACTGGGTTGGGGG - Intronic
955348771 3:58179398-58179420 TTGGACAGTGTCTGGCTGGGAGG - Intergenic
956074649 3:65491757-65491779 TTGGGATGTGACTGGGTGGCTGG - Intronic
956255497 3:67278999-67279021 TGGGGTAGGGACCTGGTGGGAGG + Intergenic
956283563 3:67584910-67584932 TTGGGGAGGGACCCGGTGGGAGG - Intronic
956327672 3:68071372-68071394 TTTGGGAGGGACCTGGTGGGAGG - Intronic
956714319 3:72064798-72064820 TGTGGGAGGGACTTGGTGGGAGG - Intergenic
956815446 3:72904182-72904204 TTGGGCAGGGAATGGGTGATAGG - Intronic
957557341 3:81779693-81779715 TGTGGGAGGGACTCGGTGGGAGG - Intergenic
957790000 3:84928572-84928594 TGGGGGAGGGACTTGGTGGGAGG - Intergenic
957978659 3:87479448-87479470 TGGGGGAGGGACCTGGTGGGAGG + Intergenic
958114742 3:89201291-89201313 TGGGGGAGGGACCTGGTGGGAGG - Intronic
958836985 3:99157435-99157457 TAGGGGAGGGACCTGGTGGGAGG + Intergenic
959405174 3:105952861-105952883 GGAGGGAGGGACTGGGTGGGAGG - Intergenic
959765376 3:110020739-110020761 TTGGGGAGGGTGGGGGTGGGAGG + Intergenic
960216958 3:115052023-115052045 TGGGGGAGGGACTTGATGGGAGG - Intronic
961008609 3:123421613-123421635 GTAGGCAATGACTGGGTGGGAGG + Intronic
961094484 3:124142754-124142776 TGGTGCAGGGAGTGGGTGGGGGG - Intronic
961532378 3:127547504-127547526 TGGGGCAAGGACTGGGTCCGGGG + Intergenic
961819487 3:129567937-129567959 CTGGGCAGGGTTGGGGTGGGGGG + Intronic
961928582 3:130509485-130509507 TTTGGGTGGGACTGGGCGGGGGG + Intergenic
962062018 3:131938741-131938763 TGAGGGAGGGACTTGGTGGGAGG - Intronic
962318409 3:134372928-134372950 ATGGGCAGGGGTTGGGGGGGTGG + Intronic
962635082 3:137322992-137323014 TGGGGGAGGGACCTGGTGGGAGG - Intergenic
963140167 3:141940419-141940441 TTGGGGAGGGTGTGGGTGGTGGG - Intergenic
963186590 3:142424712-142424734 TCGGGCGGGGAGTGGGTAGGAGG + Intronic
963352119 3:144164663-144164685 TTAGGGAGGGACCTGGTGGGAGG - Intergenic
963367826 3:144361526-144361548 TAGGGCATGGAGTGGGTGGAAGG - Intergenic
963443571 3:145373464-145373486 TGGAGGAGGGACTTGGTGGGAGG - Intergenic
963568719 3:146964483-146964505 TTTGGGAGGGACCTGGTGGGAGG - Intergenic
963602435 3:147390174-147390196 TTCAGCAGGGGGTGGGTGGGTGG - Intronic
964341592 3:155714274-155714296 CAGGGCAGGGATGGGGTGGGAGG + Intronic
965694756 3:171396108-171396130 TTGGGGGGGCAGTGGGTGGGAGG - Intronic
965776931 3:172241682-172241704 TGTGGGAGGGACTGAGTGGGAGG - Intronic
965777192 3:172243595-172243617 TGTGGGAGGGAGTGGGTGGGAGG - Intronic
965989463 3:174799345-174799367 TATGGGAGGGACTTGGTGGGAGG + Intronic
966645909 3:182246148-182246170 TTGTCCAGGCACTGGGTGTGGGG + Intergenic
966906017 3:184526141-184526163 CTGGGCACGGACTGAGGGGGAGG + Intronic
966942816 3:184757694-184757716 CAGGGCAGGTCCTGGGTGGGTGG + Intergenic
967155315 3:186686269-186686291 TAGTGCAGAGAGTGGGTGGGTGG + Intergenic
967396704 3:189016618-189016640 TTGGTGAGGGACCAGGTGGGAGG + Intronic
967514360 3:190349188-190349210 TGGGGGAGGGACCTGGTGGGAGG + Intronic
967992336 3:195140791-195140813 TAGAGGAGGGGCTGGGTGGGAGG - Intronic
968006770 3:195248341-195248363 TGTGGGAGGGACTGGGCGGGAGG + Intronic
968093459 3:195911774-195911796 TTGGTGAGGAACAGGGTGGGAGG - Intronic
968478877 4:825386-825408 TCGCGCGGGGACTGGGAGGGCGG + Intronic
968519846 4:1030329-1030351 CGGGGCAGGGACGCGGTGGGCGG + Intergenic
968531271 4:1093026-1093048 TAGGGCAGAGGCTGGGTGGATGG + Intronic
968601898 4:1513432-1513454 GCGGGCAGGGACTTGGAGGGCGG - Intergenic
968622914 4:1611733-1611755 TTTGGCATGGCCAGGGTGGGGGG - Intergenic
968703717 4:2068798-2068820 TGGAGCAGGGCCTGGGTGGAGGG + Exonic
968725189 4:2243847-2243869 TGAGGCAAAGACTGGGTGGGAGG + Intergenic
968762382 4:2449422-2449444 TTGGCCTGGGATGGGGTGGGTGG - Intronic
968894129 4:3388747-3388769 CTGGGCGGGGTCGGGGTGGGGGG + Intronic
968951262 4:3693722-3693744 TGGGGGAGGGACCTGGTGGGAGG - Intergenic
969032774 4:4227337-4227359 CCGGACAGGGGCTGGGTGGGCGG - Intergenic
969156377 4:5214110-5214132 TGGGGGAGGGACCTGGTGGGAGG + Intronic
969263008 4:6045451-6045473 CTGGGCAGGGCCTCAGTGGGCGG + Intronic
969342178 4:6549186-6549208 TGGGGCATGGACTTTGTGGGGGG - Intronic
969630699 4:8334246-8334268 TTGGGCAGTGACTGGCTAGAAGG + Intergenic
970121538 4:12758500-12758522 TGGGGAAGGGACCTGGTGGGAGG - Intergenic
970309464 4:14766984-14767006 TAGGGGAGGGACCTGGTGGGAGG - Intergenic
971753442 4:30679150-30679172 TCTGGGAGGGACTTGGTGGGAGG + Intergenic
971817329 4:31505865-31505887 TTGGGCTGTGACAGGGTGGCTGG - Intergenic
972118343 4:35667247-35667269 TGGGGGAGGGACCTGGTGGGAGG - Intergenic
972210152 4:36826725-36826747 TGTGGGAGGGGCTGGGTGGGAGG + Intergenic
972246695 4:37252557-37252579 TTGGGCAAGGCTTGGCTGGGTGG + Intronic
972922465 4:43960641-43960663 TTGGTCAGTGAGTAGGTGGGGGG + Intergenic
973316618 4:48767366-48767388 TGGGGGAGGGACTTGGTGGGAGG - Intronic
973758540 4:54097564-54097586 CTGGGCAGGGCTGGGGTGGGGGG + Intronic
973851539 4:54965989-54966011 TGGGGCAGGGACCTGGTGGGAGG + Intergenic
974135863 4:57817121-57817143 GTGGTCAGGGATTGGGAGGGAGG + Intergenic
974310225 4:60197307-60197329 TTGAGCAGGGATTGGCTGGGAGG - Intergenic
974853874 4:67435943-67435965 TTGGGGAGGGAATTGGTGTGAGG - Intergenic
974883672 4:67789517-67789539 TTGGGGAGGGACCTGGTAGGAGG - Intergenic
974912033 4:68133878-68133900 TTTGGGAGGGACCTGGTGGGAGG - Intergenic
974973994 4:68866880-68866902 TTTGGGAGGGACCAGGTGGGAGG + Intergenic
975214670 4:71739156-71739178 TGTGGGAGGGACCGGGTGGGAGG + Intergenic
975230093 4:71923087-71923109 GGGGGCAGGGACCTGGTGGGAGG + Intergenic
975238985 4:72034499-72034521 CTTGGGAGGGACTTGGTGGGAGG - Intronic
975386616 4:73766720-73766742 TTGGGCAATGACAGGGTGGCTGG + Intergenic
976742206 4:88368031-88368053 TATGGAAGGGACCGGGTGGGAGG - Intergenic
977282712 4:95061853-95061875 TGGGGGAGGGACCTGGTGGGAGG + Intronic
977402370 4:96548401-96548423 TTGGGGAGGGACCTGGTGGGAGG - Intergenic
977580009 4:98714627-98714649 TGGGGGAGGGACCTGGTGGGAGG - Intergenic
977701172 4:100024557-100024579 TTAGGCAGGGACATGGTGAGGGG - Intergenic
977783550 4:101006704-101006726 TGGGGGAGGGACCTGGTGGGAGG + Intergenic
977844142 4:101746578-101746600 TTAGGGAGGGACCTGGTGGGAGG + Intronic
978502167 4:109421150-109421172 TTGGGGAGGGACCTGGTGGGAGG - Intergenic
978822731 4:112984516-112984538 TATGGGAGGGACTTGGTGGGAGG - Intronic
978905428 4:114000078-114000100 TGGAGTAGGGACTGAGTGGGTGG - Intergenic
978998589 4:115187688-115187710 TTGAGGAGGGACCCGGTGGGAGG - Intergenic
979053526 4:115967967-115967989 TGGGGAAGGGACCAGGTGGGAGG + Intergenic
979161301 4:117464654-117464676 TTTTCCAGGGACCGGGTGGGGGG - Intergenic
979162383 4:117479888-117479910 TGTGGGAGGGACCGGGTGGGAGG - Intergenic
979223549 4:118258681-118258703 TTGGCCTGGGAGTGAGTGGGAGG + Intergenic
979405040 4:120299313-120299335 TATGGGAGGGACTAGGTGGGAGG + Intergenic
979555397 4:122040849-122040871 TAGGGGAGGGACCTGGTGGGAGG - Intergenic
979901510 4:126225093-126225115 TTGTGGAGGGACCTGGTGGGAGG + Intergenic
980013146 4:127619044-127619066 TGGGGGAGGGACTTGATGGGAGG - Intergenic
980046986 4:128000125-128000147 TTTGGGAGGGACCTGGTGGGAGG - Intronic
980214539 4:129834804-129834826 TGCGGAAGGGACTTGGTGGGAGG - Intergenic
980572594 4:134639978-134640000 TTTGGCAGGGGGTGGGTGGGGGG + Intergenic
980875773 4:138660481-138660503 TTAGGTAAGGAGTGGGTGGGTGG + Intergenic
980942106 4:139284576-139284598 TGGGGAAGGGACCTGGTGGGAGG + Intronic
981319009 4:143370059-143370081 TTGGTCAGGGACCTGGTGGGAGG + Intronic
981936087 4:150241350-150241372 TTGTGCAGGGAATGAGTGAGGGG + Intronic
982310151 4:153975838-153975860 TGTGGCAGGAACTGGGTGGAAGG + Intergenic
982566090 4:156988739-156988761 TGGGGGAGGGACTTCGTGGGAGG + Intergenic
983105722 4:163683395-163683417 TGTGGGAGGGAATGGGTGGGAGG - Intronic
983379475 4:166973055-166973077 TAAGGAAGGGACTTGGTGGGAGG + Intronic
983439896 4:167768497-167768519 TGGAAGAGGGACTGGGTGGGTGG + Intergenic
984028790 4:174577129-174577151 CTTGGCAGGGACCCGGTGGGAGG + Intergenic
984296855 4:177863195-177863217 TTTGACAGGGGTTGGGTGGGGGG + Intronic
984334380 4:178370059-178370081 TGGTGGAGGGACTTGGTGGGAGG - Intergenic
985037601 4:185856983-185857005 TGAGGAAGGGACTTGGTGGGAGG - Intronic
985560938 5:585362-585384 TAGGTCAGGGAGTGGGTGGGTGG + Intergenic
985574098 5:665690-665712 TTGGCCTGGGAGGGGGTGGGTGG - Intronic
985762070 5:1754280-1754302 TTTGGCAGGGAAAGGCTGGGAGG + Intergenic
985835432 5:2268503-2268525 TGGGGGAGGGACCTGGTGGGAGG + Intergenic
985837281 5:2280640-2280662 ATGGGCAGGGGATGGGTGGGCGG + Intergenic
986179225 5:5377855-5377877 TGTGGAAGGGACTCGGTGGGAGG + Intergenic
986263031 5:6165260-6165282 TCGGGAAGGGACTTTGTGGGAGG + Intergenic
986266440 5:6195304-6195326 TGGGGGAGGGACCTGGTGGGAGG + Intergenic
986476477 5:8139207-8139229 TGGGGGAGGGACCTGGTGGGAGG - Intergenic
986498480 5:8372475-8372497 TGTGGGAGGGACTCGGTGGGAGG - Intergenic
986507670 5:8469947-8469969 TGTGGAAGGGACTTGGTGGGAGG - Intergenic
986881179 5:12173491-12173513 TGGGGGAGGGACCTGGTGGGAGG + Intergenic
987137365 5:14912573-14912595 TTGGGCAGCCACTGAGTTGGAGG - Intergenic
987266012 5:16255799-16255821 TGGGGGAGGGACCTGGTGGGAGG + Intergenic
987342039 5:16947823-16947845 TAGGGCAGAGAGTGTGTGGGTGG + Intergenic
987743206 5:21936728-21936750 ATGGGGAGGGACCTGGTGGGAGG + Intronic
987749607 5:22022232-22022254 TGGGGAAGGGACCTGGTGGGAGG + Intronic
988177014 5:27742048-27742070 TATGGGAGGGACTCGGTGGGAGG - Intergenic
988196314 5:28010575-28010597 TTGTGGAGGGACCTGGTGGGAGG + Intergenic
988804333 5:34726506-34726528 TAGGGGAGGGACCTGGTGGGAGG - Intronic
988989054 5:36651535-36651557 TTGGGCTGGGGGTGGGAGGGTGG - Intronic
989196418 5:38721217-38721239 TGGGGGAGGGACCTGGTGGGAGG - Intergenic
989296829 5:39838428-39838450 TTAGGGAGGGACCTGGTGGGAGG + Intergenic
989434543 5:41396197-41396219 TAGGGGAGGAACTTGGTGGGAGG + Intronic
989497372 5:42124843-42124865 TGGGGGAGGGACTTTGTGGGAGG - Intergenic
989507863 5:42248105-42248127 TGGGGAAGGGACTTGGTAGGAGG - Intergenic
989681467 5:44034300-44034322 TGTGGGAGGGACTGGGTGGGAGG + Intergenic
990109248 5:52303757-52303779 GTGGGCAAGGACTGGGTCTGGGG + Intergenic
990133624 5:52618804-52618826 TGGGGGAGGGACCTGGTGGGAGG + Intergenic
990515561 5:56528086-56528108 TTTCTCAGGGACAGGGTGGGGGG - Intronic
990620902 5:57557444-57557466 TGGGGGAGGGACCTGGTGGGAGG + Intergenic
990951204 5:61300117-61300139 TGTGGGAGGGACTTGGTGGGAGG + Intergenic
991013691 5:61910095-61910117 TTGGGCAACGACGGGGTGGCTGG + Intergenic
991509577 5:67361769-67361791 TTGGAGAGGGACTGGATGGTTGG + Intergenic
991749710 5:69787803-69787825 ATGGGGAGGGACCTGGTGGGAGG - Intergenic
991763400 5:69946837-69946859 ATGGGGAGGGACCTGGTGGGAGG + Intergenic
991783927 5:70171292-70171314 ATGGGGAGGGACCTGGTGGGAGG - Intergenic
991801289 5:70367617-70367639 ATGGGGAGGGACCTGGTGGGAGG - Intergenic
991827310 5:70642425-70642447 ATGGGGAGGGACCTGGTGGGAGG + Intergenic
991842629 5:70821897-70821919 ATGGGGAGGGACCTGGTGGGAGG + Intergenic
991876372 5:71171667-71171689 ATGGGGAGGGACCTGGTGGGAGG - Intergenic
992535963 5:77703859-77703881 TTAGGGAGGGACCTGGTGGGAGG + Intronic
992843109 5:80715847-80715869 TGGAGCAGGGACCTGGTGGGAGG - Intronic
993180070 5:84541303-84541325 TGGGGGAGGGACCTGGTGGGAGG + Intergenic
993305710 5:86272648-86272670 AGGGGCAGGGAGTGGGGGGGAGG + Intergenic
993451046 5:88072386-88072408 TGTGGGAGGGACTTGGTGGGAGG - Intergenic
993668559 5:90731366-90731388 TGGGGGAGGGACCTGGTGGGAGG - Intronic
993722191 5:91332595-91332617 GTGAGCAGTGACTGGGTTGGAGG - Intergenic
993864504 5:93176239-93176261 TGGGGCTGGGGGTGGGTGGGTGG - Intergenic
994475000 5:100256538-100256560 CTGGGGAGGGGGTGGGTGGGTGG - Intergenic
994544298 5:101143633-101143655 TGAGGGAGGGACTTGGTGGGAGG + Intergenic
994552989 5:101260663-101260685 TATGGGAGGGACTTGGTGGGAGG + Intergenic
994568659 5:101485090-101485112 TAGGGCAGGGACCTGGTGGGAGG - Intergenic
994754678 5:103779337-103779359 TTGGGGAGGGACCTGGTGGGAGG - Intergenic
994876597 5:105430963-105430985 GTTGCCAGGGACTTGGTGGGGGG - Intergenic
995382872 5:111554301-111554323 TGGGGGAGGGACCTGGTGGGAGG + Intergenic
996257136 5:121418369-121418391 TGTGGGAGGGACTTGGTGGGAGG - Intergenic
996321086 5:122217989-122218011 TGGGGGAGGGACCTGGTGGGAGG + Intergenic
996574530 5:124966871-124966893 GTGGGCAGGGGTTGGGGGGGTGG + Intergenic
997584043 5:135034283-135034305 GTGGGGTGGGCCTGGGTGGGAGG + Exonic
997652184 5:135530699-135530721 TGTGGGAGGGACCGGGTGGGAGG - Intergenic
998373067 5:141673393-141673415 TTTGGCAGTGACAAGGTGGGGGG - Exonic
998481769 5:142468872-142468894 TTTGCCAGGGGCTGGGTGGGGGG + Intergenic
998576970 5:143327331-143327353 TGGGGGAGGGACCTGGTGGGAGG - Intronic
998733562 5:145108714-145108736 CAGGGCAGGGACTGGTTCGGGGG - Intergenic
998873330 5:146574980-146575002 TGGGGGAGGGACTTGGTGGGAGG - Intergenic
999213604 5:149912853-149912875 TAGGTTAGGGACTGGGTGGTAGG + Intronic
999428022 5:151504320-151504342 AGAGGGAGGGACTGGGTGGGAGG + Exonic
999459812 5:151748285-151748307 ATGGGCAGGGAGTCGGTGGGAGG + Intronic
999890982 5:155978352-155978374 TTGGAGTGGGACAGGGTGGGAGG + Intronic
1000475770 5:161705136-161705158 TGTGGGAGGGACTTGGTGGGAGG - Intergenic
1000695138 5:164371554-164371576 TCAGGGAGGGACCGGGTGGGAGG - Intergenic
1001252377 5:170156451-170156473 TTGGGCAAGCACTGTGTGAGAGG + Intergenic
1001298622 5:170517335-170517357 TGGGGGAGGGACAAGGTGGGAGG - Intronic
1001425809 5:171621624-171621646 ATGGGCAGGAAGTGGGTTGGAGG + Intergenic
1001599329 5:172918899-172918921 GTGGGCAGGGAAGGGGAGGGAGG - Intronic
1001605764 5:172958822-172958844 GTGGGCGGGGACTGGATGAGAGG + Intronic
1001855004 5:175003311-175003333 TTGGGCGGGGAGGGGGTGGGGGG + Intergenic
1001959810 5:175872942-175872964 TTGGGCTGGGACGGGCTCGGAGG + Intronic
1001979942 5:176031163-176031185 TGGGGGAGGGTGTGGGTGGGGGG + Intronic
1002019918 5:176356935-176356957 GTTGCCAGGGAGTGGGTGGGGGG + Intronic
1002082507 5:176745888-176745910 GTGCGCGGGGACTGGGTGTGTGG + Intergenic
1002093397 5:176817561-176817583 GTGGGGAGGGGCGGGGTGGGGGG - Intronic
1002237448 5:177812528-177812550 TGGGGGAGGGTGTGGGTGGGGGG - Intergenic
1002535365 5:179872851-179872873 CTGGGCAGGGGCTGGGCTGGGGG - Intronic
1002593425 5:180306520-180306542 TGGGGCAGGGACAGGGTGCCAGG - Intronic
1002774220 6:315018-315040 CTGGTCAGGGAGTGGCTGGGTGG + Intronic
1002887992 6:1312680-1312702 CCGGGGAGGGACTGGGTGCGCGG + Exonic
1003465570 6:6376860-6376882 CTGGGCAGCGGCGGGGTGGGTGG - Intergenic
1003876452 6:10441975-10441997 TGGGGGAGGGACCTGGTGGGAGG - Intergenic
1004104745 6:12655720-12655742 TTGGGAAGGAAGTGGGAGGGAGG + Intergenic
1004235808 6:13873635-13873657 ATGGGCAGGGACTTGGCGGGAGG + Intergenic
1004273682 6:14216660-14216682 TTTAGCAGGGACTGGATGGCTGG + Intergenic
1004396158 6:15248248-15248270 CTGGGCCGGGGCTGGGCGGGCGG + Intronic
1004781127 6:18909847-18909869 TGGGGAAGGGACCTGGTGGGAGG + Intergenic
1006256118 6:32833788-32833810 TGTGGGAGGGACTGGGTAGGAGG + Intronic
1006338578 6:33433513-33433535 CTGGGGAGTGACTGGGTGAGGGG - Intronic
1006365217 6:33611197-33611219 CAGGGCAAGGACTGGCTGGGAGG + Intergenic
1006440125 6:34048665-34048687 CAGGGAAGGGACTTGGTGGGAGG + Intronic
1006452563 6:34113585-34113607 TTGGGGTGGGACTCGGAGGGAGG + Intronic
1006513004 6:34531824-34531846 TTGGGCCTGGATTGGGTGTGTGG + Intronic
1006675223 6:35757842-35757864 TGGGGGAGGGACCTGGTGGGAGG + Intergenic
1006937019 6:37725711-37725733 CTTGGCAGGGCATGGGTGGGGGG - Intergenic
1007418654 6:41706509-41706531 TTGGGCAGGATGGGGGTGGGGGG - Intronic
1007702106 6:43771515-43771537 GTGGGCAGGGCCCGCGTGGGCGG - Intronic
1007774697 6:44218564-44218586 TTGCTAAGAGACTGGGTGGGAGG + Intergenic
1007840879 6:44714956-44714978 TTGGGCAAAGGCTGGGTGAGGGG + Intergenic
1007847961 6:44776417-44776439 TAGGACAGGGATTGGTTGGGGGG + Intergenic
1007890718 6:45287591-45287613 TTTGCCAGGGACTGGGAGGATGG + Intronic
1008056136 6:46947862-46947884 CTGAGCAGGGACTGGGTTGTTGG - Intronic
1008320349 6:50104422-50104444 GTGGGCAGGGTGGGGGTGGGAGG + Intergenic
1008699578 6:54082453-54082475 TAGGGGAGGGACCTGGTGGGAGG - Intronic
1008710998 6:54227008-54227030 TGGGGGAGGGACTTGGTGTGAGG + Intronic
1008766204 6:54918653-54918675 TGTGGGAGGGACTTGGTGGGAGG - Intronic
1009527257 6:64763499-64763521 TGGGGAAAGGACTTGGTGGGAGG - Intronic
1009529541 6:64794354-64794376 TTGGTGAGGGGCTTGGTGGGAGG + Intronic
1009608570 6:65906598-65906620 TATGGGAGGGACTCGGTGGGAGG - Intergenic
1009983128 6:70749290-70749312 TTGGGAAGGGACTTGGTGGGAGG - Intronic
1010186180 6:73146008-73146030 TGGGGGAGGGACTGGGTGGGAGG - Intronic
1010530831 6:76965653-76965675 TGGGGGAGGGACCCGGTGGGAGG + Intergenic
1010536486 6:77037443-77037465 TGGGGGAGGGACCTGGTGGGAGG + Intergenic
1010610882 6:77952720-77952742 TGGGGCAGGAACATGGTGGGAGG + Intergenic
1010804006 6:80213600-80213622 TTGGGCAGAGAGTGAGGGGGAGG - Intronic
1011103975 6:83758500-83758522 ATGTGCAGGGACTTGCTGGGAGG - Intergenic
1011240543 6:85267448-85267470 TGTGGGAGGGACTGGGTGGGAGG - Intergenic
1011659571 6:89582640-89582662 GCTGGCAGGGGCTGGGTGGGAGG - Intronic
1011879128 6:92001538-92001560 TTGGGGAGGGACCTGGTGGGAGG + Intergenic
1011933529 6:92743770-92743792 TGGAGCAGGGGCTGGGTGGGAGG + Intergenic
1012191002 6:96279832-96279854 TGGGGGAGGGACCTGGTGGGAGG + Intergenic
1012437251 6:99227350-99227372 TAGGGGAGGGACCTGGTGGGAGG + Intergenic
1013589962 6:111611649-111611671 TGTGGAAGGGACTTGGTGGGAGG - Intergenic
1014297695 6:119640685-119640707 TGGGGAAGGGACCTGGTGGGAGG - Intergenic
1014993695 6:128114703-128114725 TGAGGCAGGGACCTGGTGGGAGG - Intronic
1015674319 6:135727022-135727044 TTTGGGAGGGACCAGGTGGGAGG + Intergenic
1015702837 6:136054964-136054986 TTTGGGAGGGACCTGGTGGGAGG - Intronic
1015906205 6:138119304-138119326 TGGGGGAGGGACCTGGTGGGAGG + Intergenic
1015970738 6:138740707-138740729 TGTGGGAGGGACTCGGTGGGAGG - Intergenic
1016015845 6:139185142-139185164 TTGGGCAGGGAGTGGGATAGTGG + Intergenic
1016494921 6:144650224-144650246 TGTGGGAGGGACTTGGTGGGAGG - Intronic
1016620050 6:146098688-146098710 TGTGGGAGGGACTTGGTGGGAGG + Intronic
1017570893 6:155742870-155742892 GTGGGGAGTGACAGGGTGGGGGG + Intergenic
1018677558 6:166236113-166236135 GTGGGCAGGGGGTGGGGGGGGGG - Intergenic
1018735070 6:166681691-166681713 TTGGGCGGGGGCGGGGGGGGGGG - Intronic
1018788946 6:167131467-167131489 TGGGGCTGGGACCGGATGGGAGG - Intronic
1019002357 6:168764782-168764804 ATGTGGAGGTACTGGGTGGGGGG + Intergenic
1019398057 7:834101-834123 GTGGGCAGGGGCTGGCTGGATGG + Intronic
1019766319 7:2853631-2853653 TGTGGGAGGGACTTGGTGGGAGG + Intergenic
1019994061 7:4711920-4711942 TGGGGCAGGGACTCCGGGGGAGG + Intronic
1020890633 7:13873704-13873726 TTGGGCATGTTGTGGGTGGGGGG - Intergenic
1021260569 7:18451696-18451718 TTCGGCGGGGGTTGGGTGGGGGG + Intronic
1021743453 7:23712322-23712344 TTGGGGAGGAACTGGATTGGGGG - Intronic
1022381159 7:29861187-29861209 ATGGGCAGGGACAGAGTAGGGGG - Intronic
1022539808 7:31125137-31125159 TTTTCCAGGGACTGGGTGGCAGG + Intergenic
1022957484 7:35394554-35394576 TTGCCCAGGGACTAGCTGGGTGG + Intergenic
1023060611 7:36322478-36322500 TGTGGGAGGGACTTGGTGGGAGG + Intergenic
1023188395 7:37554421-37554443 TGGGGGAGGGACCTGGTGGGAGG - Intergenic
1023340796 7:39217322-39217344 GCTGGCAGGGAGTGGGTGGGTGG + Intronic
1023383643 7:39633545-39633567 TGAGGGAGGGACTAGGTGGGAGG - Intronic
1023706907 7:42950537-42950559 TGGGGGAGGGACCTGGTGGGAGG + Intergenic
1023860179 7:44213736-44213758 GTGGGCAGGGGCTGGGCAGGAGG + Exonic
1023986906 7:45102148-45102170 CTGGGCTGGGACTGGGTGTAGGG - Intronic
1023994411 7:45150452-45150474 TTGGAGAGGGACCTGGTGGGTGG + Intergenic
1024242499 7:47446508-47446530 CTGGGCAGAGGCTGGGTGGGAGG - Intronic
1024431839 7:49297579-49297601 GGTGGCAGGGACTGGGTGGAAGG - Intergenic
1024741512 7:52360093-52360115 CAGGGGAGGGACTTGGTGGGAGG - Intergenic
1024866202 7:53907138-53907160 TTGGGCAATGACGGGGTGGCTGG - Intergenic
1025142850 7:56479816-56479838 CTGGGCAGGCACTGTGAGGGAGG + Intergenic
1025258505 7:57400830-57400852 ATGGGCAGGCACTGGGAGGGAGG + Intergenic
1025264967 7:57449372-57449394 CAGGGCAGGCACCGGGTGGGAGG - Intergenic
1025610142 7:63070879-63070901 CTGGGCAGGCACTGGGAGGTAGG - Intergenic
1025709267 7:63891930-63891952 CTGGGCAGGCACTGGGAGGGAGG + Intergenic
1025719593 7:63998090-63998112 CAGGGCAGGGACCGGGTGGGAGG - Intergenic
1025723981 7:64041543-64041565 CTGGGCAGGCACTGGGAAGGAGG - Intronic
1026084720 7:67253706-67253728 TTAGGGAGGGACCTGGTGGGAGG + Intergenic
1026146494 7:67751027-67751049 TGTGGGAGGGACTGGGTGGGAGG - Intergenic
1026272399 7:68848006-68848028 TGGGGGAGGGACCTGGTGGGAGG + Intergenic
1026447521 7:70498560-70498582 GTAGGAAGGGACTAGGTGGGGGG + Intronic
1026544482 7:71309916-71309938 TGTGGGAGGGACTTGGTGGGAGG + Intronic
1026692451 7:72561214-72561236 TTAGGGAGGGACCTGGTGGGAGG - Intronic
1026907099 7:74068931-74068953 GTGGGAAGGGATGGGGTGGGGGG - Intronic
1027695333 7:81403878-81403900 TGGGGGAGGGACATGGTGGGAGG - Intergenic
1027775418 7:82458721-82458743 TGGGGGAGGGGCTTGGTGGGAGG - Intergenic
1027953401 7:84849126-84849148 TGGGGGAGGGACCTGGTGGGAGG + Intergenic
1028433264 7:90772461-90772483 TTGGGGAGGGACCTTGTGGGAGG + Intronic
1029111184 7:98213744-98213766 GGTGGCAGGGGCTGGGTGGGGGG - Intergenic
1029129024 7:98316038-98316060 TTGGGGAGGGACCTGGTGGGAGG + Intronic
1029139555 7:98400593-98400615 ATGGGGAGGGACTGGGAGGAAGG + Intronic
1029443597 7:100601152-100601174 AGGGGCAGGGATGGGGTGGGTGG + Intergenic
1029814050 7:103075436-103075458 GTGGGCGGGGACTGGGCAGGGGG + Intronic
1030381309 7:108814300-108814322 TGGGGGAGGGACCTGGTGGGAGG + Intergenic
1030519708 7:110582734-110582756 TTGGGGAGGGACCTTGTGGGAGG - Intergenic
1030735107 7:113038904-113038926 TAGGGGAGGGACCTGGTGGGAGG + Intergenic
1030741058 7:113110421-113110443 TGGGGGAGGGACTTGGTGGGAGG + Intergenic
1030868631 7:114730363-114730385 TTTGGGAGGGACCTGGTGGGAGG + Intergenic
1031192465 7:118571413-118571435 TTGGAATGGGACTTGGTGGGAGG - Intergenic
1032002199 7:128272421-128272443 TTGGAGAGGGTCAGGGTGGGAGG + Intergenic
1032264471 7:130361458-130361480 TTGGTCAGGAAGTAGGTGGGAGG + Intronic
1032326797 7:130936499-130936521 GTGGGGAGGGCCTGGGTGAGGGG - Intergenic
1032346170 7:131118855-131118877 TAGGGCAGGGACCTGGTGGGAGG - Intronic
1032423447 7:131801573-131801595 TGGGGGAGGGACCTGGTGGGAGG + Intergenic
1032740578 7:134734581-134734603 TTGTGGAGGGACCCGGTGGGAGG + Intergenic
1032799011 7:135303207-135303229 TGGGGCAGGGGCTGGGGTGGGGG + Intergenic
1033221402 7:139528611-139528633 CATGGGAGGGACTGGGTGGGAGG - Intronic
1033403225 7:141046996-141047018 TGGGGTAGGGACCTGGTGGGAGG + Intergenic
1033832931 7:145275378-145275400 TGTGGGAGGGACTTGGTGGGAGG + Intergenic
1033905580 7:146198094-146198116 GTAGGGAGGGACTTGGTGGGAGG - Intronic
1033985069 7:147215071-147215093 TGAGGCAGGGACTTGGTGGGAGG - Intronic
1034050293 7:147976967-147976989 TTTGGGAGTGAATGGGTGGGAGG - Intronic
1034210781 7:149360203-149360225 TGGGGCAGTGGGTGGGTGGGTGG - Intergenic
1034253685 7:149713445-149713467 TTTTGCATGGACTGGGAGGGGGG - Intergenic
1034421335 7:150992615-150992637 TTGGGGTGGGCCTGGGTGGGGGG - Intronic
1034606222 7:152318432-152318454 ATGGGGAGGGGGTGGGTGGGTGG - Intronic
1034685994 7:152972047-152972069 TTGGGATGGGACTGGGTGTGAGG + Intergenic
1034839066 7:154378962-154378984 TGAGGGAGGGACTTGGTGGGAGG - Intronic
1034904951 7:154935743-154935765 TGGGGCAGGGACTTGGTGGGAGG - Intronic
1035055140 7:156030198-156030220 CAGGGCAGGGGTTGGGTGGGTGG + Intergenic
1035097821 7:156369955-156369977 TGTGGCAGGGACCTGGTGGGAGG + Intergenic
1035165308 7:156985836-156985858 CTGGGCCTGGACTGGCTGGGTGG - Intergenic
1035165455 7:156986915-156986937 TTGTGCAGTGAATGTGTGGGTGG + Intergenic
1035365381 7:158345976-158345998 TTGGGGAGGGACCTGGTGGGAGG - Intronic
1035579432 8:730988-731010 ATGGGTAGGGACTGGGGTGGAGG + Intronic
1035910726 8:3563051-3563073 TTGGTCATGATCTGGGTGGGAGG + Intronic
1036800862 8:11789852-11789874 GTGGGAAGGGACCGGGTGGGAGG + Intergenic
1037139849 8:15506733-15506755 TGTGGGAGGGACTTGGTGGGAGG - Intronic
1037244377 8:16815371-16815393 TTGGGGAGGGACCTGTTGGGAGG - Intergenic
1037597877 8:20369561-20369583 ATGGGCAAAGACTGGGTGGGAGG - Intergenic
1037890700 8:22622485-22622507 TTGGGCAGGGAGTGGGGGCAGGG - Intronic
1037894362 8:22641920-22641942 GTGGGAGGGGACTGGGTGGAAGG + Intronic
1038384115 8:27125051-27125073 TTGTGGAGGGACCCGGTGGGAGG - Intergenic
1038388864 8:27175934-27175956 TTTGGGAGGGACCTGGTGGGAGG + Intergenic
1038677209 8:29634122-29634144 TGGAGCAGGGGCTTGGTGGGAGG - Intergenic
1038687902 8:29735301-29735323 TTGGGGAGGGAGAGGGAGGGAGG - Intergenic
1038772009 8:30491440-30491462 TTGGGCACACACAGGGTGGGAGG + Intronic
1039018826 8:33183054-33183076 TGTGGGAGGGACTTGGTGGGAGG + Intergenic
1039470938 8:37813606-37813628 TTAGGCAGGGACTGGACGGGTGG + Intronic
1039546518 8:38414686-38414708 GTGGGAAGGGACTGGGGGGTGGG + Intronic
1039913529 8:41843397-41843419 GTGGGCGGGGAGTGGGTGGGGGG - Intronic
1039921731 8:41897699-41897721 ATGGAGAGGGAGTGGGTGGGCGG - Intergenic
1039971473 8:42324789-42324811 TGGGGCAGGGCCTGGCTGGGAGG + Intronic
1040010648 8:42658480-42658502 TTTTCCAGGGACTGGGTTGGGGG + Intergenic
1040349137 8:46545692-46545714 TGTGGGAGGGACTTGGTGGGAGG - Intergenic
1041656215 8:60352968-60352990 GTGTGCCGGGACTGGGTGAGAGG - Intergenic
1041662042 8:60410401-60410423 CGGGGGAGGGACCGGGTGGGAGG - Intergenic
1041940330 8:63380697-63380719 TTGGGGAGGGAACAGGTGGGAGG + Intergenic
1042104182 8:65307211-65307233 TGGGGGAGGGACTGGGTGGGAGG - Intergenic
1042108585 8:65355527-65355549 TTGGGCAGGGGGTGGGTAGCTGG + Intergenic
1042851218 8:73217862-73217884 TGGGGGAGGGACTTGGTGGGAGG + Intergenic
1042896875 8:73680119-73680141 CTGGGCAGAATCTGGGTGGGGGG + Intronic
1043329631 8:79099211-79099233 ATGGGAAGTGACTGGGTGTGGGG + Intergenic
1044043678 8:87402234-87402256 TTTGGGAGGGACCCGGTGGGAGG - Intronic
1044127147 8:88472685-88472707 TGGGGAAGGGACCTGGTGGGAGG - Intergenic
1044350566 8:91160486-91160508 TGGGGGAGGGACCTGGTGGGAGG + Intronic
1045090217 8:98734169-98734191 TCGGGGAGGGACCTGGTGGGAGG - Intronic
1045286111 8:100793094-100793116 TTTGGCAGGTATTGGGTAGGAGG - Intergenic
1045494896 8:102699963-102699985 TGGGGCAGGCCCTGTGTGGGTGG + Intergenic
1045643625 8:104279384-104279406 TAGGGGAGGGACCTGGTGGGAGG - Intergenic
1046442123 8:114270840-114270862 TGTGGGAGGGAGTGGGTGGGAGG - Intergenic
1046614671 8:116463240-116463262 TGGGGCAGGGAGTGGATGGTGGG - Intergenic
1047754778 8:127910016-127910038 TGGGGCAGAGGCTGGGTGTGTGG + Intergenic
1047860279 8:128958259-128958281 GAGGGCAGGGATTGGGTTGGGGG + Intergenic
1048051955 8:130826767-130826789 TTGGGGTGGGATGGGGTGGGAGG + Intronic
1048309337 8:133306569-133306591 CTGGGCAGGGACTTGCTGGGAGG - Intergenic
1048313827 8:133347512-133347534 TGGGGCAGGGACCTGGTGGGAGG + Intergenic
1048719267 8:137304400-137304422 TGTGGGAGGGACTTGGTGGGAGG + Intergenic
1049196889 8:141320650-141320672 AGGTGCAGGGACTGGGTGGGTGG + Intergenic
1049345696 8:142137497-142137519 CGTGGGAGGGACTGGGTGGGAGG - Intergenic
1049355023 8:142183303-142183325 CTGGACAGGGTCTGGGAGGGTGG - Intergenic
1049444106 8:142622237-142622259 TAGGGCTGGGGCTGGGCGGGGGG - Intergenic
1049447225 8:142636809-142636831 TTAGGCAGGGACAGTGTGGAGGG + Intergenic
1049464617 8:142745079-142745101 ATGGGCAGAGGATGGGTGGGTGG + Intergenic
1049522342 8:143099942-143099964 TGTGGGAGGGACTTGGTGGGAGG - Intergenic
1049684518 8:143933964-143933986 TGGGGCAGGCAGTGGGCGGGAGG - Intronic
1049724690 8:144140281-144140303 TTGGGCAGGGACTAGGCTGCAGG - Exonic
1049983972 9:931022-931044 TTTGGCAGGGGCTGGGAGGGAGG - Intronic
1050435616 9:5606646-5606668 CTTGGGAGGGACTCGGTGGGAGG + Intergenic
1050526858 9:6553790-6553812 TGGGGCTGGGAGTGGGAGGGAGG - Intronic
1050670289 9:7989218-7989240 TGGGGGAGGGACATGGTGGGAGG - Intergenic
1051001522 9:12288296-12288318 TTGGGGAGGGACTTGGTGGAAGG + Intergenic
1051082450 9:13309085-13309107 TTGGAGAGGGACCTGGTGGGAGG - Intergenic
1051243989 9:15090762-15090784 TTGGGCAGTGACTTGGTTGCTGG - Intergenic
1051872474 9:21754563-21754585 TTGGGGAGGGACCTGGTGGGAGG - Intergenic
1051998316 9:23247000-23247022 TGGGGGAGGGACTTGATGGGAGG + Intergenic
1052002450 9:23302250-23302272 TTGGGGAGGGACCTGGTAGGAGG - Intergenic
1052018947 9:23503032-23503054 TTGGGGAGGGACCTGGTGGGAGG - Intergenic
1052366759 9:27620594-27620616 GTGGGCAGGCACTGGGTGAATGG - Intergenic
1052883256 9:33618662-33618684 TGGGGCAGGGGATGGGTAGGGGG + Intergenic
1052912676 9:33897725-33897747 TTGGGCAGTGAATGCGTGGGAGG - Intronic
1053108454 9:35435376-35435398 TTGGGGAGGGACCTGGTAGGAGG - Intergenic
1053493278 9:38527454-38527476 CTGGGGCGGGACTGGCTGGGAGG + Intergenic
1054898123 9:70337099-70337121 TGTGGCAGGGACCTGGTGGGAGG - Intronic
1054902746 9:70387429-70387451 GAGGGTAGGGAGTGGGTGGGGGG - Exonic
1054996616 9:71398454-71398476 TGGGGGAGGGACCTGGTGGGAGG + Intronic
1055155826 9:73061742-73061764 CAGGGTAGGGAGTGGGTGGGGGG - Intronic
1055180634 9:73381681-73381703 TGAGGGAGGGTCTGGGTGGGAGG - Intergenic
1055282640 9:74692181-74692203 TTGGGGAGAGACTGAGAGGGAGG + Exonic
1055555654 9:77470955-77470977 TTGGGGAGGGACCTGGTGGGAGG - Intronic
1057015505 9:91647481-91647503 TTGTGCAGGGGCTGGGGCGGGGG - Intronic
1057311692 9:93947339-93947361 TTGGGGCGGGGCGGGGTGGGGGG - Intergenic
1057483678 9:95465205-95465227 TTAGGCAGGGATTGGGAAGGGGG - Intronic
1057673967 9:97122032-97122054 CTGGGGCGGGACTGGCTGGGAGG + Intergenic
1057907540 9:98994136-98994158 TTGGGGAGGCACTGTGTTGGGGG + Intronic
1057913816 9:99040434-99040456 TTTGGAAGGGGCTGGGAGGGAGG + Intronic
1058039390 9:100287548-100287570 TCGGGGAGGGACTTGGTGGGAGG + Intronic
1058188616 9:101886354-101886376 TTGGGCAGGCACATGGTTGGTGG + Intergenic
1058472549 9:105295749-105295771 TGGGGCGGGGAGTGGGGGGGAGG + Intronic
1058722223 9:107774423-107774445 TGGGGGAGGGACCTGGTGGGAGG - Intergenic
1059355507 9:113696424-113696446 TGGAGGAGGGGCTGGGTGGGAGG + Intergenic
1059385788 9:113963163-113963185 CTGGGCAGGTCCTGGGTTGGTGG + Intronic
1059404304 9:114090490-114090512 TGGGGGAGGGACCTGGTGGGAGG + Intronic
1060007871 9:120016404-120016426 TGAGGGAGGGGCTGGGTGGGAGG - Intergenic
1060327653 9:122633094-122633116 TCAGGGAGGGACTTGGTGGGAGG - Intergenic
1060469568 9:123936895-123936917 TGTGGCAGGGACCTGGTGGGAGG - Intergenic
1060537691 9:124404218-124404240 GTGGGCAGGGGCTGGGGTGGAGG - Intronic
1060726314 9:126008199-126008221 TGGGGGAGGGACTTGGTAGGAGG + Intergenic
1061065612 9:128275848-128275870 TGGGGCTGGGGCTGGGTCGGGGG + Intronic
1061395728 9:130342449-130342471 CTGGGGAGGGACTGGGGAGGTGG + Intronic
1061497509 9:130983386-130983408 TTTGGAAGGCCCTGGGTGGGGGG + Intergenic
1061571838 9:131482586-131482608 GTGGCCAGGGCCTGGGTGGAAGG + Intronic
1061891666 9:133624751-133624773 TAGGGGAGGGACCTGGTGGGAGG - Intergenic
1061921195 9:133783462-133783484 GTGGCCAGGGACTGGGGTGGGGG + Intronic
1062006749 9:134242284-134242306 TCTGGCCGGGACTGGGAGGGTGG - Intergenic
1062032320 9:134367304-134367326 CTGGGCAGGGACTGAGTCTGCGG + Intronic
1062194186 9:135264008-135264030 GAGGGCAGGGAGTGGGGGGGAGG - Intergenic
1062243106 9:135550209-135550231 TTGGGAAGCCACTGGGAGGGCGG + Intergenic
1062259649 9:135655101-135655123 TTGGGTAGGGAAGGGGTGGGGGG + Intergenic
1062372086 9:136245336-136245358 TGGGGCAGGGACTGGCTCTGCGG + Intronic
1062431415 9:136528378-136528400 ATGGGCAGGGACAGTGGGGGGGG + Intronic
1062431424 9:136528401-136528423 ATGGGCAGGGACAGTGCGGGGGG + Intronic
1062431435 9:136528425-136528447 ATGGGCAGGGACGGTGAGGGGGG + Intronic
1062565435 9:137162089-137162111 GTGGGCAGGGGCCGGGTGGCGGG + Intronic
1062622365 9:137428725-137428747 TGGGGGAGAGGCTGGGTGGGGGG + Intronic
1062665431 9:137668626-137668648 GTTGCCAGGGACTGGGTTGGGGG - Intronic
1062699560 9:137891868-137891890 GAGGGCAGGGACTGGGTGGGGGG - Intronic
1203746174 Un_GL000218v1:41687-41709 TGGGGCAGGGCCTTGGTGTGTGG + Intergenic
1203563928 Un_KI270744v1:77794-77816 TGGGGCAGGGCCTTGGTGTGTGG - Intergenic
1185597169 X:1314294-1314316 TTGGGCAGGCACAGAGTGGTTGG - Intergenic
1185597188 X:1314370-1314392 TTGGGCAGGCACAGAGTGGTTGG - Intergenic
1185852197 X:3499588-3499610 TTGGGGAGGGACCTGGTGGGGGG + Intergenic
1186241865 X:7576972-7576994 TTGGGGAGGGACCCAGTGGGAGG + Intergenic
1186310363 X:8311073-8311095 TGTGGGAGGGACTTGGTGGGAGG + Intergenic
1186320256 X:8416459-8416481 TTTGGGAAGGACAGGGTGGGAGG + Intergenic
1187299101 X:18030712-18030734 TGGGGGAGGGACCTGGTGGGAGG + Intergenic
1187483136 X:19676350-19676372 CTGGGTGGGGGCTGGGTGGGAGG + Intronic
1187522985 X:20029681-20029703 TTGGGCAGGGGCTGGGGTCGGGG - Intronic
1187575774 X:20553084-20553106 TTTGCCAGGGGCTGGGTGTGGGG - Intergenic
1187639802 X:21275360-21275382 TGGGGGAGGGACCTGGTGGGAGG - Intergenic
1187944441 X:24412594-24412616 TTGGGCAGGTACAGGGAGGTGGG - Intergenic
1188103929 X:26125377-26125399 TTGGGGAGGAACCTGGTGGGAGG - Intergenic
1188879638 X:35476057-35476079 TGGGGGAGGGACCTGGTGGGAGG - Intergenic
1188887916 X:35572954-35572976 TGGGGAAGGGACCTGGTGGGAGG + Intergenic
1188972023 X:36629592-36629614 TGGGGGAGGGACCTGGTGGGAGG + Intergenic
1188979230 X:36712241-36712263 TTTGGCAGGGAGTGTATGGGTGG + Intergenic
1189869535 X:45367875-45367897 TTGGGGAGGTACCTGGTGGGAGG + Intergenic
1190270804 X:48861885-48861907 TTTGGGAGGGACCTGGTGGGAGG - Intergenic
1190281628 X:48934912-48934934 TGGGGAAGGGGCAGGGTGGGAGG - Intronic
1190372876 X:49759692-49759714 TTGGGGAGGGACCTGGTGGGAGG - Intergenic
1190486068 X:50926583-50926605 TGGGGGAGGGACCTGGTGGGAGG - Intergenic
1190632955 X:52406240-52406262 TTGGAGAGGGACCTGGTGGGAGG - Intergenic
1190718290 X:53123627-53123649 TTGGGATGGGACTGGGTGCAGGG - Intergenic
1190741501 X:53291837-53291859 TGGGGCAGGGCCTGGGGTGGGGG - Intronic
1190953088 X:55165080-55165102 TGTGGAAGGGACTCGGTGGGAGG + Intronic
1191089718 X:56607503-56607525 TGGGGGAGGAACTTGGTGGGAGG - Intergenic
1191109717 X:56794900-56794922 TTGTGATGGGACTGGATGGGAGG + Intergenic
1192182543 X:68925304-68925326 GTTGGCAGGGTCAGGGTGGGTGG - Intergenic
1192206392 X:69099558-69099580 TTGGGCTGGATCTGGGAGGGTGG + Intergenic
1192468790 X:71378528-71378550 TTGGGGAGATACTGGGTGGTAGG + Intronic
1192680316 X:73247065-73247087 TTTGGGAGGGACCCGGTGGGAGG + Intergenic
1192723712 X:73726208-73726230 TTAGGGAGGGACTTGGTGGGAGG - Intergenic
1193542314 X:82787518-82787540 TGTGGGAGGGACTGGGTGGGAGG + Intergenic
1193882946 X:86947779-86947801 TGGGGGAGGGACCTGGTGGGAGG - Intergenic
1193929898 X:87541091-87541113 TGAGGGAGGGACTTGGTGGGAGG + Intronic
1194944295 X:100049287-100049309 TTGGGGAAGGACCTGGTGGGAGG + Intergenic
1195141325 X:101963463-101963485 TGGGGGAGGGACCTGGTGGGAGG - Intergenic
1195319087 X:103706806-103706828 ATGGCCAGGCTCTGGGTGGGAGG + Intergenic
1195456126 X:105072067-105072089 CAAGGGAGGGACTGGGTGGGAGG + Intronic
1195693694 X:107650533-107650555 TTGAGCAGACATTGGGTGGGGGG + Exonic
1195700402 X:107701267-107701289 TGGGACTGGAACTGGGTGGGAGG - Intergenic
1196770799 X:119291388-119291410 TGGGGGAGGGACCTGGTGGGAGG + Intergenic
1196947389 X:120841324-120841346 TTTGGTAGGGAGTGGGAGGGGGG + Intergenic
1197595229 X:128456099-128456121 TGGGGGAGGGACCTGGTGGGAGG - Intergenic
1197654866 X:129106093-129106115 CGGGGTAGGGATTGGGTGGGAGG - Intergenic
1197892237 X:131279048-131279070 TTGGCCAGGGAGTGGCTGGTTGG - Intronic
1198370030 X:135981387-135981409 TGGGGGAGGGACCTGGTGGGAGG - Intergenic
1198370726 X:135986084-135986106 GTAGGCAGGGAAAGGGTGGGGGG - Intronic
1198379961 X:136074584-136074606 TGTGGGAGGGACTTGGTGGGAGG + Intergenic
1198792075 X:140356630-140356652 TGGGGCAGGGAATTGGGGGGAGG + Intergenic
1198967010 X:142237783-142237805 TGTGGGAGGGACTTGGTGGGAGG + Intergenic
1199139330 X:144290733-144290755 TTGGGGAGGGGCCCGGTGGGAGG + Intergenic
1199272789 X:145904698-145904720 TTGGGGAGAGACCTGGTGGGAGG + Intergenic
1199397541 X:147357085-147357107 TGTAGGAGGGACTGGGTGGGAGG + Intergenic
1199435662 X:147809927-147809949 TGGGGGAGGGACCTGGTGGGAGG + Intergenic
1200106970 X:153719627-153719649 TTCTGCTGGGACTCGGTGGGAGG + Intronic
1200353582 X:155525179-155525201 TGGGGGAGGGACCTGGTGGGAGG + Intronic
1200353890 X:155527193-155527215 TGGGGGAGGGACCTGGTGGGAGG + Intronic
1200679521 Y:6194008-6194030 TTGTGGAGGGACCCGGTGGGAGG - Intergenic
1201159501 Y:11156700-11156722 TGGGGCAGGGTCTTGGTGTGTGG + Intergenic
1201722853 Y:17120572-17120594 TGGGGGAGGGACCTGGTGGGAGG + Intergenic