ID: 1104982266

View in Genome Browser
Species Human (GRCh38)
Location 12:132578731-132578753
Sequence CACTCTCCCCTCACCGTGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 95}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104982259_1104982266 -6 Left 1104982259 12:132578714-132578736 CCGCTGCAGCCCCCCCTCACTCT 0: 1
1: 1
2: 14
3: 96
4: 778
Right 1104982266 12:132578731-132578753 CACTCTCCCCTCACCGTGTTTGG 0: 1
1: 0
2: 0
3: 5
4: 95
1104982254_1104982266 2 Left 1104982254 12:132578706-132578728 CCCAACCCCCGCTGCAGCCCCCC 0: 1
1: 0
2: 4
3: 54
4: 555
Right 1104982266 12:132578731-132578753 CACTCTCCCCTCACCGTGTTTGG 0: 1
1: 0
2: 0
3: 5
4: 95
1104982250_1104982266 22 Left 1104982250 12:132578686-132578708 CCTGTCCCTTCCTCAGAGCTCCC 0: 1
1: 0
2: 3
3: 42
4: 557
Right 1104982266 12:132578731-132578753 CACTCTCCCCTCACCGTGTTTGG 0: 1
1: 0
2: 0
3: 5
4: 95
1104982257_1104982266 -4 Left 1104982257 12:132578712-132578734 CCCCGCTGCAGCCCCCCCTCACT 0: 1
1: 1
2: 2
3: 25
4: 400
Right 1104982266 12:132578731-132578753 CACTCTCCCCTCACCGTGTTTGG 0: 1
1: 0
2: 0
3: 5
4: 95
1104982256_1104982266 -3 Left 1104982256 12:132578711-132578733 CCCCCGCTGCAGCCCCCCCTCAC 0: 1
1: 0
2: 3
3: 45
4: 543
Right 1104982266 12:132578731-132578753 CACTCTCCCCTCACCGTGTTTGG 0: 1
1: 0
2: 0
3: 5
4: 95
1104982258_1104982266 -5 Left 1104982258 12:132578713-132578735 CCCGCTGCAGCCCCCCCTCACTC 0: 1
1: 1
2: 1
3: 58
4: 594
Right 1104982266 12:132578731-132578753 CACTCTCCCCTCACCGTGTTTGG 0: 1
1: 0
2: 0
3: 5
4: 95
1104982249_1104982266 30 Left 1104982249 12:132578678-132578700 CCTTGAGGCCTGTCCCTTCCTCA 0: 1
1: 1
2: 3
3: 26
4: 368
Right 1104982266 12:132578731-132578753 CACTCTCCCCTCACCGTGTTTGG 0: 1
1: 0
2: 0
3: 5
4: 95
1104982253_1104982266 12 Left 1104982253 12:132578696-132578718 CCTCAGAGCTCCCAACCCCCGCT 0: 1
1: 0
2: 0
3: 35
4: 270
Right 1104982266 12:132578731-132578753 CACTCTCCCCTCACCGTGTTTGG 0: 1
1: 0
2: 0
3: 5
4: 95
1104982251_1104982266 17 Left 1104982251 12:132578691-132578713 CCCTTCCTCAGAGCTCCCAACCC 0: 1
1: 0
2: 2
3: 43
4: 412
Right 1104982266 12:132578731-132578753 CACTCTCCCCTCACCGTGTTTGG 0: 1
1: 0
2: 0
3: 5
4: 95
1104982255_1104982266 1 Left 1104982255 12:132578707-132578729 CCAACCCCCGCTGCAGCCCCCCC 0: 1
1: 0
2: 3
3: 121
4: 954
Right 1104982266 12:132578731-132578753 CACTCTCCCCTCACCGTGTTTGG 0: 1
1: 0
2: 0
3: 5
4: 95
1104982252_1104982266 16 Left 1104982252 12:132578692-132578714 CCTTCCTCAGAGCTCCCAACCCC 0: 1
1: 0
2: 2
3: 60
4: 551
Right 1104982266 12:132578731-132578753 CACTCTCCCCTCACCGTGTTTGG 0: 1
1: 0
2: 0
3: 5
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104982266 Original CRISPR CACTCTCCCCTCACCGTGTT TGG Intronic
900380073 1:2379530-2379552 CACCTGCCCCTCACCATGTTTGG - Intronic
900504231 1:3021362-3021384 CTCTCTCACCTCACCCTGTGGGG + Intergenic
905563546 1:38945603-38945625 CACTCTCCCATCACTCTGTGTGG - Intergenic
908473322 1:64465841-64465863 CACTCTCCCCTGTCTGTGATTGG + Intergenic
911288396 1:96026454-96026476 CACTCTCACAACACAGTGTTAGG + Intergenic
913332774 1:117681302-117681324 CTCTCTCCCCTTCCCGTCTTAGG - Intergenic
914675542 1:149904895-149904917 CACTCCCCACTCCCCGTGTTTGG - Exonic
923336077 1:232971309-232971331 CACTCTCCACTCCCCCTGATAGG - Intronic
1064991987 10:21264290-21264312 CACTGTCCCAGCACCGTGGTAGG - Intergenic
1067139054 10:43640485-43640507 CCCTCTCCCCTCCCTGTGGTAGG - Intergenic
1075688332 10:124379140-124379162 CACTCCCCCCTCACCGTTCTTGG - Intergenic
1077009669 11:374569-374591 CACTCTACCCCCACCAAGTTGGG - Intronic
1077808301 11:5611155-5611177 CAGTGCCCCCTCGCCGTGTTGGG + Exonic
1080386320 11:31813072-31813094 CCCTCTCCCCTCCCCGGGCTGGG + Intronic
1083737242 11:64688409-64688431 CTCTCTCTCCTCACCATCTTCGG - Intronic
1084166297 11:67376239-67376261 CCCTCTCCCCTCACCTAGTGGGG + Intronic
1084372943 11:68756563-68756585 CACTCTCTCCTCACCACGGTGGG + Exonic
1088198699 11:107305924-107305946 TTCTCTCCCCTCACCATGTGAGG + Intergenic
1090270260 11:125380969-125380991 GACTCTCCCATAACTGTGTTGGG + Intronic
1090353650 11:126124301-126124323 CTCTCTCCCCTCTCCGTCCTCGG - Intergenic
1090986967 11:131776357-131776379 TGCTCTTCCCTCACTGTGTTTGG - Intronic
1097677892 12:62622678-62622700 CACTCTCCCATCTCAGGGTTAGG - Intergenic
1100399951 12:94220801-94220823 AACTCTACCCTCACCTTGTCTGG - Intronic
1102497658 12:113330508-113330530 CACTCCCACCTCACGGGGTTTGG + Intronic
1102514104 12:113435171-113435193 TCCTCTCCCCTCACCGTGGATGG + Intronic
1102547204 12:113665763-113665785 CTCTCTCCCCTGACCTTGATGGG + Intergenic
1104982266 12:132578731-132578753 CACTCTCCCCTCACCGTGTTTGG + Intronic
1106565162 13:30878378-30878400 CACTCTAGCCTCAACCTGTTGGG + Intergenic
1109033411 13:57223457-57223479 CCCTCACCCCTCACCCTTTTTGG - Intergenic
1113795021 13:113051793-113051815 CACTCTCCCCTCGCCAGGTGAGG - Intronic
1129152923 15:73700282-73700304 GACTCTCCCCACACGGTGCTTGG + Intronic
1131494930 15:92900120-92900142 CCCTCCCCCCTCCCCCTGTTGGG + Exonic
1133568119 16:7014489-7014511 CACTCTCCTCCCACAGTGCTAGG + Intronic
1137758353 16:50920231-50920253 TCCTCTTCCCTCACTGTGTTAGG - Intergenic
1141742644 16:85904248-85904270 CACTCTCCCCTCCCCATCTCTGG - Intronic
1141791896 16:86242739-86242761 CACTCTCCCCTCTTCGTCGTGGG + Intergenic
1142482277 17:226414-226436 CCCTCTCTGCTCACTGTGTTGGG + Intronic
1148065825 17:44869040-44869062 GACTGTCCCCTCACCTTGTATGG + Intronic
1148441532 17:47714037-47714059 CACACACCCCTCCCCTTGTTAGG - Intergenic
1148864149 17:50619849-50619871 CCCTCTCCCCTGACCGTGCTGGG + Intronic
1149201872 17:54196133-54196155 CACTCTCTCCTCACCCTGCTTGG + Intergenic
1153789557 18:8565249-8565271 AACTCTCCCCTCACAAGGTTTGG - Intergenic
1157519130 18:48333334-48333356 CACTCTTTCCTCACCGAGTCTGG - Intronic
1158598750 18:58839031-58839053 CACTCTCCCCTGGCCCTGTGTGG - Intergenic
1163845892 19:19637877-19637899 CATCCTCCCCTCACCCCGTTGGG - Intronic
1166790474 19:45396026-45396048 CGCTCTCCCTTCACTGTGCTGGG - Intronic
1167040195 19:47019409-47019431 CACTCTCCCCCCACAGGGCTGGG - Intergenic
1167636781 19:50659980-50660002 CCCCCTCCCCTCACCATGTCAGG - Intronic
1168561698 19:57389981-57390003 CACTCCCGCCTCTCCGTGGTGGG - Exonic
926089850 2:10043135-10043157 CCCTCTCCCCGCACCGAGTCCGG + Intronic
926245643 2:11120903-11120925 CACACTTCCCACATCGTGTTTGG + Intergenic
928245883 2:29626639-29626661 CACTCTCCCCTCCCCATGTGAGG + Intronic
934639661 2:96020110-96020132 CGCTGTCCCCTCACTGTGTGTGG - Intergenic
934793985 2:97085267-97085289 CGCTGTCCCCTCACTGTGTGTGG + Intronic
940398832 2:153222963-153222985 CACACCCCCCTCACCGAGTCAGG - Intergenic
941434154 2:165447672-165447694 CAATCACCCCTCAAGGTGTTGGG + Intergenic
942993523 2:182232187-182232209 CACTCTCCTCTCTCTCTGTTAGG - Intronic
945691337 2:213040643-213040665 CACTATCCCCTCAGAGTATTAGG + Intronic
948859615 2:240746513-240746535 CTCTCTCCCCTCCCCTTCTTGGG + Intronic
1168876697 20:1176871-1176893 CCTTCTCCCCTAACCTTGTTGGG - Intronic
1170325960 20:15154646-15154668 CACTCTCTTCTCACCTTGTGAGG - Intronic
1172297664 20:33824832-33824854 CACCCTCCCCCCACCCTTTTGGG - Intronic
1175659547 20:60800698-60800720 CCCTCTCACCTGACAGTGTTAGG - Intergenic
1176422718 21:6528974-6528996 CTCTCTCTCCTCACCGTCTGAGG - Intergenic
1177720559 21:24901546-24901568 CTCCCTCCTCTCACCATGTTAGG + Intergenic
1179698211 21:43137290-43137312 CTCTCTCTCCTCACCGTCTGAGG - Intergenic
1179818271 21:43921903-43921925 CACTCACCCCACACCTTGGTGGG - Intronic
1179842740 21:44087823-44087845 CACTCTCCCCTCCGAGTGCTGGG - Exonic
1182636373 22:31730528-31730550 CACTGTCCTATCACGGTGTTAGG + Intronic
950042380 3:9928506-9928528 CACTCTCCCCTCACCACGGGAGG - Intronic
950318267 3:12025101-12025123 CTCTCTCCCTTCACCATGTAGGG - Intronic
950892659 3:16418033-16418055 CACTCTGCTCTCACAGTGGTGGG + Intronic
951083386 3:18479638-18479660 CAGTGTCCCCTCTCCCTGTTGGG + Intergenic
953060128 3:39420623-39420645 CACTCTCCCCTCTCCATGGCTGG + Intergenic
954859765 3:53677516-53677538 CCCACTCCCCTCACTGGGTTAGG + Intronic
958962113 3:100520774-100520796 CACTCTCCTTTCACTATGTTGGG - Intronic
961683153 3:128612161-128612183 CACTCTCCCCTCTGCCTCTTGGG - Intergenic
969059244 4:4422005-4422027 CATTCTGCCCTGACCCTGTTAGG - Intronic
970483307 4:16499578-16499600 CACCCTCACCTCACCATTTTAGG - Intergenic
971587134 4:28418400-28418422 CACCCTCCCCTCACCCCCTTGGG - Intergenic
972660444 4:41110829-41110851 CAACCTCCCCTCACCCTATTGGG - Intronic
979778508 4:124620197-124620219 CAATTTCCCCTCAGGGTGTTTGG + Intergenic
984296724 4:177862566-177862588 CACCCTCCGCTCACCACGTTGGG + Intronic
992777970 5:80104845-80104867 TACTCTCCCTTCTCCCTGTTTGG - Intergenic
994041498 5:95264612-95264634 CACTCTCAGCCCACAGTGTTTGG + Intronic
996428816 5:123347363-123347385 CACTATCCCCAAAACGTGTTTGG - Intronic
1002278962 5:178119933-178119955 CACCCTCCCCACACCTTGTAAGG - Intronic
1006471947 6:34234803-34234825 CCCTCTCCCCTCCCCGTCTCAGG + Intergenic
1016990807 6:149926316-149926338 CCCTCCACCCTCACTGTGTTTGG + Intergenic
1017007539 6:150038457-150038479 CCCTCCACCCTCACTGTGTTTGG + Intergenic
1022467132 7:30659483-30659505 CACTCACCCCTCAGTGTGTATGG - Intronic
1028900891 7:96099623-96099645 CTCTCTCTCCTCACCATGTGAGG - Intronic
1031230804 7:119103401-119103423 CACTCATCCCTCTCCCTGTTGGG + Intergenic
1052269805 9:26615709-26615731 AAATCTCCCCTCCCAGTGTTGGG + Intergenic
1057392868 9:94653887-94653909 CACTCTGCCCTCTCTGTGTGGGG - Intergenic
1061972840 9:134054094-134054116 CCACCTCCCCGCACCGTGTTTGG - Intronic
1190944386 X:55076669-55076691 CACTCTCCCTTCACCTTGAACGG - Exonic
1194035895 X:88871524-88871546 CAGTTTCACCTCACCATGTTTGG - Intergenic
1196666071 X:118318078-118318100 CTCTCTCCCCGCATCGTGTGAGG + Intergenic
1196846348 X:119899488-119899510 TTCTCTCCCCTCAACGTTTTAGG - Intronic
1199535992 X:148903879-148903901 CACTCTAATCTTACCGTGTTTGG - Intronic