ID: 1104983383

View in Genome Browser
Species Human (GRCh38)
Location 12:132583608-132583630
Sequence CCGCCCGCCGCCGCCGCCCT CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1069
Summary {0: 1, 1: 1, 2: 19, 3: 132, 4: 916}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104983374_1104983383 13 Left 1104983374 12:132583572-132583594 CCCGCCGCGCTGCACAATGGGCT 0: 1
1: 0
2: 0
3: 7
4: 76
Right 1104983383 12:132583608-132583630 CCGCCCGCCGCCGCCGCCCTCGG 0: 1
1: 1
2: 19
3: 132
4: 916
1104983370_1104983383 25 Left 1104983370 12:132583560-132583582 CCGCGCCTCTCGCCCGCCGCGCT 0: 1
1: 0
2: 5
3: 30
4: 297
Right 1104983383 12:132583608-132583630 CCGCCCGCCGCCGCCGCCCTCGG 0: 1
1: 1
2: 19
3: 132
4: 916
1104983369_1104983383 26 Left 1104983369 12:132583559-132583581 CCCGCGCCTCTCGCCCGCCGCGC 0: 1
1: 0
2: 12
3: 64
4: 412
Right 1104983383 12:132583608-132583630 CCGCCCGCCGCCGCCGCCCTCGG 0: 1
1: 1
2: 19
3: 132
4: 916
1104983375_1104983383 12 Left 1104983375 12:132583573-132583595 CCGCCGCGCTGCACAATGGGCTC 0: 1
1: 0
2: 0
3: 6
4: 55
Right 1104983383 12:132583608-132583630 CCGCCCGCCGCCGCCGCCCTCGG 0: 1
1: 1
2: 19
3: 132
4: 916
1104983371_1104983383 20 Left 1104983371 12:132583565-132583587 CCTCTCGCCCGCCGCGCTGCACA 0: 1
1: 0
2: 0
3: 12
4: 108
Right 1104983383 12:132583608-132583630 CCGCCCGCCGCCGCCGCCCTCGG 0: 1
1: 1
2: 19
3: 132
4: 916
1104983379_1104983383 -10 Left 1104983379 12:132583595-132583617 CCTGGCGCGGACCCCGCCCGCCG 0: 1
1: 0
2: 2
3: 54
4: 368
Right 1104983383 12:132583608-132583630 CCGCCCGCCGCCGCCGCCCTCGG 0: 1
1: 1
2: 19
3: 132
4: 916
1104983376_1104983383 9 Left 1104983376 12:132583576-132583598 CCGCGCTGCACAATGGGCTCCTG 0: 1
1: 0
2: 0
3: 17
4: 152
Right 1104983383 12:132583608-132583630 CCGCCCGCCGCCGCCGCCCTCGG 0: 1
1: 1
2: 19
3: 132
4: 916

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104983383 Original CRISPR CCGCCCGCCGCCGCCGCCCT CGG Exonic
900016128 1:151422-151444 CCTCCCGCCTCAGCCACCCTAGG + Intergenic
900046394 1:510016-510038 CCTCCCGCCTCAGCCACCCTAGG + Intergenic
900068595 1:751732-751754 CCTCCCGCCTCAGCCACCCTAGG + Intergenic
900169227 1:1258282-1258304 CCGCCCGCCTCGGCCTCCCAAGG + Intronic
900344479 1:2204586-2204608 CCGCCCGCCGCCGAGCCCCCGGG + Intronic
900513268 1:3070096-3070118 CGACCCGCCGCTGCCGCCCTCGG + Intronic
900626651 1:3611588-3611610 TCGCCCGCCCCCTGCGCCCTCGG + Intergenic
900629613 1:3627065-3627087 CCGCCCGCCTCAGCCTCCCAAGG - Intronic
900640033 1:3684223-3684245 CGCCCCGCCTCCGCCGCCCAGGG + Intronic
900650574 1:3728143-3728165 CCCCCTGCCGTCCCCGCCCTTGG + Exonic
900792448 1:4689430-4689452 CCCCCCGCCTCCGCCTTCCTGGG - Intronic
901057401 1:6455100-6455122 CCCAGCGCCGCCGCCGCCCACGG + Intronic
901109613 1:6784853-6784875 CAGCCCGCCGCCGCTGCCGGTGG - Intergenic
901227682 1:7623739-7623761 CCGCCCGCCTCGGCCTCCCGAGG + Intronic
901629026 1:10639249-10639271 CCGCCCGACGCCGCCGCCCCCGG - Exonic
901630332 1:10644891-10644913 CTGCCCGCAGCCCCAGCCCTCGG + Intronic
901659088 1:10787505-10787527 CCGCCCGCCCCCCTCGCCCCCGG - Intronic
901676572 1:10889013-10889035 CCGCCCGCCCCGGCCGCCCAGGG - Intergenic
901797843 1:11691147-11691169 CGTCCCGCCTCCCCCGCCCTGGG + Intronic
902288606 1:15422474-15422496 CCCCCCACCTCCGCCGCCCCAGG + Intronic
902375135 1:16026923-16026945 CCGCCCCGCCCCGCCGCCCCCGG - Intronic
902476958 1:16693379-16693401 CCCAGCGCCGCCGCCGCCCACGG - Intergenic
902584985 1:17433413-17433435 CCGCCCTGCCCCGCCGCCCCGGG - Intronic
902823109 1:18955636-18955658 CGCCCCTCCCCCGCCGCCCTGGG - Intronic
902893335 1:19461083-19461105 CCCCCCCCCGCCCCCGCCCAGGG - Intronic
902896796 1:19485212-19485234 CCGCTCCCAGCCCCCGCCCTTGG - Intronic
903324741 1:22563450-22563472 GCCGCCGCCGCCGCCGCCCCGGG - Intergenic
903398408 1:23020008-23020030 CCGCCCTCCCCCGCCGCCGCCGG + Intronic
903603038 1:24556081-24556103 CCGCCCGGCGCTGCCACCCTGGG - Intergenic
903907389 1:26696448-26696470 CCCGCCGCCGCCGCCGCCCTCGG + Exonic
903907711 1:26697494-26697516 CCCCCCGCCGCCGCTGCTCCCGG - Exonic
903950554 1:26993846-26993868 GAGGTCGCCGCCGCCGCCCTGGG + Exonic
904039292 1:27575173-27575195 CCCGCCGCCGCCGCCGCCTCTGG + Intronic
904252970 1:29237789-29237811 CCGCCCGCCGGCCCCTCGCTGGG - Intronic
904725469 1:32543917-32543939 CCGCCCGCCTCGGCCTCCCAAGG + Intronic
904782991 1:32964539-32964561 CGGCCCGCGGCCGCCGCGCCCGG - Exonic
904822950 1:33256821-33256843 GCCGCCGCCGCCGCCGCTCTGGG - Intronic
905037994 1:34929808-34929830 CCGCCCGCGGGCGGCGACCTCGG - Intergenic
905066978 1:35192482-35192504 AGGCCCGCCGCCTCCGCCCGCGG - Exonic
905463070 1:38134002-38134024 CCGGCCGCCGCCTCCCTCCTCGG - Intergenic
905573821 1:39027313-39027335 CCGCCCGCCTCGGCCTCCCAAGG + Intronic
905639145 1:39576583-39576605 GCGCCCGCCGCCGCAGCGCTTGG - Intronic
905803828 1:40862054-40862076 CCGTCCGCCGCGGCCGCCCATGG - Exonic
905806982 1:40884379-40884401 GCGGCTGCCGCCGCCGCCCGCGG + Intergenic
906325522 1:44843161-44843183 CCTCCAGCCGCCGCGGCCCACGG - Intergenic
906418216 1:45639631-45639653 CCGCCCGCCTCGGCCTCCCAAGG - Intronic
906637014 1:47416489-47416511 GCCGCCGCCGCCGCCGCCCCGGG - Exonic
906662542 1:47593270-47593292 CGGCCCGCCGCCGCCAGCCCGGG + Intergenic
907010726 1:50960243-50960265 CTGGCCGCCGCCTCCGCCCCTGG + Exonic
907069331 1:51519408-51519430 CCGCCCGCCGGAGCCGGCCGCGG + Intergenic
907258358 1:53197117-53197139 CCGCCGCCCGCCGCCGTCCCAGG + Intronic
907278001 1:53327606-53327628 CCCCCCGCCCCCGCGGGCCTCGG - Intronic
907414002 1:54301754-54301776 CCGGCCGCCACCACCACCCTAGG + Intronic
908275053 1:62461826-62461848 CCGCCCGCCTCTGCCTCCCAAGG - Intronic
909338137 1:74500356-74500378 CCGCCCGCCTCGGCCTCCCAAGG - Intronic
910569675 1:88684932-88684954 CGGCCCGTCGCCCCCTCCCTCGG + Intronic
910967817 1:92825361-92825383 CCGCCCGCCTCGGCCTCCCAAGG - Intergenic
912625756 1:111203887-111203909 CCGCCCCACCTCGCCGCCCTGGG - Intronic
912798553 1:112707052-112707074 CCGCCCGCAGCCCCGGCCCAGGG + Intronic
914831957 1:151176720-151176742 CCGCCCACTGCCTCAGCCCTGGG - Exonic
914837075 1:151216103-151216125 CCGCCCGCCTCGGCCTCCCAAGG - Intronic
915015859 1:152732635-152732657 CCGCCCGCCTCGGCCTCCCAAGG + Intergenic
915310829 1:155005103-155005125 CTGCCCGCCGCACCCTCCCTGGG - Intronic
915429810 1:155857484-155857506 CCGCCCGCCTCCGTCTCCCAAGG - Intronic
915463192 1:156081740-156081762 GGCCCCGCCGCCGCCGCCCGCGG - Exonic
916107005 1:161440287-161440309 CAGCGCGCCGCCGACGCCCGGGG + Intergenic
916108566 1:161447701-161447723 CAGCGCGCCGCCGACGCCCGGGG + Intergenic
916110154 1:161455082-161455104 CAGCGCGCCGCCGACGCCCGGGG + Intergenic
916111739 1:161462492-161462514 CAGCGCGCCGCCGACGCCCGGGG + Intergenic
916113326 1:161469873-161469895 CAGCGCGCCGCCGACGCCCGGGG + Intergenic
916144631 1:161727440-161727462 CTGCGCTCCGCCGACGCCCTTGG + Exonic
916483656 1:165237458-165237480 CCGCCCGCCTCGGCCTCCCAAGG + Intronic
916548295 1:165827482-165827504 CCGGGCCCCGCCGCCGCCCGAGG - Intronic
917336366 1:173928153-173928175 CCGCCCGCCTCAGCCTCCCAAGG + Intergenic
917846694 1:179026020-179026042 CCGGCCGCCCCCGCCGCCTCCGG - Exonic
917888255 1:179409636-179409658 CCGCCCGCCTCAGCCTCCCAGGG - Intronic
918093668 1:181317621-181317643 CCGCCCGCCGCCCCCAGCCCCGG + Intergenic
918659417 1:187071650-187071672 CCGCCCGCCTCAGCCTCCCAAGG + Intergenic
919126125 1:193395839-193395861 CCGCCCGCCTCGGCCTCCCAAGG - Intergenic
919463242 1:197902937-197902959 CGCCCCGCCGCGGCCGCCCCGGG + Intronic
919676356 1:200387375-200387397 CCGCCCGCCTCAGCCTCCCAAGG + Intergenic
919809402 1:201399338-201399360 CCGCCGGCCGCCGCCTCACCTGG + Exonic
920293922 1:204944321-204944343 CAGGCAGCCACCGCCGCCCTGGG + Exonic
920429364 1:205906820-205906842 CCGCCCGCCTCAGCCTCCCAAGG + Intergenic
920878471 1:209858913-209858935 CCGGCTGGCGCCGCCGCCCCGGG - Intergenic
920896226 1:210052417-210052439 CCGCCCGCCTCGGCCTCCCAGGG - Intronic
921155160 1:212433229-212433251 CGGCCCGCGGCGGGCGCCCTGGG + Intronic
921266343 1:213423790-213423812 CCTCCCGCCGCCTCCCCTCTGGG - Intergenic
921604757 1:217139698-217139720 CCGCGCACCGCCGCCGCCGCCGG - Intergenic
921629104 1:217412717-217412739 CCGCCCGCCTCGGCCTCCCAAGG + Intergenic
921702431 1:218283672-218283694 CCTCCCGCCTCCGCCTCCCAAGG + Intergenic
922103950 1:222497108-222497130 CCTCCCGCCTCAGCCACCCTAGG + Intergenic
922134906 1:222815142-222815164 CCGCCCGGCGCCGCGGGACTGGG + Intergenic
922264272 1:223969635-223969657 CCTCCCGCCTCAGCCACCCTAGG + Intergenic
922507760 1:226136367-226136389 CCGCCCGCCTCAGCCTCCCAAGG - Intergenic
922513148 1:226186476-226186498 CCCCCAGCCGCCGCCTCCCCGGG + Exonic
922740223 1:228010328-228010350 CCTCCCGCCACCGCCTCCCCAGG + Intronic
922766244 1:228158093-228158115 GCGCCCTCCGCCGCCGCCCGGGG + Exonic
922958587 1:229625909-229625931 CCCCCCGCCGCCGCCGCCTCCGG + Exonic
923007920 1:230067082-230067104 CCGCGCGGCGCCGCCGGCCCGGG + Intronic
923055886 1:230425902-230425924 CCGCGCGCCCCCGCCGCCCTCGG + Intergenic
923744307 1:236686413-236686435 GCCCCCGCCGCCACCGCCCCCGG - Intergenic
923744345 1:236686582-236686604 CCGCCGCCCGCCGCCTCCGTGGG + Exonic
924289722 1:242524714-242524736 CCCGCCGCCGCCGCCGCCCCGGG - Intergenic
924346120 1:243074628-243074650 CCTCCCGCCTCAGCCACCCTAGG + Intergenic
924383418 1:243483197-243483219 GCGCCCGCCGCCTCCTCCCCGGG - Intronic
924436681 1:244048904-244048926 CCGGCCGCCGCCGCCGCCGCCGG - Intergenic
1064125623 10:12657905-12657927 CCGCCCGCCTCAGCCTCCCAAGG - Intronic
1064209078 10:13348112-13348134 CCCGCCGCCGCCGCCGCCGCCGG - Exonic
1064221105 10:13440611-13440633 CTGCCCCCCGCCGCCTCCCGCGG - Intronic
1064553116 10:16521722-16521744 GTGCCCGCCGCCGCCGCCGCTGG - Exonic
1064981872 10:21173845-21173867 GCCGCCGCCGCCGCCGCCCCCGG - Intronic
1065019535 10:21493444-21493466 CCGCCCACCTCAGCCTCCCTAGG - Exonic
1065214940 10:23439716-23439738 GCGCCCGCCTCCGCCGCCGCCGG + Exonic
1065589782 10:27252571-27252593 GCCCCCGCCGCCGCCGCCAGGGG + Intergenic
1065712734 10:28533158-28533180 CCCGCCGCCGCCGCCGCCGCTGG - Intronic
1065968137 10:30785215-30785237 CCGCCCAGCGCCGCCCCCCGCGG + Intergenic
1066080722 10:31928574-31928596 CCCCCCGACTCCACCGCCCTCGG + Intronic
1066180468 10:32957550-32957572 GCTCCCGCCGCCCCCGCCCGCGG + Intronic
1066180584 10:32957924-32957946 CCGCACGCCGCCACCCGCCTCGG - Intronic
1066396374 10:35027385-35027407 CCGCCCGCCTCGGCCTCCCAAGG + Intronic
1066402609 10:35090355-35090377 CCGGCCGCCGCCACCGGCCCCGG + Exonic
1066429329 10:35336849-35336871 GCCGCCGCCGCCGCCGCCCATGG + Intronic
1066456036 10:35573197-35573219 CCTCCCGCCTCAGCCTCCCTGGG + Intergenic
1066464227 10:35639498-35639520 CGGCCCGCCGCCACCCCCCGCGG + Exonic
1066599046 10:37084318-37084340 CCGCCCGCCTCGGCCTCCCGCGG - Intergenic
1066730227 10:38430192-38430214 CCTCCCGCCTCAGCCACCCTAGG - Intergenic
1067015584 10:42754784-42754806 CCCCCAGCCGCCGGCGCTCTCGG + Intergenic
1067362416 10:45594709-45594731 CCGCGCGCAGCCGCCGCCGCTGG - Intronic
1067407302 10:46034580-46034602 CCGCCCGCCTCGGCCTCCCAAGG - Intronic
1067694330 10:48524142-48524164 CCGCCTGCCGCCTGCGCCCCGGG + Intronic
1068119962 10:52775051-52775073 CCGCCCGCCTCGGCCTCCCAAGG - Intergenic
1068560769 10:58512754-58512776 CCGCCCGCCGCGGCTCCCCGTGG + Intergenic
1069019144 10:63465991-63466013 CTGCGCGCCGCCGCTGCCCGGGG - Intergenic
1069722026 10:70555756-70555778 CCGCCCGCCTCAGCCTCCCAAGG - Intronic
1070145872 10:73772906-73772928 CCGCCCGGTGCCTCCGCCCATGG + Exonic
1070800833 10:79243558-79243580 CCCCGCGCCGCCGCCGCCGCCGG + Intronic
1072334681 10:94387434-94387456 CCGCCCGCCTCGGCCTCCCAAGG - Intergenic
1072409071 10:95183876-95183898 CCTGCCGCCGCCGCCGCCCCGGG + Intergenic
1072562180 10:96586701-96586723 CCGGCCGGCGCGGCCGCCCCGGG - Intronic
1073233221 10:101990412-101990434 CCGCCCGCCTCGGCCTCCCAAGG + Intronic
1073379444 10:103066586-103066608 CCGGCCGCTGCCGCCACCCTGGG + Intronic
1073385812 10:103127797-103127819 CCGCCCGCCTCGGCCTCCCAAGG + Intronic
1074169721 10:110919955-110919977 CCGCCCGCCGCCGCCGCCGCAGG - Intronic
1074587886 10:114786738-114786760 CCGCCAGCCTCCGCCTCCCGAGG + Intergenic
1074814503 10:117134309-117134331 GCAGCCGCCGCCGCCGCCCCGGG - Exonic
1074865721 10:117543424-117543446 TCGGCCGCCGCCGCCGCCGCCGG + Exonic
1075129542 10:119726226-119726248 CCGCGGGCCGCCGCCTCCCTGGG + Exonic
1075697487 10:124447628-124447650 CCGCCGCCCCCCGCCGCCCCTGG + Exonic
1075802018 10:125159930-125159952 CCTCCGGACGCCGCCGCGCTCGG + Intronic
1076554208 10:131311518-131311540 GCCGCCGCCGCCGCCGCCCTGGG - Exonic
1076554275 10:131311787-131311809 GCCCGCGCCGCCGCCGCCCCCGG + Intergenic
1076943004 10:133622470-133622492 CCGCCCGCCTCGGCCTCCCACGG + Intergenic
1076972720 11:146493-146515 CCTCCCGCCTCAGCCACCCTAGG + Intergenic
1076986009 11:236429-236451 CCGCCTACCGCCCCCGCCCCCGG + Exonic
1076993819 11:289056-289078 GCGACCGCCCCCGCCGCCCAGGG + Intergenic
1077041770 11:527943-527965 CCGCCCGCCTCGGCCTCCCAAGG + Intergenic
1077121466 11:910855-910877 CCGCGCGCCGCCGCCGCGCACGG + Intronic
1077308716 11:1879099-1879121 CCGCCCGCCTCAGCCTCCCAAGG - Intronic
1077479582 11:2807417-2807439 CCGCCCGCGGTCGCTGCACTGGG + Intronic
1077628946 11:3797772-3797794 CCGCCCCTCGCCGCCGCGGTTGG + Exonic
1078057407 11:8019254-8019276 CCCAGCGCCGCCGCCGCCCGCGG + Intronic
1078316042 11:10294068-10294090 ATGGCCGCCGCCGCCGCGCTCGG + Exonic
1078771921 11:14359091-14359113 CCCCCGGCCGCTGCCGCCCCTGG - Exonic
1079624671 11:22601837-22601859 CCGCCCGCCTCGGCCTCCCAAGG - Intergenic
1080458482 11:32435086-32435108 CTGCCCGCCGTCCCCTCCCTGGG - Exonic
1080668711 11:34357594-34357616 TCGCTCGGCGACGCCGCCCTCGG - Exonic
1081700029 11:45146973-45146995 CCGCCCCCAGCCGCCGCTCCCGG - Intronic
1081970953 11:47198355-47198377 CCGCCCGCCCCGGCCTCCCAAGG - Intergenic
1082021325 11:47536003-47536025 CCGCCCGCCTCAGCCTCCCAAGG + Intronic
1082076679 11:47980689-47980711 CCCCCCGCGGCAGCCGCGCTAGG + Exonic
1082986082 11:59172363-59172385 CCGCGCGCCGCCGCCGCCGCCGG - Intronic
1083176112 11:60951452-60951474 CCGCCCGCCGCCACCGTCGAGGG + Exonic
1083296133 11:61716665-61716687 CCGCCTGTCGCTGCCGCCCGAGG + Intronic
1083617906 11:64035595-64035617 GCGCCCCCCTCCCCCGCCCTCGG - Intronic
1083747642 11:64744652-64744674 CAGCCCGCCCGCGCCGCCCTGGG + Intronic
1083797743 11:65027444-65027466 CCGCCCGCCGCCGCCTCGCCAGG - Exonic
1083807497 11:65083836-65083858 CCTCCCGCTGCCGCCGCCGGAGG - Intronic
1083890239 11:65592340-65592362 CCGGCGTCCGCCGCCGCCCCGGG + Exonic
1083970303 11:66070404-66070426 GCCCCCGCCGCCGCCGCCGCGGG + Intronic
1083970352 11:66070527-66070549 CCGCTGGCCGCTGCCGCCCCCGG - Exonic
1084128626 11:67118033-67118055 CGGCCCGACCCTGCCGCCCTGGG - Intergenic
1084128701 11:67118228-67118250 GCGCCGGCCGCCACCGCCCCCGG + Intergenic
1084128897 11:67118798-67118820 CCGCCCTCCCCCACCCCCCTGGG - Intergenic
1084131994 11:67143248-67143270 CCTCCCGCCTCCGCCTCCCAAGG + Intronic
1084621105 11:70270779-70270801 CCGCCCCACGCCGCGGCCCCGGG - Exonic
1084871743 11:72103164-72103186 CCGCCTGCCGCGGCCGCACCTGG + Exonic
1084973123 11:72781943-72781965 GCGCCCGCCCCCGCCGGCCCTGG + Intronic
1085626639 11:78078967-78078989 CCGCCCGCCACGGCCTCCCAAGG + Intronic
1087755043 11:102046584-102046606 CCGCCCGCCTCGGCCTCCCAAGG - Intergenic
1088053863 11:105552256-105552278 CCGCCCGCCTCAGCCGCCCAAGG - Intergenic
1088147524 11:106700024-106700046 CCGCCCGCCTCGGCCTCCCAGGG + Intronic
1088244104 11:107800129-107800151 CCGCCCGCCTCGGCCTCCCAAGG + Intronic
1088466540 11:110146229-110146251 CCGCCCGCCTCAGCCTCCCAAGG + Intronic
1088495735 11:110430002-110430024 GCGCCCCTCGCCGCGGCCCTCGG + Exonic
1088906622 11:114159921-114159943 CCCCCCGCCTCCCCCGCCCAGGG - Intronic
1089306380 11:117528923-117528945 CCGCCCCCCGCCCCCCCCCTTGG + Intronic
1089405827 11:118196635-118196657 CCGCCCTCAGCAGCCTCCCTTGG + Intronic
1089432653 11:118436559-118436581 CCCCCCGCCGCCGCCGCCCCCGG - Exonic
1089499924 11:118925843-118925865 CCGCGCGCCGCCGCCTCCCCGGG + Intronic
1089848725 11:121479206-121479228 CCTCCCGCCTCCACCTCCCTGGG - Intronic
1090799084 11:130159671-130159693 CTGCCCGCCCCCGCCGGCCCTGG - Exonic
1091474043 12:753974-753996 CCTCCAGCCGCTGCCGCCCCTGG + Exonic
1091718519 12:2795863-2795885 CCGCGCGGCGCCCCCTCCCTCGG + Intronic
1091923075 12:4321161-4321183 CCGGCCGGCTCCGCCGCCATAGG - Intergenic
1092187451 12:6491411-6491433 CCGCCCCCCTCCGCCTCCCAAGG + Intergenic
1092383590 12:8018709-8018731 CAGGCCGCCGCCGCCGCGCCCGG + Intergenic
1092607073 12:10132273-10132295 CCGCCCGCCTCGGCCTCCCAAGG + Intergenic
1093189415 12:16057559-16057581 CAGCCCACCGGCGCTGCCCTCGG + Intergenic
1093921708 12:24866373-24866395 CCGCCCCCCGCCACCGCTGTGGG + Intronic
1094610704 12:31993222-31993244 CCGCCCGCCTCAGCCTCCCAAGG - Intergenic
1096101012 12:48970493-48970515 CCGGCCGCGGCCTCCGCCCTCGG - Exonic
1096241182 12:49961305-49961327 CCGCCCGCCCCCGCCGCCGGCGG + Intergenic
1096670884 12:53197663-53197685 CCGCCCGCCGCCCACCCCCTAGG - Exonic
1096774366 12:53955228-53955250 CAGGCCCCCGCCGCCACCCTCGG - Exonic
1097107698 12:56635033-56635055 CCCTCCGCCGCCGCCGGCCCAGG - Intronic
1097218238 12:57430756-57430778 CCGCCCGCCGCCCGGGCCCACGG + Exonic
1097990091 12:65825008-65825030 CCCACCGCCGCCGCCGCCACCGG + Exonic
1098161045 12:67648661-67648683 CCGCCCTCCTCCGCCGCCGCAGG - Intronic
1098550373 12:71755140-71755162 CGCCCCGCCGCCGCCGCCGCCGG - Exonic
1099114047 12:78601885-78601907 CCGCCCGCCCCAGCCTCCCAAGG - Intergenic
1100423411 12:94459803-94459825 ACCGCCGCCGCCGCCGCCCTCGG - Exonic
1100444721 12:94650226-94650248 CCGCCCTCCGCTGCCGCCGGAGG - Intronic
1100963101 12:99984842-99984864 CTCGCCGCCGCCGCCGCCCTCGG - Intergenic
1101641316 12:106587250-106587272 CCGCCCGGCGCCTCGGGCCTGGG + Intronic
1101842637 12:108339388-108339410 CAGCTAGCCGCCCCCGCCCTAGG - Intergenic
1102124458 12:110469000-110469022 TCACCCGCCGCCGCCACCCTCGG - Exonic
1102853865 12:116277235-116277257 CGGGCCGCCGCCGCCGCCGGGGG + Exonic
1102933570 12:116879816-116879838 CCGCGCGCCGCAGACACCCTGGG - Intronic
1103074267 12:117969309-117969331 CCGGCCTCCCCCGCCGCCCCCGG - Intergenic
1103120561 12:118376524-118376546 CCGCCCCCCGCGCCCGCGCTCGG - Exonic
1103459673 12:121093770-121093792 CCGGCCGGCACCGCCGCCCCGGG - Intergenic
1103655347 12:122466246-122466268 CCGCCCGCCTCGGCCTCCCAAGG + Intergenic
1103954196 12:124567435-124567457 CCTCCCGCCGCCGCCTCCTAGGG + Intronic
1104692660 12:130838840-130838862 CCGCCCGGAGCCCCCACCCTAGG + Intronic
1104861550 12:131926818-131926840 CCGCCAGCCTCCGCCTCCCGAGG - Intergenic
1104961525 12:132490430-132490452 CCGCCGCCCGCCGCCGCCCAGGG + Exonic
1104983383 12:132583608-132583630 CCGCCCGCCGCCGCCGCCCTCGG + Exonic
1104999701 12:132682050-132682072 CCGCCCGCCTCGGCCTCCCACGG - Intronic
1105407367 13:20143365-20143387 CAGGCCGCTGCCGCCGCCCATGG - Intronic
1105964528 13:25372323-25372345 CCCCGCGCCGCCCCCGCCCCGGG - Intronic
1106590069 13:31091424-31091446 CCCCCCGCCGCCCCCGCTCCCGG + Intergenic
1106995055 13:35471286-35471308 CCTCGCGCCGACACCGCCCTCGG - Intronic
1107133329 13:36919687-36919709 CCGACCGCCGCCCCCGCCGCGGG + Intronic
1107954431 13:45496914-45496936 CCGCCCGCCTCGGCCTCCCAAGG + Intronic
1107968164 13:45615763-45615785 CCGCACTCCGCAGCCTCCCTGGG + Intergenic
1108408016 13:50124325-50124347 CCGCCCGGAGTCCCCGCCCTGGG - Intronic
1108727791 13:53201119-53201141 GCCGCCGCCGCCGCTGCCCTCGG + Intergenic
1110318199 13:74134286-74134308 CCCGCCGCCGCCCCCGCCCTCGG - Intergenic
1110558468 13:76886095-76886117 GCCCCCGCCGCCGCCCCCGTTGG + Exonic
1111556187 13:89884091-89884113 CCGGCCGACCCCGCCGCCCCAGG - Intergenic
1111979668 13:95003016-95003038 CCGCCCTCTGCCGCCGGCCCGGG - Intergenic
1112056302 13:95691807-95691829 CCGCCAGCCTCCGCCTCCCAAGG - Intronic
1112290892 13:98143361-98143383 GCCCGCGCCGCCGCCGCCCGCGG + Intronic
1112344207 13:98576874-98576896 CCGGCCGGCCCCGCCGCCCGAGG - Intronic
1113200997 13:107867341-107867363 CCGCCCGCGGGCGCCGCCGCCGG + Intergenic
1113378613 13:109784717-109784739 CCGCCCGCCGCCACCAGCCCCGG - Exonic
1113707790 13:112445569-112445591 CCGCCTGCCGCCCCCTCCATGGG - Intergenic
1113794940 13:113051344-113051366 CCGCCCACCGCCGTGGCCCTGGG - Intronic
1113976962 13:114234970-114234992 GCAGCCGCCGCCGCCGCCCCAGG - Exonic
1114508566 14:23237371-23237393 CCGCCCGCCTCGGCCTCCCAAGG + Intronic
1114627932 14:24141477-24141499 CCGCCGGCTCCCGGCGCCCTGGG + Exonic
1114890626 14:26917788-26917810 CCACCCGCCTCAGCCGCCCAAGG + Intergenic
1115028399 14:28767498-28767520 GCCGCCGCCGCCGCCGCCCCCGG + Exonic
1115714688 14:36090002-36090024 TCGCCCGCCTCAGCCTCCCTGGG - Intergenic
1116310998 14:43326702-43326724 CCGGCCGCCGCCACCGGCCCTGG + Intergenic
1116817681 14:49598947-49598969 CCGCCACCCGGCGCCGCCATCGG - Exonic
1117307246 14:54488834-54488856 CTGCCCGCCGCCGCCGGCTCCGG + Intronic
1118024081 14:61751205-61751227 CCGCCCGCGGCCCCGGCCGTGGG + Intergenic
1118220810 14:63853244-63853266 TCTCCCGCCGCCCCCGCCCCCGG - Intronic
1118273456 14:64364533-64364555 CCGCCCGCCTCAGCCTCCCAAGG + Intergenic
1118776988 14:68979334-68979356 CCCCCCGCCCCCGCCCGCCTCGG - Intronic
1120525354 14:85570826-85570848 CCGCCCGCCTCGGCCTCCCAAGG + Intronic
1121050452 14:90816362-90816384 CCGCCTCCCGCCGCCGCCGCGGG + Exonic
1121184095 14:91951538-91951560 CCGCCCGCCTCAGCCGCCCAAGG - Intergenic
1121199585 14:92106319-92106341 TCCCCCGCGGCCCCCGCCCTGGG - Intronic
1121767796 14:96502529-96502551 ACCGCCGCCGCTGCCGCCCTGGG - Exonic
1122145124 14:99684311-99684333 CCGCGCGCCGCCTCGGCCCCAGG - Exonic
1122194365 14:100074001-100074023 CCCCCCGCCCCCACCGCCCCCGG - Intronic
1122418311 14:101560748-101560770 GCGCCCCCCGCCGCTGCCCGAGG - Intergenic
1122445013 14:101761777-101761799 GCCGCCGCCGCCGCCGCCCGGGG - Exonic
1122866123 14:104604774-104604796 CCGCCCGGCGCAGCCTCCCGCGG - Exonic
1122918212 14:104868488-104868510 GCGCCCGCCACCGGCTCCCTCGG + Exonic
1123024986 14:105420167-105420189 CCGCCCGCCCTCGCGGCCCCCGG + Intronic
1123048159 14:105528303-105528325 CCTCTCCCCGCCGCCGCACTGGG - Intronic
1123059306 14:105587287-105587309 CCACCTGCTGCCGCCGCCGTCGG - Intergenic
1123083638 14:105707518-105707540 CCACCTGCTGCCGCCGCCGTCGG - Intergenic
1123200021 14:106654007-106654029 CCGCCCGCCTCGGCCTCCCAAGG - Intergenic
1123470934 15:20551500-20551522 CCGCCCGCCACGGCCTCCCGGGG + Intergenic
1123480691 15:20628745-20628767 CCGGCCCCCGCCGCCGCCCGAGG - Intergenic
1123637318 15:22371622-22371644 CCGGCCCCCGCCGCCGCCCGAGG + Intergenic
1123647124 15:22449200-22449222 CCGCCCGCCACGGCCTCCCGGGG - Intergenic
1123664694 15:22599103-22599125 CCGCCCGCCTCGGCCTCCCTGGG + Intergenic
1123731237 15:23146488-23146510 CCGCCCGCCACGGCCTCCCGGGG + Intergenic
1123734828 15:23175406-23175428 CCGCCCGCCTCAGCCTCCCGGGG - Intergenic
1123734915 15:23175871-23175893 CCGCCCGCCTCGGCCTCCCAGGG - Intergenic
1123749375 15:23343903-23343925 CCGCCCGCCACGGCCTCCCGGGG + Intergenic
1123752994 15:23373019-23373041 CCGCCCGCCTCGGCCTCCCGGGG - Intergenic
1123753103 15:23373616-23373638 CCGCCCGCCTCGGCCTCCCGGGG - Intergenic
1124281746 15:28367780-28367802 CCGCCCGCCACGGCCTCCCGGGG + Intergenic
1124285330 15:28396706-28396728 CCGCCCGCCTCAGCCTCCCGGGG - Intergenic
1124285420 15:28397175-28397197 CCGCCCGCCTCGGCCTCCCAGGG - Intergenic
1124297277 15:28514467-28514489 CCGCCCGCCTCGGCCTCCCAGGG + Intergenic
1124297367 15:28514919-28514941 CCGCCCGCCTCAGCCTCCCGGGG + Intergenic
1124300957 15:28543824-28543846 CCGCCCGCCACGGCCTCCCGGGG - Intergenic
1124318528 15:28693541-28693563 CCGCCCGCCTCGGCCTCCCTGGG + Intergenic
1124322682 15:28726727-28726749 CCGCCCGCCTCCGCCTCCCTGGG + Intronic
1124328058 15:28783970-28783992 CCGCCCGCCTCCGCCTCCCAGGG + Intergenic
1124328157 15:28784434-28784456 CCGACCGCCTCGGCCTCCCTGGG + Intergenic
1124439405 15:29675462-29675484 CCTCCCGCCTCGGCCTCCCTGGG - Intergenic
1124500375 15:30223087-30223109 CCGCCCTCCTCCGCCGCCTCCGG - Intergenic
1124500728 15:30225039-30225061 CCCGCCGCCGCCGCCGCCGCAGG + Intergenic
1124500781 15:30225217-30225239 CCGCCCCCCGCCAGCCCCCTGGG + Intergenic
1124523513 15:30426861-30426883 CCGCCCGCCTCCGCCTCCCTGGG + Intergenic
1124523591 15:30427305-30427327 ACGCCCGCCTCCGCCTCCCTGGG + Intergenic
1124535076 15:30538910-30538932 ACGCCCGCCTCCGCCTCCCTGGG - Intergenic
1124535154 15:30539353-30539375 CCGCCCGCCTCCGCCTCCCTGGG - Intergenic
1124564916 15:30803894-30803916 CCGCCCGCCTCGGCCTCCCTGGG - Intergenic
1124742789 15:32313450-32313472 CCGCCCCCCGCCAGCCCCCTGGG - Intergenic
1124742841 15:32313628-32313650 CCCGCCGCCGCCGCCGCCGCAGG - Intergenic
1124743198 15:32315579-32315601 CCGCCCTCCTCCGCCGCCTCCGG + Intergenic
1124763499 15:32468244-32468266 CCACCCGCCTCCGCCTCCCTGGG + Intergenic
1124763574 15:32468691-32468713 ACGCCCGCCTCCGCCTCCCTGGG + Intergenic
1124775052 15:32580360-32580382 ACGCCCGCCTCCGCCTCCCTGGG - Intergenic
1124775129 15:32580805-32580827 CCACCCGCCTCCGCCTCCCTGGG - Intergenic
1124929145 15:34101890-34101912 CCGGCCGCCACCGCCGCCGCTGG + Exonic
1125051163 15:35299464-35299486 CCGCCCGCCGACTCTGCCCATGG + Intronic
1125139281 15:36385333-36385355 CCGCCCGCCTCGGCCTCCCAAGG - Intergenic
1125811393 15:42544577-42544599 CTGCCCGCCGCAGCCTCCCAAGG - Intronic
1125999348 15:44194865-44194887 CCGGCGGCGGCCGCCGCCCAGGG - Intronic
1127753438 15:62068014-62068036 CGGGCCGCCGCCGCCGCCGTAGG - Exonic
1128547731 15:68579181-68579203 CCCCCTTCCGCCGCCGCCCCGGG + Exonic
1128582753 15:68820492-68820514 GCTGCCGCCGCCGCTGCCCTTGG - Intronic
1128582858 15:68820986-68821008 CCCCCCGCCGCCACTGCCATTGG - Intronic
1129051290 15:72783812-72783834 CCGCCCGTCGCCCCGCCCCTTGG - Intronic
1129274031 15:74433782-74433804 GCGGCCGCCGCCTCCGCCCAGGG - Exonic
1129322352 15:74782250-74782272 CCGCCCGGCTGCGCCGCCGTCGG + Exonic
1129606500 15:77027805-77027827 CCTCCCGAGGCCGCGGCCCTCGG + Intronic
1130428496 15:83822947-83822969 CCGCCAGCCTCCGCCTCCCGAGG - Intronic
1131238687 15:90719232-90719254 CCGCCTGCCTCCGCCTCCCAAGG + Intronic
1131257618 15:90872202-90872224 GCGCCGGCCGCCGGCGCCCGCGG - Intronic
1131263745 15:90903444-90903466 CCCCCCGCCGCCACCGCCCTCGG - Intronic
1132365102 15:101251507-101251529 CAGCCCGCTGCCCCCGCCCGCGG + Exonic
1132499893 16:280611-280633 CGCCCCGCCGCCGCCCCGCTCGG - Exonic
1132578754 16:675745-675767 CCGGCCGCGGCCGCCGACCCCGG + Exonic
1132656569 16:1044047-1044069 GCCCCCGCCGCCGCCGGCCCAGG - Intergenic
1132741758 16:1417358-1417380 CCGCCCGCCTCGGCCTCCCAAGG + Intergenic
1132837999 16:1964397-1964419 CCGCTCTCCGGCGCCGCCCAGGG + Intronic
1132868671 16:2105918-2105940 CGGCCTGCCGCAGCAGCCCTGGG + Exonic
1133156453 16:3880137-3880159 CCGGCCGCCGCCGCCGCCGCCGG + Exonic
1133228678 16:4355710-4355732 CCGCCCGCCTCGGCCTCCCACGG + Intronic
1133270544 16:4609086-4609108 CTGCCCGCCGCCCCCTCCCCAGG - Exonic
1133278103 16:4650057-4650079 CCGCCCGCCTCAGCCTCCCAAGG - Intronic
1133771479 16:8869104-8869126 CCGCCCGCCCCCACCGTCCCGGG - Intergenic
1133998032 16:10762538-10762560 CCGCCCGGCTCCGCGGTCCTGGG - Intronic
1135374857 16:21936755-21936777 CCGCCCGCCTCAGCCTCCCAAGG - Intergenic
1135583826 16:23651789-23651811 CTGCCCGCCTCCGCCTGCCTTGG - Intronic
1136145130 16:28312071-28312093 CCGCCCACCTCAGCAGCCCTTGG + Intronic
1136146667 16:28320400-28320422 GCGCCCGACGCCGCCTCCCACGG - Exonic
1136264811 16:29109179-29109201 CCGCCCGCCTCAGCCTCCCAAGG - Intergenic
1136428369 16:30183797-30183819 CCGCGCGCCCCCGCAGCCCGCGG - Intronic
1136474998 16:30507214-30507236 CCGCCCGCCTCGGCCTCCCAAGG - Intronic
1136556559 16:31010654-31010676 CCGCCCCCCTCCCCCGCGCTCGG - Intergenic
1136737855 16:32478697-32478719 CCACCCGCCGCCGCGGCTTTTGG - Intergenic
1136784283 16:32925519-32925541 GCCCCCGCCGCCGCCGGCCCGGG - Intergenic
1136885501 16:33928287-33928309 GCCCCCGCCGCCGCCGGCCCGGG + Intergenic
1137683271 16:50368966-50368988 GCCCCCCCCGCCGCCGCTCTCGG - Intergenic
1137987091 16:53118171-53118193 CCACCCGCCTCCGCCTCCCAAGG - Intronic
1138013935 16:53412483-53412505 CCGCCCGCCTCGGCCTCCCAGGG + Intergenic
1138014193 16:53414026-53414048 CCGCCCGCCTCGGCCTCCCGGGG + Intergenic
1139540786 16:67614451-67614473 CCACCCGCCTCAGCCTCCCTAGG - Intronic
1139610452 16:68053202-68053224 CCGCCCGCCTCGGCCTCCCAAGG + Intronic
1139756535 16:69148473-69148495 CCGCCCGCCTCAGCCTCCCAAGG + Intronic
1140501737 16:75439236-75439258 CCGCCCGCCTCGGCCTCCCAGGG + Intronic
1141054591 16:80803949-80803971 CCGCCGCCCGCCGCCTCCCGCGG - Intronic
1141184333 16:81776350-81776372 CCGCCCGCCTCAGCCTCCCAGGG + Intronic
1141320159 16:83000820-83000842 CCGCCCGCCTCGGCCTCCCAAGG + Intronic
1141531239 16:84648468-84648490 CTCCCCGCGGCCGCCGCCATTGG + Intergenic
1141531247 16:84648493-84648515 GCGCGCGCCGCCTCCGCCCTCGG + Intergenic
1141972355 16:87492477-87492499 CCGGCCGCCCCGGCCGCCCCGGG - Intergenic
1141989636 16:87602655-87602677 CGTGCCGCCGCCGCCGCCCGCGG + Intronic
1141989644 16:87602674-87602696 GCGGGCCCCGCCGCCGCCCTCGG + Intronic
1142053596 16:87977169-87977191 CCGCCCGCCTCAGCCTCCCAAGG - Intronic
1142130787 16:88430656-88430678 CCGCCCGCCGCCCCAGCCGCCGG - Intronic
1142136356 16:88453576-88453598 CCGCCCGCCGCCGCCCGCCCGGG + Exonic
1142156229 16:88533919-88533941 CCGGCCGCCCGCGCCGTCCTCGG - Exonic
1142193063 16:88726679-88726701 CCCCCCGCACCCACCGCCCTGGG - Intronic
1142211906 16:88812382-88812404 AGGCCCGCCGCCTCCGCCCTGGG - Intergenic
1142219218 16:88845102-88845124 CCGCCCGCCTCGGCCTCCCACGG - Intronic
1142393245 16:89816321-89816343 ACGCCCCCAGCCGCCGCCCGCGG - Intronic
1142447529 16:90151033-90151055 CCTCCCGCCTCAGCCACCCTAGG - Intergenic
1203015219 16_KI270728v1_random:350880-350902 CCACCCGCCGCCGCGGCTTTTGG + Intergenic
1203033554 16_KI270728v1_random:624038-624060 CCACCCGCCGCCGCGGCTTTTGG + Intergenic
1203086940 16_KI270728v1_random:1189525-1189547 GCCCCCGCCGCCGCCGGCCCGGG - Intergenic
1142459964 17:84294-84316 CCTCCCGCCTCAGCCACCCTAGG + Intergenic
1142509781 17:386128-386150 CCGCGCGCACCCCCCGCCCTCGG + Intronic
1142580189 17:937225-937247 CCGCCCGCCTCGGCCTCCCAAGG + Intronic
1142582995 17:953169-953191 CCGCCCGCCTCGGCCTCCCAAGG - Intronic
1142583410 17:955651-955673 CCGCCCGCCTCGGCCTCCCGAGG - Intronic
1142683468 17:1563127-1563149 CCGCCCGCCTCGGCCTCCCAAGG - Intergenic
1142757711 17:2025532-2025554 CCGCGCGGCGCCGCCTCCCAAGG + Intergenic
1142762423 17:2050234-2050256 CCGGCCGCCGCCGCCGCGCCCGG - Intergenic
1142848255 17:2692315-2692337 CCGCAGGCCTCCGCCGGCCTTGG + Intronic
1143019443 17:3909271-3909293 CCGCCCGCCTCGGCCTCCCAAGG + Intronic
1143024127 17:3930895-3930917 CCACCCGCCTCCGCCTCCCTGGG - Intronic
1143183395 17:4997562-4997584 CCGCCCGCCGGCTCCTCCCGCGG - Intronic
1143273437 17:5692610-5692632 CCGCCCGCCTCAGCCTCCCAGGG - Intergenic
1143587216 17:7856315-7856337 CCGCCTGCCGCTGCTCCCCTTGG + Intergenic
1143625984 17:8110360-8110382 GAGCCCGGCGCCGCCGCCCCGGG - Intronic
1143745292 17:8989444-8989466 CCGCCCGCCTCGGCCTCCCAAGG - Intergenic
1143783136 17:9239964-9239986 CCGCCCGCTGCCTCGGCGCTAGG - Exonic
1144756083 17:17681531-17681553 CCGGGCGCCGCCCCCGCCCGCGG + Exonic
1144756184 17:17681838-17681860 CCTCGCGCCGCCCCCGCCCCGGG - Intronic
1144828827 17:18120891-18120913 CCGCCGCCACCCGCCGCCCTGGG + Exonic
1145417990 17:22740752-22740774 CCGCCAGCCTCGGCCTCCCTAGG + Intergenic
1145925652 17:28644947-28644969 CCCGCCGCCGCCGCCGCCGCCGG + Intronic
1146048998 17:29533593-29533615 CCGCCAGCCTCCGCCTCCCGAGG - Intronic
1146067341 17:29646739-29646761 CCGCCCGCCTCAGCCTCCCAAGG + Intronic
1146219837 17:31008725-31008747 CTGCCCGCCGCCTCCGCCGCTGG + Intergenic
1146371134 17:32266153-32266175 CCCGCAGCCGCCGCCGCCCCCGG + Intergenic
1146935079 17:36808249-36808271 GCGCCCTCCGCGGGCGCCCTTGG - Intergenic
1147144574 17:38477666-38477688 GCCCCCGCCGCCGCCGGCCCGGG - Exonic
1147168557 17:38605575-38605597 CCGGCCGCCGCCCCCGCCCCCGG + Intronic
1147168700 17:38606044-38606066 TCCCCCGCCCCCGCCGCCCCGGG - Intergenic
1147200646 17:38799426-38799448 GCCGCCGCCGCCGCCGCCCCGGG - Exonic
1148494986 17:48048300-48048322 CCGCCCGCCGCAAACACCCTAGG - Intergenic
1148499086 17:48075434-48075456 CCGCCCGCCTCGGCCTCCCAAGG + Intronic
1148603091 17:48908708-48908730 CCGCCCTCAGCCGCTGCCCACGG + Exonic
1149308179 17:55369365-55369387 CCGCCCGCCTCGGCCTCCCAAGG - Intergenic
1149491177 17:57085939-57085961 TCGCCCGCCGGCGCAGCCCCTGG + Exonic
1149678503 17:58487746-58487768 CCAGCAGCCGCCGCCGCCCGCGG - Exonic
1149683130 17:58519345-58519367 CCGCCCGCCTCGGCCCCCCAAGG - Intergenic
1149743151 17:59067777-59067799 CCGCCCGCCTCGGCCTCCCAAGG + Intronic
1151611934 17:75182329-75182351 CGCCCCGCCGCCGCGGCCCCAGG + Intergenic
1151673884 17:75588362-75588384 GCGCCCCCCGCGGCCGCCCCTGG - Intergenic
1151723443 17:75871482-75871504 CCGCCCGCCTCGGCCTCCCAAGG + Intergenic
1152433118 17:80260541-80260563 CTGCCCGCCGCCGCCGCCGCCGG - Intergenic
1152433131 17:80260571-80260593 CTGCCCGCCGCCGCCGCCGCCGG - Intergenic
1152433144 17:80260601-80260623 CTGCCCGCCGCCGCCGCCGCCGG - Intergenic
1152433157 17:80260631-80260653 CTGCCCGCCGCCGCCGCCGCCGG - Intergenic
1152433170 17:80260661-80260683 CTGCCCGCCGCCGCCGCCGCCGG - Intergenic
1152433183 17:80260691-80260713 CTGCCCGCCGCCGCCGCCGCCGG - Intergenic
1152433196 17:80260721-80260743 CTGCCCGCCGCCGCCGCCGCCGG - Intergenic
1152433209 17:80260751-80260773 CTGCCCGCCGCCGCCGCCGCCGG - Intergenic
1152433222 17:80260781-80260803 CTGCCCGCCGCCGCCGCCGCCGG - Intergenic
1152433235 17:80260811-80260833 CTGCCCGCCGCCGCCGCCGCCGG - Intergenic
1152654858 17:81514749-81514771 CCGCCCCCCGCCGCGTACCTGGG - Intronic
1152714366 17:81891437-81891459 CCCACCGCCGCGGCCGCCCTGGG + Exonic
1152925398 17:83085336-83085358 AGGCCCGCCGCCCCCGCCCCAGG - Intronic
1153308973 18:3659446-3659468 CCCCCCGCCGCCCCCACCCCCGG + Intronic
1153457234 18:5295285-5295307 CCGCGCGCCGCCCCCGCCCCCGG - Intronic
1153855094 18:9137221-9137243 CCGCCCGCCGCCGCCCCTCCCGG + Intronic
1155211052 18:23602277-23602299 CCGCCCGCCTCCGCCTCCCAAGG + Intronic
1155474677 18:26226400-26226422 CAGGCCGCCGCCACCGCCCCGGG - Exonic
1156326470 18:36078403-36078425 CCGCCAGCCTCGGCCTCCCTAGG - Intergenic
1157383816 18:47246660-47246682 CCCGCCCCCGCCGCCGCCCCTGG - Intronic
1157384126 18:47247704-47247726 GCCCCCGCCTCAGCCGCCCTCGG - Intronic
1157384293 18:47248298-47248320 GCCGCCGCCACCGCCGCCCTTGG - Intronic
1157609639 18:48948652-48948674 GCGGCCGCAGCCGCCGCGCTCGG + Intronic
1157614087 18:48976524-48976546 CGGAGCGCCGCCGCCTCCCTGGG + Intergenic
1158435948 18:57435679-57435701 CCCGCCGCCCCCGCCGCCCCCGG + Exonic
1158601010 18:58855617-58855639 CCGCCCGCCTCCACCCCCCAAGG + Intergenic
1158954142 18:62523556-62523578 GCCGCCGCCGCCGCCGCCCGCGG + Exonic
1158954159 18:62523598-62523620 GCCGCCGCCGCCGCCGCCCCGGG + Exonic
1159021231 18:63144871-63144893 ACCCCCGCCCCCGCCGCCCTGGG + Intronic
1159770867 18:72543894-72543916 CCGAGCGCTGCCGCCTCCCTAGG + Intronic
1160242394 18:77132899-77132921 GCGGCCGCCGGCGCCGCCCCGGG + Intronic
1160338471 18:78065066-78065088 CCGCCCGCCTCGGCCTCCCAAGG - Intergenic
1160455162 18:78994475-78994497 CTGCCCGCCCTCCCCGCCCTCGG + Exonic
1160577248 18:79863687-79863709 GGTCCCGCCGCCGCCGCCCGGGG - Exonic
1160649679 19:216798-216820 CCTCCCGCCTCAGCCACCCTAGG + Intergenic
1160711653 19:554476-554498 CCGCCCGCCTCAGCCTCCCAAGG + Intergenic
1160791198 19:924634-924656 CCGCCCACCTCCGCCTCCCAAGG + Intergenic
1160812977 19:1020934-1020956 CGGGCCGCCGCCGCCGCCGTTGG + Exonic
1160815062 19:1031328-1031350 CCGCCCCCCGCCACCACCCTCGG - Intronic
1160923891 19:1533827-1533849 CCTCCCGCAGCCGCCGCCGCAGG - Intronic
1160930594 19:1568014-1568036 GCCCCCGCCCCCGCCGCCGTCGG + Exonic
1161022140 19:2015537-2015559 GCCGCCGCCGCCGCCGCCCCTGG - Exonic
1161069655 19:2253722-2253744 GCAGCCGCCGCCGCCGCCCCCGG - Exonic
1161130975 19:2588532-2588554 CGTCCAGCTGCCGCCGCCCTGGG - Intronic
1161157415 19:2739900-2739922 CCGCCCCGCCCCGCCGCCCCAGG + Intronic
1161241156 19:3224699-3224721 CCGCCCGCCGCCGCCGCCGCCGG + Exonic
1161350070 19:3786392-3786414 CCGCGCGCCGCCGCCGCCGCCGG + Intronic
1161420353 19:4173213-4173235 CCGCCCGCCGCCGCTCTCCAAGG - Intergenic
1161703059 19:5805313-5805335 CCGCCCGCGGCCGCCCCCTCCGG + Intergenic
1161703244 19:5805936-5805958 CTGCTCGCCGCCGCCGCCGCCGG + Intergenic
1161707223 19:5827819-5827841 CCGCCCGACGGCGCGGACCTGGG - Exonic
1161973397 19:7596169-7596191 CGGCCCGCCGCCCCCGACCCCGG - Intronic
1162021158 19:7869234-7869256 GCCCCCGCCGCTGCCGCCCGCGG + Exonic
1162033205 19:7926051-7926073 CGGGCCGCCGCCGCCGCCGCCGG - Exonic
1162034119 19:7930090-7930112 CCGCCCGCCTCAGCCTCCCAAGG + Intronic
1162298842 19:9832295-9832317 CCGCCCGCCTCAGCCTCCCAAGG + Intergenic
1162330746 19:10027747-10027769 CCGCCCGCCTTCCCCTCCCTGGG - Intergenic
1162363117 19:10231260-10231282 GCCCCAGCCGCGGCCGCCCTGGG - Exonic
1162405430 19:10470198-10470220 CCGCCCGCCTCGGCCTCCCAAGG - Intergenic
1162524201 19:11197819-11197841 CCGCCCCCCGCAGCGGCCCAGGG - Intergenic
1162535827 19:11262449-11262471 CGTCCCGCCGCCGCCGCCCCGGG + Exonic
1162544411 19:11320059-11320081 CTGCCCGCCTCCGCCTCCCAAGG + Intronic
1162603800 19:11691753-11691775 CCGCCCGCCTCGGCCTCCCAAGG - Intergenic
1162741360 19:12775559-12775581 CCGCCCCGCCCCGCCCCCCTAGG + Intronic
1162790758 19:13061494-13061516 CCGCGCCCCGCCGCAGCCCTCGG + Intronic
1162959464 19:14117543-14117565 CCGGCCGCCGCCGCCGCGATGGG - Exonic
1162975789 19:14206509-14206531 CCGCCCGGCGGCGCCGCTCCGGG + Intergenic
1163012323 19:14433677-14433699 GCGCCCGGCGCCCCCTCCCTGGG + Intronic
1163029396 19:14534365-14534387 CCGCCCGCCTCGGCCTCCCAGGG + Intronic
1163262174 19:16197977-16197999 GCTGCCGCCGCCACCGCCCTCGG + Exonic
1163347129 19:16750238-16750260 ACGCCAGCCTCAGCCGCCCTGGG - Exonic
1163443795 19:17334779-17334801 GCGCCCGCCCGCGCCGGCCTCGG + Exonic
1163462844 19:17448938-17448960 CCGCCCGCCTCGGCCTCCCAAGG - Intronic
1163495368 19:17643560-17643582 CCGCCCGCCTCGGCCTCCCAAGG + Intronic
1163515648 19:17761900-17761922 CCGCCCGCCTCAGCCTCCCAAGG + Intronic
1163551170 19:17967152-17967174 GCGCCTGCCGCCGCCGCCCCCGG + Intronic
1163577162 19:18117789-18117811 CGCCCCGCCCCCGCCGCCCGCGG + Intronic
1163581957 19:18144547-18144569 CCGGCCGGGGCCGCCGCCTTGGG + Exonic
1163601451 19:18251684-18251706 CCCGCCCCCGCCCCCGCCCTCGG + Intronic
1163743891 19:19033488-19033510 CCCGCCGCCGCCGCCGCGCGAGG + Intronic
1165080113 19:33302103-33302125 GCCGCCGCCGCCGCCGCCCGTGG + Exonic
1165345680 19:35247982-35248004 CCGCGCCGCGCCCCCGCCCTCGG + Intergenic
1165349788 19:35269308-35269330 CCGCCCCCGGCCCCCGGCCTCGG + Intronic
1165493945 19:36141118-36141140 GCCGCCGCCGCCGCCGCCCCCGG - Exonic
1165546582 19:36542115-36542137 CCGCCCGCCTCAGCCTCCCAAGG - Intronic
1165829815 19:38724758-38724780 CCGCCCGCCTCAGCCTCCCCAGG - Intronic
1165928697 19:39342687-39342709 CCGCCCGCCGCCGCCGCCCGCGG - Intronic
1166121803 19:40691026-40691048 CTGCCCGCCCCCGCCGGGCTGGG - Intergenic
1166189919 19:41169728-41169750 CCGCCCGCCTCGGCCTCCCAAGG + Intergenic
1166817100 19:45552917-45552939 CCGCCCGCCTCGGCCTCCCAAGG + Intronic
1167071220 19:47223025-47223047 CCGCCCGCCTCGGCCTCCCAAGG - Intronic
1167072326 19:47228214-47228236 CCCGCCGTCACCGCCGCCCTGGG - Exonic
1167076937 19:47256095-47256117 CCGCCCGCCTCGGCCTCCCAAGG + Intronic
1167077131 19:47256813-47256835 CCGCCCACAGCCGCCGGCCCAGG - Intronic
1167242472 19:48352529-48352551 CCGCCCGCCTCGGCCTCCCAAGG - Intronic
1167328375 19:48838518-48838540 CCGCCCGCCTCGGCCTCCCAAGG - Intronic
1167428846 19:49443010-49443032 CCGCCCACCGCCTCCGCCTCTGG + Intergenic
1167703618 19:51065605-51065627 CCGCTCCCCGCCCCCGCCCCAGG + Intergenic
1167975386 19:53222513-53222535 CCGCCAGCCTCCGCCTCCCGAGG + Intergenic
1168064058 19:53909425-53909447 CCGGCCGCCGCCGCCGCCACCGG - Exonic
1168071949 19:53958425-53958447 CCGGCCGCCGCTGCCAGCCTTGG + Intergenic
1168092647 19:54095832-54095854 CGGCCCGCCTCCTCCGCCCCAGG - Exonic
1168154696 19:54466197-54466219 CCGCCCGCCTCGGCCTCCCAAGG - Intronic
1168247005 19:55117491-55117513 GCAGCCGCCGCCGCCGCCCCCGG + Exonic
1168297302 19:55383736-55383758 CTGCCCGCGCCCGCCGCCCCGGG + Exonic
1202710974 1_KI270714v1_random:19205-19227 CCCAGCGCCGCCGCCGCCCACGG - Intergenic
925068909 2:951015-951037 CCGCCCCCGGCCGCCTCCCGCGG + Exonic
925417700 2:3682766-3682788 CCGCCCGCCTCGGCCTCCCAAGG + Intronic
925450723 2:3967333-3967355 CCGCCCGCCTCGGCCTCCCAAGG - Intergenic
925731587 2:6922865-6922887 CCGCCCGCCTCGGCCTCCCAAGG + Intronic
925984961 2:9207553-9207575 CCGCCGCCCGCCGCCGCCCGGGG + Intronic
926104052 2:10139230-10139252 CCGTCTGCCGCCTCAGCCCTGGG + Intergenic
926684150 2:15685589-15685611 CCGCCCGCCTCAGCCTCCCAAGG - Intergenic
927176767 2:20415433-20415455 CCGCCCGCCTCGGCCTCCCGAGG + Intergenic
927552136 2:24010061-24010083 CCGCCCGCGGCCGTTGCCCTCGG - Exonic
927809378 2:26173132-26173154 GCGCCCGCCGCCACCTCCCGGGG - Exonic
927904616 2:26847942-26847964 CCGCGCGCCGCCGCCGCCTGGGG - Intronic
927943995 2:27123788-27123810 CCGCCCACCGCCGGTGCCCCGGG - Intronic
928556184 2:32427527-32427549 CCGCCCGCCTCCGTCTCCCAAGG + Intronic
929151232 2:38750916-38750938 CCCCCCTCCCCCCCCGCCCTCGG - Intronic
929188696 2:39120706-39120728 CGGCCCGCCGGCGCCGCCCCGGG + Intronic
929218038 2:39436856-39436878 CCGCGCGCCGCCGAGGCCGTGGG - Intronic
929665956 2:43833925-43833947 CCGCCCGCCTCGGCCTCCCAAGG + Intronic
929730013 2:44478940-44478962 CCGCCCGCCTCGGCCTCCCAAGG + Intronic
929857788 2:45650926-45650948 CCGCCCGCCGCTGCGACCCCGGG + Intergenic
929892899 2:45933717-45933739 CCGCCCGCCTCGGCCTCCCAAGG + Intronic
930358223 2:50346884-50346906 GCCGCCGCCGCCGCCGCCCCCGG + Intronic
931374412 2:61694815-61694837 CCGCCCCACCCCGCCTCCCTTGG - Intergenic
931517807 2:63059866-63059888 CCGCCGTCCCCCGCCGCCCCCGG - Intergenic
931671692 2:64653716-64653738 CCGCTCCCCGGCGCCACCCTCGG - Exonic
931903884 2:66821762-66821784 CCGCCCGCCTCAGCCTCCCAAGG + Intergenic
932607674 2:73175833-73175855 GCGCCCGCCCCCGCCGCCGCGGG - Intergenic
932696563 2:73961785-73961807 CCGCCCGCCTCGGCCTCCCTAGG - Intergenic
933739020 2:85518366-85518388 CCGCCCGCCTCAGCCTCCCAAGG + Intergenic
933762590 2:85682654-85682676 CCACCCGCCTCCGCCTCCCAGGG - Intergenic
934079031 2:88452228-88452250 CCGCCTGCCGCCGGCACCTTCGG - Exonic
934098226 2:88627138-88627160 CCGAACGCCGCCTCCGCCGTCGG + Exonic
934763927 2:96870014-96870036 CCGCCCGGCTCCGCGCCCCTAGG + Intronic
934993150 2:98935759-98935781 ACCCCCGCCGCCGAAGCCCTGGG - Intronic
935301614 2:101697926-101697948 GAGCCCGCCGCCGCCGCCCGCGG + Intronic
935904966 2:107829680-107829702 CCGCCCGCCGCGGTCCCCCCAGG - Intronic
936104710 2:109614392-109614414 CCGCCAGACTCCGCCGCCGTCGG + Exonic
936105047 2:109615703-109615725 GCGCCCGCCGCCGCTACCCGCGG - Exonic
936122699 2:109760437-109760459 GCCGCCGCCGCCGCCGCCCCCGG - Intergenic
936126743 2:109794752-109794774 CCGCCCGCCGCGGTCCCCCCAGG - Intronic
936217954 2:110576734-110576756 CCGCCCGCCGCGGTCCCCCCAGG + Intronic
936330445 2:111543090-111543112 CCGCCCGCCTCAGCCTCCCAAGG + Intergenic
936427291 2:112432808-112432830 CCGCCCGCCGCGGTCCCCCCAGG + Intronic
936433181 2:112482008-112482030 CCCTGCGCCGCCGCCGCCCCCGG + Intergenic
936871495 2:117138292-117138314 CCGCCCGCCTCGGCCTCCCAAGG + Intergenic
937134913 2:119544372-119544394 CAGCCCGGCTCCCCCGCCCTGGG + Intergenic
937221248 2:120344394-120344416 CCGCCGGCGGCTGCCGCTCTGGG - Intergenic
938296598 2:130182803-130182825 CCGCCCGCCACCCCCGCCACTGG - Intronic
938460150 2:131491826-131491848 CCGCCCGCCACCCCCGCCACTGG + Intronic
938837994 2:135127583-135127605 CCGCCCGCCTCGGCCTCCCAAGG + Intronic
939065086 2:137473449-137473471 CCGCCCGCCTCGGCCTCCCAAGG + Intronic
939432658 2:142130785-142130807 CCTGCCGCCGCCGCCGCCGCCGG - Exonic
940510049 2:154602336-154602358 CCGCCCGCCTCGGCCTCCCAAGG + Intergenic
940541946 2:155031318-155031340 CCGCCCGCCTCAGCCTCCCAGGG + Intergenic
940971973 2:159904797-159904819 GGCCCCGCCCCCGCCGCCCTCGG + Intergenic
941119112 2:161507856-161507878 CCCGCCGCCGCCGCCGCCGCGGG + Intronic
941732379 2:168932864-168932886 CCGCCCGCCTCGGCCTCCCAAGG - Intronic
941951308 2:171160201-171160223 CCCCCCGCCCCCCCCGCCCCGGG - Intronic
943060558 2:183038193-183038215 CCGCCCGCGACCTCCGCCTTAGG + Exonic
943541787 2:189224443-189224465 CCGCCCGCCTCAGCCTCCCAAGG - Intergenic
943571507 2:189580772-189580794 GCCGCCGCCGCCGCCGCCGTGGG + Exonic
943583810 2:189714701-189714723 CCGCCCGCCTCAGCCTCCCAAGG - Intronic
945080927 2:206085670-206085692 CCGCCCGCCGTCGCCGCCCGCGG + Intronic
945465987 2:210171231-210171253 CCGCCCGCCTCCCCCACCCGGGG + Exonic
946747558 2:222861168-222861190 ACGCCCCGCGCCGCCGCCCGGGG - Exonic
946921257 2:224584664-224584686 CCGGCCGCAGCCGACGCCCGCGG + Intronic
947117932 2:226791638-226791660 CCGCCCGCCACCACCGCCAGGGG + Intronic
947860529 2:233354563-233354585 GCCTCCGCCGCCGCCGCCCGAGG + Exonic
947992158 2:234496682-234496704 CCGCCCGCCGCCGCCCGCACCGG + Exonic
948054702 2:235002480-235002502 CCGCCCGCTTCAGCCTCCCTTGG - Intronic
948115996 2:235494562-235494584 CCGCCCGCCGCCGGCGGGCCCGG + Exonic
948455965 2:238104795-238104817 CTGCACGCTGCCGCCGCCCGTGG + Exonic
948487265 2:238288824-238288846 CCGCCCCCGGCCTCCGCCATTGG + Intronic
948645320 2:239400691-239400713 CCGGCCGCCGCCGCCCGCCGCGG - Exonic
948801583 2:240435737-240435759 CCCCGCGCCGCCGCCGCCGCCGG + Exonic
948959559 2:241322360-241322382 CCGCCCGCCTCAGCCTCCCAAGG - Intronic
1168795893 20:610060-610082 CCGCCCGCCGCCCGCCCCCGGGG + Exonic
1168867483 20:1100336-1100358 CCACCCGCCTCGGCCTCCCTTGG + Intergenic
1170158417 20:13289027-13289049 CCGCCCGCCTCAGCCTCCCAAGG + Intronic
1170221818 20:13949419-13949441 CCGCCTGCCTCCGCCTCCCAAGG - Intronic
1170889971 20:20368423-20368445 GCTGCCGCCGCCGCCGCCCGCGG + Exonic
1171427527 20:25058067-25058089 CCTCCCGACGCCGCGGCCCAGGG + Exonic
1172702889 20:36863579-36863601 CCGCCCGGCGCCCGCCCCCTCGG + Exonic
1172753035 20:37264313-37264335 CCGCCCGCCTCAGCCTCCCAAGG - Intergenic
1173322259 20:41998696-41998718 CTGCGCGGCGCCGCAGCCCTGGG + Intergenic
1174016402 20:47491929-47491951 CTGCCCGCCTCAGCCTCCCTAGG - Intergenic
1174027286 20:47588376-47588398 CCGCCCGCCTCTGCCTCCCAAGG + Intronic
1174191992 20:48747403-48747425 CCGGCCCCCGCTCCCGCCCTGGG - Intronic
1174204338 20:48828018-48828040 CCGCGCGCTGCCTCCGCCCCCGG - Intergenic
1174381999 20:50161992-50162014 CCGCCCGCCTCGGCCTCCCAAGG + Intergenic
1174791727 20:53484627-53484649 CCGCCCGCCGTTGCCTCCCAAGG + Intronic
1175108575 20:56630621-56630643 CCGCCACCCTGCGCCGCCCTGGG - Intronic
1175367717 20:58467216-58467238 CCGCCTGCAGCCGCAGCCCCGGG - Exonic
1175429538 20:58891709-58891731 GCCGCCGCCGCCGCCGCCATGGG + Intronic
1175461669 20:59156280-59156302 CCGCTCGCCTCAGCCTCCCTGGG - Intergenic
1176143256 20:63554222-63554244 CCGGCCCCCGCCGCCGCCCCAGG - Exonic
1176179735 20:63743604-63743626 CCGTCGGCCGCCGCCACCCCAGG + Intergenic
1176194402 20:63830836-63830858 CCGCCCCGCGCCGCCGGCCTGGG + Intronic
1176194607 20:63831385-63831407 CCGGCCGCGGCCACCGCCCCGGG + Intergenic
1176207110 20:63895198-63895220 GCCGCCGCCGCCGCCGCCCGGGG + Exonic
1176213520 20:63937600-63937622 CCGCCCGCCTCGGCCTCCCAGGG + Intergenic
1176380481 21:6110311-6110333 CCGCCCGCAGCGTCCGCCCGGGG + Intergenic
1176737058 21:10559628-10559650 CCGCCCGCCTCGGCCTCCCAGGG - Intronic
1177188113 21:17819672-17819694 CCGCCTGCGGCCCCCGCCCCGGG - Intergenic
1177605359 21:23370718-23370740 CCGCCCGCCTCAGCCTCCCAAGG - Intergenic
1177960222 21:27655562-27655584 CCGCCCGCCTCGGCCTCCCAAGG + Intergenic
1178104083 21:29299117-29299139 CCGGCCGCCGGCGCCCCCCGCGG - Intronic
1178334668 21:31732277-31732299 GCGGCCGCCGCCGCCGCCGGCGG - Intergenic
1179549463 21:42134865-42134887 CCGCCCGCCTCAGCCTCCCAAGG + Intronic
1179561592 21:42219237-42219259 GCCGCCGCCGCCGCCGCCCCCGG + Exonic
1179742991 21:43427929-43427951 CCGCCCGCAGCGTCCGCCCGGGG - Intergenic
1179784054 21:43719692-43719714 CCGCCCGCCCCCGCGGCAGTTGG - Intronic
1179810253 21:43865393-43865415 CCACGCCCCGCCGCCGCCCGAGG + Intronic
1180064234 21:45404916-45404938 TCGCCCGTCCCCGCCGCCCCCGG + Intergenic
1180110261 21:45644026-45644048 CCGACCGCCGCCGGCGCCTGCGG + Intronic
1180762312 22:18219921-18219943 CCGCCCGCCTCCTGCGTCCTGGG - Intergenic
1180773355 22:18404687-18404709 CCGCCCGCCTCCTGCGTCCTGGG + Intergenic
1180804708 22:18654236-18654258 CCGCCCGCCTCCTGCGTCCTGGG + Intergenic
1180806038 22:18715174-18715196 CCGCCCGCCTCCTGCGTCCTGGG - Intergenic
1180910690 22:19447864-19447886 GCGCGCGCCGCAGCCGCCCTCGG - Exonic
1180949384 22:19714394-19714416 CCGCCCCCCCGGGCCGCCCTGGG + Intergenic
1180960677 22:19761024-19761046 CCGTGCGCCGCCGCCGCCCCCGG + Exonic
1181094360 22:20495634-20495656 GCGCCCGCCCCCGCGCCCCTCGG + Intronic
1181192451 22:21151620-21151642 CCGCCCGCCTCCTGCGTCCTGGG + Intergenic
1181216988 22:21340955-21340977 CCGCCCGCCTCCTGCGTCCTGGG - Intergenic
1181530790 22:23516210-23516232 CCGCCCGCCTCGGCCTCCCAAGG + Intergenic
1181590279 22:23879968-23879990 CTGCCCGCCTCAGCCTCCCTGGG - Intronic
1182122665 22:27797715-27797737 CCGTCCCCGGCCGCCGCCCCCGG + Exonic
1182355372 22:29720334-29720356 CCGCCCGCTCCAGCCGCCCCCGG + Exonic
1183149732 22:36028364-36028386 GGGCCCGGCGCCGCCGCCCGGGG - Exonic
1183201413 22:36387758-36387780 CCGCCCGCCGCCGCCTGCCCGGG + Intronic
1183427225 22:37746384-37746406 CCTCCTGCTCCCGCCGCCCTGGG + Intronic
1183437727 22:37805045-37805067 CTGCTCCCCGCCGCCGCCCTGGG - Intergenic
1183466664 22:37983665-37983687 CGATCCGCCGCCGCCGCCGTCGG + Exonic
1183560790 22:38570711-38570733 CCCCCCGCCCCCGCTGCCCATGG + Intergenic
1183612633 22:38920799-38920821 CCGCCCGCCTCGGCCTCCCAAGG - Intergenic
1183665567 22:39244119-39244141 CCCCCGGGCGCCGCCGCCCCCGG + Exonic
1183695128 22:39417375-39417397 CCGCCCGCCTCGGCCTCCCAAGG - Intronic
1183702236 22:39457289-39457311 CGGGCCCCCGCCGCCGCCCCGGG + Intergenic
1183708417 22:39488860-39488882 CCGCCCGCCGCCGTGCTCCTGGG - Exonic
1183831115 22:40418723-40418745 GCCCCCGCCCCCGCCCCCCTCGG - Exonic
1183898051 22:40984724-40984746 CCGCCCGCCTCGGCCTCCCAAGG - Intergenic
1184265303 22:43343139-43343161 GCGCCCGCCGCCCCCCACCTCGG + Intronic
1184680402 22:46070018-46070040 CAACCCCCCGCCGCCGGCCTTGG - Intronic
1184690824 22:46116562-46116584 CCGCCAGCCACCCCCGCCTTCGG + Intergenic
1184698019 22:46150540-46150562 CCGCCCGCTGCCCCCGCCGCGGG - Intronic
1184698033 22:46150589-46150611 CTGCCCGGCGCCGCCTCCTTCGG + Intronic
1184712818 22:46263120-46263142 CCGCCCGCCCGCACCGCGCTGGG + Exonic
1184840569 22:47050246-47050268 CCGCCCGCCTCGGCCCCCCAGGG + Intronic
1185341249 22:50292092-50292114 CCGCCCGCCTCGGCCTCCCAAGG - Intronic
1185388406 22:50546924-50546946 CCATCCGCCGCCGCCGGCCCCGG - Intergenic
1185409411 22:50674361-50674383 CCCCCCGCCGCCCCCGCCCCCGG + Intergenic
1203235185 22_KI270731v1_random:145669-145691 CCGCCCGCCTCCTGCGTCCTGGG + Intergenic
949091990 3:39474-39496 CCGCCCGCCTCGGCCTCCCAAGG - Intergenic
949338786 3:3006117-3006139 CCGCCCGCCTCGGCCTCCCAAGG + Intronic
949414242 3:3799304-3799326 CGGCCTCCCGCCCCCGCCCTCGG - Intronic
949414383 3:3799850-3799872 GCTGCCGCCGCCGCCGCCGTGGG + Exonic
949987522 3:9552697-9552719 CCGCCAGCCGCCGCCGCCGCCGG - Exonic
950316389 3:12004933-12004955 GTGCCGGGCGCCGCCGCCCTCGG + Intronic
950421244 3:12901084-12901106 CGGCCACCCGCCGCTGCCCTCGG - Intronic
951080301 3:18444721-18444743 CCTGCCGCCGCCGCCGCCGCCGG + Intronic
951328993 3:21343016-21343038 CCGCCCGCCTTGGCCTCCCTGGG - Intergenic
951536793 3:23747295-23747317 CCGCCCGCCTCAGCCCCCCAAGG + Intergenic
952744450 3:36764221-36764243 CCCGCAGCCGCCGCCGCCCCCGG - Intergenic
952867192 3:37862004-37862026 GCTCCCGCCGCCGCCGCCGCTGG - Intronic
953618216 3:44510716-44510738 CCGCCCGCCGCCAGCGGCCCTGG - Intergenic
953668852 3:44945798-44945820 CCGCCCGCCTCAGCCTCCCAAGG + Intronic
954076867 3:48188032-48188054 CCGCGCGCCACCGGCGCCCGCGG + Exonic
954158382 3:48701321-48701343 CCGCCCGCCTCAGCCTCCCAGGG - Intronic
954277951 3:49554651-49554673 CCGCCCGGCGGCGCCGGCCCCGG + Exonic
954415043 3:50389154-50389176 CCGGCCTCCGCCCCCGCCCCAGG - Intronic
955246267 3:57227800-57227822 CCGCCCGCCGCAGCTGACCCCGG - Exonic
955271296 3:57502148-57502170 CCGCCCGCCTCGGCCTCCCTGGG + Intronic
955687517 3:61561931-61561953 CTGCTCGCCGCCGCCGCCCGCGG + Exonic
955703909 3:61708698-61708720 CCGCCCGCCTCGGCCTCCCAAGG + Intronic
955911598 3:63864011-63864033 GCGCCGGCCGCGGCCGCCCCCGG - Intergenic
955916387 3:63912316-63912338 CGGCCCGCCACCGCGGCGCTGGG - Intronic
955942961 3:64164127-64164149 CCGCCCGCCTCAGCCCCCCAAGG - Intronic
956418100 3:69054280-69054302 CCACCCCCCCCCGCCCCCCTCGG - Intergenic
957389593 3:79546936-79546958 CCGCCCGCCTCGGCCTCCCAAGG - Intronic
958785550 3:98593400-98593422 GAGCCCTCCGCCGCCGCACTGGG + Exonic
959085816 3:101849743-101849765 TCGCCGCCCGCCGCCGCCCCGGG + Exonic
963107620 3:141660273-141660295 CTCCCCGGCGCCGGCGCCCTGGG + Intergenic
963236737 3:142963695-142963717 GCCTCCGCCGCCGCCGCCCCCGG + Intergenic
963733124 3:148991659-148991681 CAGCCCGCCGCCGCCAGCCCCGG + Intronic
964265390 3:154889502-154889524 CCGGCTGGCGCCGCCGGCCTCGG - Intergenic
965277382 3:166703281-166703303 CTGCCCGCCTCCGCCTCCCAAGG - Intergenic
965312638 3:167149919-167149941 CCGCCCGCCTCGGCCTCCCAAGG - Intergenic
965575913 3:170218162-170218184 CCGCCCGCCTCAGCCTCCCAAGG + Intergenic
965819949 3:172675064-172675086 CCGCCCGCCTCGGCCTCCCAAGG - Intronic
966402957 3:179565191-179565213 CCGCCCGCCTCGGCCTCCCAAGG - Intronic
966411771 3:179652896-179652918 CCGCCCCCCGCCGCCGCGCCCGG + Exonic
966482147 3:180422771-180422793 CCGCCCGCCTCGGCCTCCCAAGG - Intergenic
966814286 3:183876966-183876988 CCGCCCGCCTCGGCCTCCCAGGG - Intronic
966849420 3:184155513-184155535 CCGCCAGCAGCCGCCGAGCTGGG + Exonic
966872303 3:184299068-184299090 CCGCCCTCGGACCCCGCCCTCGG - Exonic
966913006 3:184569620-184569642 CCTCCCGCTGCCGCAGCCCCTGG - Intronic
967183660 3:186928049-186928071 CCGCCCGCCTCGGCCTCCCAAGG + Intergenic
967963747 3:194944710-194944732 CCGCCCGCCTCGGCCTCCCCAGG + Intergenic
968161641 3:196432028-196432050 CCGTCCGCCCCCGCCGGCCCGGG - Intronic
968225434 3:196969518-196969540 CCGCGCGCCGTCGCCGACCCCGG - Intergenic
968368172 3:198203333-198203355 CCTCCCGCCTCAGCCACCCTAGG - Intergenic
968479218 4:826311-826333 CCACCCCCCGCCCCCGCCCCGGG - Intergenic
968479235 4:826336-826358 CCGCCCCCCGCCCCCGCCCCCGG - Intergenic
968479258 4:826373-826395 CCACCCCCCGCCCCCGCCCCGGG - Intergenic
968479289 4:826421-826443 CCGCCCCCCGCCCCCGCCCCCGG - Intergenic
968485702 4:860181-860203 CCTCCCACCGCAGCCCCCCTGGG - Intronic
968485723 4:860238-860260 CCTCCCACCGCAGCCCCCCTGGG - Intronic
968515139 4:1012543-1012565 CCGCCGGCCGCCGCCGCCCGAGG + Exonic
968659593 4:1793601-1793623 TTTGCCGCCGCCGCCGCCCTGGG + Intronic
968659640 4:1793710-1793732 CCCGCCGCCGCCGCCGCCCAGGG - Intronic
968758671 4:2429832-2429854 CCGCCCGCCTCGGCCTCCCAAGG + Intronic
968775395 4:2536856-2536878 CCGCCCTCCGCCGCCGCCCGCGG + Intronic
969379780 4:6786937-6786959 CCGCCCGCCTCGGCCTCCCAAGG - Intronic
969381001 4:6797826-6797848 CCGCCCGCCTCGGCCTCCCAAGG - Intronic
969457085 4:7306304-7306326 CCGCCCTCCCCCTCCACCCTCGG - Intronic
970445308 4:16118994-16119016 CCTCCCGCCTCAGCCTCCCTGGG - Intergenic
970456302 4:16226819-16226841 CCGCCCGCCGCCGCCATCCCCGG - Intronic
970574566 4:17414462-17414484 CTGCCCGCCCGCGCCGCACTCGG - Intergenic
970967872 4:21948843-21948865 CCGCGCGCCCCCGCCGCCAAGGG - Intergenic
971327432 4:25655739-25655761 CCGCCTGCCGCAGCCGCCGCCGG - Intronic
971406014 4:26321180-26321202 CACGCCGCCGCCGCCGCGCTCGG - Intronic
971635143 4:29047800-29047822 CCAGCCGCCGCCCCCGCCGTGGG + Intergenic
972259096 4:37390031-37390053 CCGCCCGCCTCAGCCTCCCAAGG + Intronic
972312200 4:37891537-37891559 CCCCCCACCCCCGCCGCCCTTGG + Intronic
972321614 4:37977525-37977547 CCGCCCGACGCCGCCTACCTTGG - Intronic
972765791 4:42151704-42151726 CCGGCGGCCGCCGCCGCGCCTGG + Exonic
972960648 4:44448420-44448442 GCGTCGGCCGCCGCCGCCCCGGG - Exonic
973056543 4:45666413-45666435 CCGCCCGCCTCAGCCTCCCAAGG + Intergenic
975858195 4:78647087-78647109 CCGCCCGCCTCGGCCTCCCAAGG + Intergenic
975986046 4:80202411-80202433 CCGCCCTCCGCCGCCTCCTCCGG - Exonic
976256148 4:83102841-83102863 CCGCCCGCCTCGGCCTCCCAAGG - Intronic
977182846 4:93898796-93898818 CCGCCCGCCTCAGCCTCCCAAGG + Intergenic
977606949 4:98993748-98993770 CCGGCCGGCCCCGCCGGCCTCGG - Intergenic
977908226 4:102501457-102501479 CCGCCAGCCGCCGCAGCCCTCGG + Exonic
978126954 4:105146594-105146616 CCGGCCTGCGCCGCCGCCCTGGG - Exonic
978777206 4:112516022-112516044 CGGGCCGCCGCCGCCGCCGCCGG - Exonic
979231506 4:118352913-118352935 CCACCCGCGGCCGCCGCCAGGGG - Exonic
979256599 4:118613061-118613083 CCTCCCGCCTCAGCCACCCTAGG - Intergenic
979331750 4:119427484-119427506 CCTCCCGCCTCAGCCACCCTAGG + Intergenic
980930279 4:139177435-139177457 CCGCGGGGCCCCGCCGCCCTCGG + Intergenic
981128404 4:141132624-141132646 CCGCCCGCCGCCCCGGCCCCGGG + Exonic
981270743 4:142845722-142845744 GCCGCCGCCGCCGCCGGCCTGGG - Intronic
981300935 4:143185180-143185202 CCGTACTCCGCCGCCGCCCCGGG - Exonic
982033674 4:151325426-151325448 GCGCCCCACGCCACCGCCCTCGG + Intronic
982143646 4:152357562-152357584 CCGCCCGCCTCAGCCTCCCAAGG + Intronic
982157215 4:152535275-152535297 CCCCCCGGCCCCGCCGCCCTCGG + Exonic
982712206 4:158768943-158768965 CGCGCCGCCGCCGCCGCCGTGGG + Intergenic
984928394 4:184826114-184826136 CCGCCCGCAGGCCCCGCCCCCGG + Intronic
985171297 4:187153150-187153172 CCGCCCGCCTCAGCCTCCCAAGG - Intergenic
985173485 4:187176715-187176737 CCGCCCGTGGCTGCCGCCCGTGG + Intergenic
985611626 5:892653-892675 CCCGCCGCCGGCGCCGCCATGGG - Exonic
985713722 5:1444702-1444724 CGGCAAGCCGCCGCCGCCCTGGG + Intronic
985906009 5:2837367-2837389 CCGCCCACCTCCGCCTCCCAAGG - Intergenic
986330550 5:6713743-6713765 CCGCCCGCCGCGGCCTGCCGGGG + Intergenic
987050407 5:14143573-14143595 CCGCCGCCCCCCGCCGCCCCGGG + Intergenic
987374215 5:17218564-17218586 GCGCCAGGCGCCTCCGCCCTGGG + Intronic
987386092 5:17330971-17330993 CCGCCCGCCTCAGCCTCCTTAGG - Intergenic
988821436 5:34890078-34890100 CCACCCGCCTCAGCCTCCCTAGG + Intronic
989643189 5:43603157-43603179 CCGCCCGCCGCCGCGGAGTTGGG + Intronic
991056742 5:62328733-62328755 CCGCCCGCCTCAGCCTCCCAAGG + Intronic
991435907 5:66596841-66596863 GCCGCCGCCGCCGCCGCCGTTGG + Exonic
992300966 5:75379824-75379846 CCGCCCGCCTCAGCCTCCCAAGG + Intronic
992726552 5:79612811-79612833 CCGTGCCCCGCCGCCGACCTGGG - Exonic
993770417 5:91918056-91918078 CCGCCCGCCACTGCTGGCCTGGG - Intergenic
994043580 5:95284547-95284569 TCGCCCGCCGCGGCAGCCCGGGG + Exonic
994229969 5:97301288-97301310 CCCTCCGCAGCCGCTGCCCTGGG - Intergenic
994251531 5:97542141-97542163 CCGGCTGGCCCCGCCGCCCTGGG - Intergenic
995724675 5:115170237-115170259 CCCCGCCCCGGCGCCGCCCTCGG - Intronic
995809081 5:116084982-116085004 CCGTCCGCCGCGGCCGCCATTGG + Exonic
995895095 5:117002646-117002668 CCGCCAGCCTCAGCCTCCCTAGG - Intergenic
996316673 5:122168285-122168307 CCGCCCGCCTCGGCCTCCCCTGG + Intronic
996530382 5:124521720-124521742 CCGGCCGCCGCTGCCGGCCCTGG + Intergenic
996549551 5:124715898-124715920 CCGCCCGCCTCGGCCTCCCAAGG - Intronic
997297527 5:132777270-132777292 TCTCCCGCCGCCGCCGCCAAGGG - Exonic
997382645 5:133448723-133448745 CCCCCCGCCCCCGCACCCCTGGG - Intronic
997583978 5:135034036-135034058 CCGCCCGGCGCCGCAGCCCCGGG - Exonic
997675189 5:135707509-135707531 ACTCCCGCCGCCCCCGCCCTTGG + Intergenic
997899626 5:137753416-137753438 GTAACCGCCGCCGCCGCCCTTGG + Exonic
997899646 5:137753473-137753495 CCGGCCGCCTCGGCCGCCCCGGG + Exonic
997910678 5:137870043-137870065 CCTCCCGCCTCAGCCCCCCTTGG - Intronic
997965480 5:138352880-138352902 CCGCTCGCCGCTGCCGCCGCGGG - Exonic
998018854 5:138753394-138753416 CCGCCCCACGCCCCCGCCCCCGG - Intronic
998119048 5:139561361-139561383 CCGCCCGCCCGCGCGTCCCTCGG + Exonic
998131858 5:139655431-139655453 CCACCCCCCGCCGCCCCCCTGGG + Intronic
999313766 5:150570592-150570614 CCACCCGCCGCCGCCTCCTGGGG - Intergenic
1000220468 5:159209320-159209342 CCGGCCCCCGCCGCCGCCCGAGG - Intronic
1001506435 5:172283900-172283922 CCGCGCGCCGCCCTCGCCTTCGG + Exonic
1002020132 5:176358839-176358861 CCGCCCGCCTCGGCCTCCCAAGG - Intronic
1002055814 5:176597404-176597426 CGCCCCGCCGCCGCCGCGCGAGG - Exonic
1002421254 5:179150200-179150222 CCGCCCGCCGCACCCACCCCAGG - Intronic
1002530696 5:179842787-179842809 CCGCCCGCCTCAGCCTCCCACGG - Intronic
1002635087 5:180603317-180603339 CAGGCCGCCGCCGCCTCCCTTGG + Exonic
1002666773 5:180831185-180831207 CCCGCCGCCGCCGCCGCCTCGGG + Intergenic
1002727391 5:181308560-181308582 CCTCCCGCCTCAGCCACCCTAGG - Intergenic
1002927139 6:1611163-1611185 CTGTCCCCGGCCGCCGCCCTGGG + Exonic
1003163453 6:3655852-3655874 CCCCCCACCGCCGCCCCCCCGGG + Intergenic
1003206840 6:4020542-4020564 CCGCCCGCCTCGGCCTCCCAAGG + Intergenic
1003544902 6:7051438-7051460 CTCCGCGCCGCAGCCGCCCTCGG - Intergenic
1003681221 6:8259000-8259022 CCGCCCGCCTCGGCCCCCCAAGG - Intergenic
1003870384 6:10398270-10398292 GCCGCCGCCGCCGCTGCCCTTGG - Exonic
1003874865 6:10426285-10426307 CCGCCTCCCGCCGCAGCCCAAGG - Intergenic
1003897022 6:10617278-10617300 CCGGCCGGCCCCGCCGCCCGGGG - Intronic
1004216792 6:13711274-13711296 CCCTCCGCCGCCGCCGCCCCCGG - Exonic
1004721459 6:18271281-18271303 CCGCCCGCCTCGGCCTCCCAAGG + Intergenic
1005607544 6:27489724-27489746 CCGCCCGCCTCAGCCTCCCAAGG - Intergenic
1006472660 6:34237335-34237357 CCCTCCGCCGCCGCCGCCGCGGG - Intronic
1006543399 6:34758781-34758803 CCGCCCGCCTCGGCCTCCCAAGG - Intronic
1006563137 6:34931120-34931142 CCGCCCGCCTCAGCCTCCCAAGG + Intronic
1006725497 6:36196788-36196810 CCGGCCGCCGCCGCCGCTCCCGG - Exonic
1007099326 6:39234041-39234063 CCGCCCGCCTCGGCCTCCCAAGG - Intergenic
1007444513 6:41895020-41895042 CCTCCCGCCGCCCCCGCCCCGGG + Intronic
1007605362 6:43114037-43114059 CCACCCGCCCCAGCAGCCCTGGG - Intronic
1007901697 6:45419886-45419908 CCGCCTGCCACTGCCACCCTCGG - Intronic
1008965816 6:57311781-57311803 CTGCCCGCCTCCGCCTCCCGAGG - Intergenic
1009431777 6:63573080-63573102 GTGACCGCCGCCTCCGCCCTTGG + Intronic
1010001514 6:70954905-70954927 CCGCCCCCCCCCGCCGCCCCCGG - Intronic
1010083103 6:71886723-71886745 CTGCCCGCCCCCGCCGGCCGAGG + Intronic
1010756531 6:79671774-79671796 CTGCCTGCCCCCGCCACCCTAGG + Intronic
1010988674 6:82454599-82454621 CCGCCCGCCTCAGCCTCCCGAGG + Intergenic
1011075270 6:83431400-83431422 CCGCTCCCTGCCCCCGCCCTGGG - Intergenic
1011448991 6:87473051-87473073 TCGCCCGCCGCCGCCCCCCGCGG - Intronic
1011601035 6:89060719-89060741 CCGCCCGCCTCGGCCTCCCAAGG + Intergenic
1011734035 6:90295489-90295511 CCGCCCGCCGCCGTCTCCAGCGG + Intronic
1011734439 6:90297034-90297056 CCGCCCCCCGCCCCAGCCCCCGG - Intergenic
1011765135 6:90611470-90611492 CCGCCCGGCGCCTAAGCCCTGGG - Intergenic
1012399997 6:98835070-98835092 GCCCCCGCCGCCGCCGCCGTGGG - Exonic
1012975475 6:105777165-105777187 CCGCCCGCCTCAGCCTCCCGAGG - Intergenic
1013030342 6:106326330-106326352 CCGCCCGCCTCGGCCTCCCAAGG - Intergenic
1013117807 6:107115542-107115564 GCGGCCGCCGCCCCCGCCCCGGG - Intergenic
1013155803 6:107490254-107490276 GCTCCCGCCGCCGCCGCCGCCGG - Exonic
1013170792 6:107634942-107634964 CCGCCCGCCGCCGGCGACCCAGG + Exonic
1013441790 6:110179212-110179234 GCGCCCGCCGCCGTCTCCCTCGG + Intronic
1013538881 6:111087946-111087968 CAGCCAGCCCCAGCCGCCCTCGG - Exonic
1014137711 6:117907818-117907840 CCCGCCGCCGCCGCTGCCCTCGG - Exonic
1014947488 6:127515665-127515687 CCCTCCGCCGCCGCCGCCATTGG + Exonic
1015786043 6:136922313-136922335 CTGCCCTTCGCCGCCGCGCTGGG + Exonic
1016330275 6:142946572-142946594 CCGCCCGCAGCGGCAGCCGTGGG - Intergenic
1016839999 6:148516501-148516523 CCTCCCCCCTCCCCCGCCCTTGG + Intronic
1016863962 6:148747769-148747791 CCGCGCGCCGCCGCCGCCCCGGG + Intronic
1016969545 6:149749646-149749668 CCACACGCCTCCCCCGCCCTCGG + Exonic
1017073892 6:150600294-150600316 CTGCCCGCCGCCGCCCCGCTTGG + Intronic
1017163954 6:151390918-151390940 TCACCGGCCGCCGCCGCCCAGGG + Intronic
1017686864 6:156922414-156922436 CCGCCCGCCTCGGCCTCCCAAGG + Intronic
1017738021 6:157381292-157381314 CCGCGAGCCGCCGCCGCCCTCGG + Exonic
1017793625 6:157823034-157823056 GCCGCCGCCGCCGCCGCCCCCGG - Intronic
1017793634 6:157823068-157823090 CCGCGCCGCGCCGCCGCCCCGGG - Intronic
1017896348 6:158683460-158683482 CCGCCCGCCTCGGCCTCCCAAGG + Intronic
1018123237 6:160657638-160657660 CTGCCCGCCCCCGCCTCCCAAGG + Intronic
1018400427 6:163414958-163414980 CTCCCAGCCGCCGCCGCTCTCGG - Exonic
1018469054 6:164080383-164080405 CCTCCCGCCTCCGCAGCTCTGGG - Intergenic
1018686531 6:166308099-166308121 CCGCCGCCCGCCCCCGCCCCGGG - Exonic
1018757473 6:166862687-166862709 CCCCCCGCCTCCCCAGCCCTTGG - Intronic
1019048911 6:169168428-169168450 CCTGGCGCCGCCGCCGCCCTGGG - Intergenic
1019279563 7:193020-193042 GCGCCCGCCGCCGGAGCGCTGGG - Exonic
1019305677 7:333187-333209 CCCCCCGCCGGCCCCTCCCTGGG - Intergenic
1019483090 7:1275219-1275241 CCGCCCGCCTCCCCCACCGTGGG + Intergenic
1019524753 7:1475908-1475930 CCGCTCCCCGCCGCCGTCCCAGG - Intronic
1019562631 7:1666078-1666100 GCCGCCGCCGCCGCCGCGCTCGG + Intergenic
1019622116 7:1997699-1997721 CTGCCCCCCGCCACCGCACTGGG - Intronic
1019680185 7:2343430-2343452 CCGCCCGCCTCGGCCTCCCAAGG - Intronic
1019765101 7:2844179-2844201 CCGCGCCCCGCCGGCGCCCGGGG + Exonic
1020262854 7:6540353-6540375 CCGCCCGCCTCGGCCTCCCAAGG + Intronic
1020281790 7:6653569-6653591 CAGGCCGCCTCCGCCGCCCGCGG - Exonic
1020418205 7:7969441-7969463 CCGCCCGCCGTCGCCGCCGCCGG + Exonic
1020498768 7:8890202-8890224 CCGCCAGCCTCCGCCTCCCGAGG + Intergenic
1020831587 7:13102197-13102219 CCGCCAGCCTCCGCCTCCCGAGG + Intergenic
1021012128 7:15483321-15483343 CCGCCCGCCTCGGCCTCCCAAGG - Intronic
1021123036 7:16818489-16818511 CCGCCCGCCTCGGCCTCCCAAGG - Intronic
1021415693 7:20381403-20381425 CCGCCCGCCTCGGCCTCCCAAGG + Intronic
1021614394 7:22487555-22487577 CCCCCCGCCCCCGCCATCCTCGG - Intronic
1021680151 7:23121923-23121945 CCGCCCGCCTCAGCCTCCCAAGG + Intronic
1021735188 7:23636107-23636129 CCGCCAGCCTCGGCCTCCCTAGG + Intronic
1022101842 7:27173699-27173721 CCGCCCGACGGCTGCGCCCTGGG - Exonic
1022207611 7:28179786-28179808 CCGCCCGCGGCCGCCGGCCCCGG + Intronic
1022471149 7:30682521-30682543 CCGCCCCCCGGCGCAGCCATTGG - Intronic
1022528625 7:31053423-31053445 CCGCCCCCCGCAGCCGCCGCAGG - Intronic
1022559859 7:31336679-31336701 CCGCCCGCAGTGGGCGCCCTGGG - Intergenic
1022923258 7:35037180-35037202 CCGCCCGCCGGGGGCGGCCTTGG - Intronic
1022953281 7:35358855-35358877 CCGCCCGCCTCAGCCTCCCAAGG - Intergenic
1023773689 7:43583336-43583358 CCGGCCGCCGCCGCCGCCCCAGG + Exonic
1024586340 7:50845085-50845107 CCGCCCGCCTCGGCCTCCCAAGG - Intergenic
1025207528 7:57002208-57002230 CCCCCCACCGCCCCTGCCCTGGG - Intergenic
1025664409 7:63574678-63574700 CCGCCCACCACCCCTGCCCTGGG + Intergenic
1026353813 7:69540162-69540184 CCGCCCGCCTCAGCCTCCCAAGG + Intergenic
1026828684 7:73598874-73598896 CCGCCCGCCTCGGCCTCCCAAGG - Intronic
1026909477 7:74083908-74083930 TCGCCCACCGCCGCCGGCCCGGG - Intronic
1027177788 7:75915500-75915522 CCCCGCGCCGCCGCCCCCCACGG + Intronic
1027190645 7:75994030-75994052 CCGCGCGCCGCCGAGGCCTTTGG - Intronic
1027421282 7:78019934-78019956 TCTCCCGCTGCCGCCGCCCCAGG - Exonic
1027654642 7:80915498-80915520 CTGCCCGCCTCCGCCTCCCGAGG - Intronic
1028621428 7:92833336-92833358 CCGCCCGCCGCGGCGCCGCTGGG + Exonic
1028856172 7:95596518-95596540 CCACCAGCCGCCGCCGCCCGAGG + Intergenic
1029139671 7:98400960-98400982 TCGGCCGCCGCCGCAGCCGTCGG + Exonic
1029281561 7:99438949-99438971 GCCGCCGCCGCCGCCGCCCGAGG - Intronic
1029414736 7:100435831-100435853 CCGCCCGCCCCCCTCACCCTCGG + Exonic
1029461069 7:100694133-100694155 CCGCGCGCCGCCCACGCCCCGGG - Intergenic
1029624939 7:101714748-101714770 CCGCCCGCCTCAGCCTCCCAAGG - Intergenic
1029640306 7:101816123-101816145 CCGCCCGCAGCCCCCACCCCCGG - Intronic
1029640566 7:101816838-101816860 CCGGCCCCGGCCGCCGCCCCCGG + Intronic
1030176500 7:106660422-106660444 CCCACCGCCGCCGCCCCCCGAGG - Exonic
1030176658 7:106661035-106661057 TCGCCCGCGTCCTCCGCCCTCGG - Intergenic
1032011829 7:128352105-128352127 CTGGCGGCCGCCGCCGCCCTCGG - Exonic
1032048910 7:128633814-128633836 CCTCCCGCCTCAGCCTCCCTAGG - Intergenic
1032119316 7:129144955-129144977 CCCGCCGCCGCCACCGCCCCCGG - Exonic
1032158133 7:129487256-129487278 CCGCCCGCCTCCACCTCCCAGGG + Exonic
1032298925 7:130668806-130668828 CCGCCCTCCCCGGCCGCCCTCGG + Exonic
1032359891 7:131245511-131245533 GCGCCCCCCGCCCCCGGCCTCGG + Intronic
1033105935 7:138523510-138523532 CCGCCCGCCTCGGCCTCCCCAGG - Intronic
1033159053 7:138981141-138981163 GCGCCCGCCGCCGCCGCCCGGGG - Exonic
1033299932 7:140176658-140176680 CCGGCCGCCCGCGCCTCCCTCGG - Intronic
1033824496 7:145172903-145172925 CCGCCCGCCTCAGCCTCCCAAGG - Intergenic
1034455501 7:151167815-151167837 CCGCCCGCCGCCGCCGCGCCCGG + Intronic
1034597481 7:152211803-152211825 CCGCCCGCCTCAGCCTCCCAAGG - Intronic
1035476021 7:159144801-159144823 GCGCCCGCCGCCTCCGTCCTAGG + Exonic
1035552766 8:543062-543084 CCGCCCGCCTCAGCCTCCCAAGG - Intronic
1036723708 8:11201006-11201028 CCGCCAACCCCCGACGCCCTCGG - Exonic
1036801995 8:11799702-11799724 CCGCCCGCCTCAGCCTCCCCAGG - Intronic
1037305152 8:17497032-17497054 CCGCGCCCCGCCCCCGCCCCGGG + Intergenic
1037824754 8:22154689-22154711 CAGCCCGCTGCCTCAGCCCTGGG + Intronic
1037878665 8:22561952-22561974 CCGCGCCCCTCCGCAGCCCTCGG - Intronic
1037985422 8:23288125-23288147 CGGCGCGTCGCAGCCGCCCTCGG - Exonic
1039311418 8:36321652-36321674 GCGCCCGCCGCCACCACCCCTGG - Intergenic
1039798142 8:40932844-40932866 CCGCCCGCCGCCCCCGCAAGAGG + Intergenic
1039936571 8:42051585-42051607 CCGCCGGCCGGGCCCGCCCTGGG - Intronic
1039949010 8:42153266-42153288 CCGCCCGCAGCCGCGGCGCCGGG - Intronic
1040055949 8:43056715-43056737 TCTCGCGCCGGCGCCGCCCTGGG - Intronic
1040481426 8:47831285-47831307 GCGCCAGCCGCCGCCGCCACAGG - Intronic
1040883279 8:52231716-52231738 CCGCCAGCCGCGGCCTCCCAAGG + Intronic
1041502393 8:58553266-58553288 CCGCTCGCCGCCGCCGCCTCCGG - Exonic
1041690086 8:60679360-60679382 CCGCGCGCCCCCGCCGCCGCCGG - Intronic
1042040165 8:64581206-64581228 CTGCTCGCCGCCGCTGCTCTCGG - Exonic
1042153650 8:65817993-65818015 CCGCCCGCCTCGGCCTCCCAAGG + Intronic
1042224681 8:66505897-66505919 CCTCCCGCCTCAGCCTCCCTGGG + Intronic
1042591775 8:70403662-70403684 CCGCCCGCCCTCGCGGCCCCGGG + Intronic
1043711869 8:83430164-83430186 CCGCCCGCCTCGGCCTCCCAAGG - Intergenic
1045516294 8:102863626-102863648 CCCGCCGCCGCCGCCGCCGCCGG + Intronic
1046375704 8:113377099-113377121 CCGGACGACGCCGCAGCCCTTGG - Intronic
1046423151 8:114011182-114011204 CCGTCCGCCTCCCCAGCCCTTGG - Intergenic
1047393725 8:124475033-124475055 CCGCCCCCGGCCGCGGCCCCGGG + Exonic
1047732288 8:127737376-127737398 TCCCCTGCCGCGGCCGCCCTCGG + Intronic
1047776994 8:128079965-128079987 CCGCCCGCCTCGGCCTCCCAAGG + Intergenic
1049166276 8:141128264-141128286 CCGCCGGCCGCCCGCTCCCTGGG - Intronic
1049240648 8:141535941-141535963 CCGCCCGCCGCCCCCACCCGAGG - Intergenic
1049405406 8:142449964-142449986 CCTCCAGCCGCCGCCGCCCCCGG - Exonic
1049407554 8:142458355-142458377 CCGCCTCCCGCCGCCATCCTGGG - Intronic
1049585301 8:143430161-143430183 CCCCGCGCCGCCGCCGCCGCCGG + Exonic
1049668347 8:143858801-143858823 CAGCACGCGGCCGGCGCCCTGGG - Exonic
1049668763 8:143860400-143860422 CAGCACGCGGCCGGCGCCCTGGG - Exonic
1049669178 8:143862002-143862024 CAGCACGCGGCCGGCGCCCTGGG - Exonic
1049669593 8:143863604-143863626 CAGCACGCGGCCGGCGCCCTGGG - Exonic
1049670003 8:143865197-143865219 CAGCACGCGGCCGGCGCCCTGGG - Exonic
1049708251 8:144052519-144052541 CCGCCCACCACCGCCGCCTCGGG + Exonic
1049759862 8:144327040-144327062 CGGCCCGCAGCCCCGGCCCTGGG - Intergenic
1049762201 8:144336655-144336677 GGGCCCGGCGCCGCCGCCCCCGG - Intergenic
1049784656 8:144444573-144444595 GCGCCCGCCGCCGCCGTCGAGGG - Intergenic
1049847062 8:144807947-144807969 CTGCCCCACGCCGCCGTCCTGGG - Exonic
1049932429 9:470118-470140 CTGCCCTTCGCCGCCGCCCCCGG - Intergenic
1049988209 9:971188-971210 CCGCCCGCCTCGGCCTCCCAAGG - Intergenic
1050432333 9:5574477-5574499 CCGCCCGCCTCGGCCTCCCAAGG - Intergenic
1050500655 9:6294615-6294637 CCGCCCGCCTCCGCCTCCCAAGG + Intergenic
1051351048 9:16198159-16198181 GCTGCCGCCGCCGCTGCCCTGGG + Intergenic
1052274706 9:26663898-26663920 CTGCCCGCCTCGGCCTCCCTAGG + Intergenic
1052971738 9:34380920-34380942 CCGACCGCCGCCTGCGGCCTTGG - Exonic
1053149205 9:35732201-35732223 CCACCCGCGGGCGGCGCCCTGGG + Exonic
1053511154 9:38688616-38688638 CCGCCCGCCTCGGCCTCCCAAGG - Intergenic
1053739275 9:41123732-41123754 CTGCCCACCTCCGCCGCCTTGGG + Intergenic
1054689075 9:68307590-68307612 CTGCCCACCTCCGCCGCCTTGGG - Intergenic
1054762308 9:69014088-69014110 CCTGCCGCCGCCACCGCCATGGG - Exonic
1055091117 9:72365283-72365305 CCCGCCGCCGCCGCCGCCGCCGG - Intergenic
1055514165 9:77020161-77020183 GCCCCCGCCGCCGCCGCACATGG + Exonic
1055654922 9:78442173-78442195 CCGGCCGGCGCCACCGCCCCGGG + Intergenic
1055925355 9:81504724-81504746 CCGCCCGCCTCGGCCTCCCAAGG + Intergenic
1056406779 9:86282580-86282602 CCGCCCCCCGCCGCCACCATTGG + Intergenic
1057488562 9:95505898-95505920 GCGGCCGCGGCCGCCGCGCTGGG - Intronic
1058410609 9:104726700-104726722 CCGCCCGCCTCAGCCTCCCAAGG - Intergenic
1058580555 9:106451754-106451776 CCGCCCGCCTCGGCCTCCCAAGG + Intergenic
1060410816 9:123399037-123399059 CCGCCCGCCTCGGCCTCCCAAGG + Intronic
1060770152 9:126326739-126326761 CGGCCCGCCGCCGCGGCCCGCGG + Intergenic
1060770181 9:126326829-126326851 GCCGCCGCCGCCGCCGCTCTCGG + Exonic
1061096724 9:128461660-128461682 CCGCCCGCCTCGGCCTCCCAAGG + Intronic
1061737254 9:132670084-132670106 CCGCCCGGTGCCGCCGTCCCCGG - Exonic
1061872153 9:133526894-133526916 CCGCCCCCCGCCGGCCCCCAAGG + Intronic
1061967698 9:134025461-134025483 GCGGCCGCCGGCCCCGCCCTGGG + Intergenic
1062160254 9:135075896-135075918 CCGCCCCGCGCCCCCGGCCTGGG + Intronic
1062162587 9:135088247-135088269 CTGCTCCCCGCCGCCTCCCTGGG - Intronic
1062218391 9:135401430-135401452 CCCTCCGCTGCTGCCGCCCTGGG - Intergenic
1062305764 9:135906706-135906728 CCCGCCGCCGCCGCCGCCAACGG + Intronic
1062315802 9:135966518-135966540 CTGCCCGACGCTGCCTCCCTGGG + Intergenic
1062343380 9:136103698-136103720 CCCGCCACCTCCGCCGCCCTGGG - Intergenic
1062390579 9:136332096-136332118 CCGCCCGCTGCTGCTGCCCGTGG + Intronic
1062462990 9:136669620-136669642 CCGCCTACCGCCGCAGCCCTGGG + Exonic
1062583884 9:137240465-137240487 CTGCCCTCCGCCCCGGCCCTCGG + Intergenic
1062596509 9:137302178-137302200 CCGCGCGGCGCCGCCGTCCCCGG - Exonic
1062623238 9:137431826-137431848 CCGCCCACGGCTGCCACCCTGGG - Intronic
1062630773 9:137462142-137462164 CCGCCCGCCTCCGCCGCCGCGGG + Intronic
1062659112 9:137619122-137619144 CCGCCTGCCGCCGCCCCGCCCGG - Intronic
1062682827 9:137791974-137791996 CCGCCCGCCTCAGCCTCCCATGG + Intronic
1062752513 9:138266038-138266060 CCTCCCGCCTCAGCCACCCTAGG - Intergenic
1203575024 Un_KI270745v1:813-835 CCTCCCGCCTCAGCCACCCTAGG - Intergenic
1185476603 X:419308-419330 CCCCCCACCGCCGCCTCCCCGGG + Intergenic
1185591043 X:1277352-1277374 CCGCCCGCCTCTGCCTCCCAAGG - Intronic
1185610802 X:1392742-1392764 CCGCCCTCCGCGCCCGGCCTAGG + Intergenic
1187420584 X:19130371-19130393 CCGCCCGCCTCAGCCTCCCAAGG + Intergenic
1192316726 X:70058016-70058038 CCACCCGCCTCCGCCTCCCAAGG - Intergenic
1193649388 X:84110674-84110696 CCCCCTGCCGCCGCCCCTCTTGG - Intronic
1194642126 X:96414647-96414669 CCGCCCGCCTCGGCCTCCCAGGG - Intergenic
1194666821 X:96685068-96685090 GCTCCCGACGCCGCCGCCCCGGG - Exonic
1195252659 X:103063820-103063842 CCGCCCCCCGCTCCCACCCTCGG + Intronic
1195954796 X:110317832-110317854 GCCGCCGCCGCCGCAGCCCTGGG + Exonic
1198388140 X:136147717-136147739 CCCGCCGCCGCCGCCGCTCGGGG + Intronic
1199699484 X:150365012-150365034 CCGGCCGCCACCGCAGCTCTGGG + Intronic
1199724294 X:150566379-150566401 CCGCCCGCCTCGGCCTCCCAAGG + Intergenic
1199736866 X:150693540-150693562 CCCGCCGCCGCCGCCGCCGCCGG - Exonic
1200086641 X:153610329-153610351 CCGCCCCCCGCCGCAACCCCGGG - Intergenic
1200100786 X:153688420-153688442 CCGCCCGCCGCCCCGTCCCCCGG + Exonic
1200235536 X:154466183-154466205 CAGCCCGCCGCCGGGGCCCGTGG + Exonic
1200239573 X:154486634-154486656 CCGCCGCGCGCCGCCGCCCCGGG + Exonic
1200244597 X:154516253-154516275 CAGCCCGCCGGCCCCGCCCCCGG + Intergenic
1200277860 X:154751159-154751181 CCTCCGGCCGCCGCGGCCCCCGG + Intronic
1200292588 X:154886729-154886751 CAGGCCGCCGCCAGCGCCCTGGG + Exonic
1200292696 X:154887131-154887153 GCGCCCTCTCCCGCCGCCCTGGG + Exonic
1200309449 X:155062755-155062777 CCCCCCGCCAACCCCGCCCTTGG - Intronic
1200339432 X:155382469-155382491 CAGGCCGCCGCCAGCGCCCTGGG + Exonic
1200339540 X:155382871-155382893 GCGCCCTCTCCCGCCGCCCTGGG + Exonic
1200346930 X:155457822-155457844 GCGCCCTCTCCCGCCGCCCTGGG - Exonic
1200347038 X:155458224-155458246 CAGGCCGCCGCCAGCGCCCTGGG - Exonic
1200886887 Y:8279964-8279986 CAGCCCGCCGCCATCGCCATAGG - Intergenic