ID: 1104984132

View in Genome Browser
Species Human (GRCh38)
Location 12:132587143-132587165
Sequence CAGTGCGGCTGGAGGGTGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 678
Summary {0: 1, 1: 4, 2: 7, 3: 61, 4: 605}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104984132 Original CRISPR CAGTGCGGCTGGAGGGTGGA CGG Intergenic
900141745 1:1141652-1141674 CATTGAGGCTGGGGGTTGGAGGG - Intergenic
900348745 1:2224853-2224875 GGGCGGGGCTGGAGGGTGGAAGG + Intergenic
900386522 1:2413294-2413316 CAGGCAGGGTGGAGGGTGGAGGG - Intronic
900934915 1:5759087-5759109 AAGAGCGGCTGGCGGGAGGAAGG - Intergenic
900984532 1:6065806-6065828 AAGCGCGGCTGGAGGTTGGGGGG - Intronic
901004067 1:6163271-6163293 CAGTGCAGGTGGATGGAGGAGGG - Intronic
901734815 1:11305785-11305807 CGGGGCGGCTGGCGGGCGGAGGG + Intergenic
901734837 1:11305865-11305887 CAGGGCGGCTGCCGGGCGGAGGG + Intergenic
901820164 1:11823820-11823842 CAGTGTGGCTGGAGGTAAGAAGG + Exonic
901855786 1:12043386-12043408 CGGGGCGGCTGCCGGGTGGAGGG - Intergenic
901928832 1:12583943-12583965 CAGTGGGGCTGATGGGTGGGTGG - Intronic
902079673 1:13812526-13812548 CAGTGTGGCTGGAGCCTGGTAGG + Intronic
903265568 1:22156048-22156070 GTCTGCAGCTGGAGGGTGGAAGG + Intergenic
903323631 1:22556828-22556850 CAGTGTGGCTAGCGGCTGGAAGG + Intergenic
903455507 1:23484264-23484286 GAGAGCGGCTGGAGGGTCGGGGG - Intronic
905041996 1:34967812-34967834 CGGAGCGGCTGCAGGGCGGAGGG + Intergenic
905199043 1:36304122-36304144 CTGTGCGGCTGGTGGGGGGTGGG - Exonic
905673437 1:39808245-39808267 CAGGGCGGCTGCCGGGTGGAGGG - Intergenic
906114860 1:43349604-43349626 CAGTTTGGCTGAAGGGTGGACGG - Intronic
907140559 1:52181835-52181857 CGGGGCGGCTGCAGGGCGGAGGG - Intronic
907186318 1:52612136-52612158 CAGTGGGTATGGAGGGAGGAAGG - Intergenic
907216628 1:52869988-52870010 CGGGGCGGCTGCCGGGTGGAGGG + Intronic
907281548 1:53350293-53350315 CAGTGTGGCTGGAGCATGGTGGG - Intergenic
907296926 1:53461303-53461325 CAGTGGGGCTGGCTGGAGGATGG + Intronic
907697083 1:56742058-56742080 CAGTGGGGCTGGGGGGCGGATGG + Intronic
909184782 1:72472963-72472985 CAAGTTGGCTGGAGGGTGGAGGG + Intergenic
909508145 1:76418367-76418389 CAGTGTAGCTTGAAGGTGGAGGG + Intronic
909909415 1:81243842-81243864 CAGTGCTCCTGGTGGCTGGAGGG - Intergenic
910368094 1:86487742-86487764 CAGTATGGCTAGAGGCTGGATGG - Intronic
911935095 1:103960228-103960250 CTGTGCTGGTGGAGGGTGGGAGG + Intergenic
912457479 1:109807550-109807572 CTGTGCTCCTGCAGGGTGGAAGG + Intergenic
913022818 1:114804614-114804636 CAGGGCGGCTGCCGGGCGGAGGG + Intergenic
913173731 1:116255480-116255502 AAGTGTGGCTGGGGGGTGGGGGG - Intergenic
914230974 1:145764632-145764654 CGGGGCGGCTGCCGGGTGGAGGG - Intronic
914959922 1:152196544-152196566 CGGTGCGGCTGCCGGGTGGAGGG + Intergenic
915112788 1:153575226-153575248 CGGGGCGGCTGCCGGGTGGAGGG - Intergenic
915113303 1:153578575-153578597 CAGTGTGGCTGGAGCATGGATGG + Intergenic
915443124 1:155958901-155958923 CAGTGTGGGTGGGGGGTGGGGGG + Intronic
916063523 1:161118291-161118313 GCGGGCGGCGGGAGGGTGGAGGG + Intronic
916498862 1:165369389-165369411 CAGTGCCGCTGGAGCGTTGGTGG - Intergenic
916571178 1:166029102-166029124 CAGTGGGGCAGCGGGGTGGAGGG + Intergenic
916606109 1:166343481-166343503 CAGTGCAGCTGGGGGCTGAAGGG + Intergenic
916991687 1:170251190-170251212 CAGTGCGGCAGCAGGCTGAAGGG + Intergenic
918022743 1:180710934-180710956 CAGGGCGGCTGCTGGGCGGAGGG + Intronic
919608061 1:199710639-199710661 CAGTGAGGGAGGAGGATGGAGGG + Intergenic
919819333 1:201463092-201463114 GAGGGCAGGTGGAGGGTGGAGGG - Intergenic
919892153 1:201983154-201983176 CAGGGCGGCTGGGGGCCGGAAGG - Intronic
920215336 1:204358723-204358745 GAGAGCTGCAGGAGGGTGGAAGG - Intronic
920433008 1:205930684-205930706 TGGTGTGGCTGGAGGGTAGAGGG - Intronic
920920390 1:210293159-210293181 AAGTTTGGCTGGAGGGTGGAGGG + Intergenic
921013225 1:211162671-211162693 CAGTGCTGCTGGCGGCTGGCTGG + Intergenic
921902780 1:220466722-220466744 CAGGGCGGCTGCCGGGCGGAGGG + Intergenic
922433606 1:225581431-225581453 GAGTGGGAGTGGAGGGTGGAGGG + Intronic
922632811 1:227132923-227132945 CAGGGCGGCTGCCGGGCGGAGGG - Intronic
922647948 1:227310148-227310170 CAGAGCGTCTGGAGGATGGCTGG - Intronic
924185894 1:241490068-241490090 CAGAGGGCCTGGAGTGTGGAGGG - Intergenic
924531506 1:244897588-244897610 CAGGGCGGGGGCAGGGTGGAGGG + Intergenic
1062832729 10:616947-616969 CAGTGGGGATGGGGGGTGGTTGG - Intronic
1062848699 10:727070-727092 CAGTGCTGGGGGAGGCTGGAGGG + Intergenic
1063092507 10:2879713-2879735 CTGTGAGCCTGGAGGGTGGCAGG + Intergenic
1063321102 10:5053549-5053571 CAGTGCAGCAGTAGGCTGGAGGG + Intronic
1063710857 10:8476418-8476440 AATTGAGGGTGGAGGGTGGAGGG + Intergenic
1064109119 10:12523068-12523090 CGGGGCGGCTGCCGGGTGGAGGG + Intronic
1066231224 10:33435752-33435774 CAGGGTGGTTGCAGGGTGGAGGG - Intergenic
1068606064 10:59006270-59006292 CTGTGAAGCTGGAGGGAGGAAGG + Intergenic
1069929019 10:71869844-71869866 CGGTGCGGCTGCCGGGCGGAGGG + Intergenic
1070779692 10:79130323-79130345 CCTTGGGGTTGGAGGGTGGAGGG - Intronic
1071275351 10:84049103-84049125 CAGTGGGGGTGGAGGGTAGAAGG + Intergenic
1072224770 10:93358784-93358806 CACTGGGGCCGGCGGGTGGAGGG + Intronic
1072291723 10:93970833-93970855 CGGGGCGGCTGCCGGGTGGAGGG - Intergenic
1072772424 10:98152822-98152844 CGGGGCGGCTGCCGGGTGGAGGG - Intronic
1073357789 10:102870708-102870730 CAGTGCTGATGGAGTGAGGAAGG - Intronic
1073466796 10:103698958-103698980 CAGTGAGGGTAGTGGGTGGACGG + Intronic
1074112424 10:110431966-110431988 CAGATCGGCTGCAGTGTGGATGG + Intergenic
1075079106 10:119370962-119370984 GAGTGGGGCGGGGGGGTGGAAGG - Intronic
1075181444 10:120215246-120215268 CGGGGCGGCTGCCGGGTGGAGGG + Intergenic
1075650999 10:124128358-124128380 CAGAGCGGCTGGAGGGGGTGGGG - Intergenic
1075808741 10:125209027-125209049 CAGCTCGGCGGGAGGGTGGTAGG + Intergenic
1076135138 10:128040484-128040506 CAGGGCGAGTGGAGGGTGGATGG + Intronic
1076420218 10:130326138-130326160 CTGTGGGGTTGGAGGGAGGAAGG + Intergenic
1076836325 10:133022898-133022920 CAGTGGGGCGGGAGGGAGGCAGG - Intergenic
1077136727 11:1003258-1003280 CTGTGCTGCTGGTGGGTGGATGG + Intronic
1077218923 11:1406713-1406735 CTGTGCTGCTGGAGGGTGCGGGG + Intronic
1077327808 11:1971264-1971286 CTGTGTGGCTGGAAGGTGGAGGG - Intronic
1077602298 11:3582020-3582042 CTGTGGGGCTGGAGCATGGAGGG + Intergenic
1077680759 11:4237923-4237945 CAGGGCGGCTGCTGGGTGGAGGG - Intergenic
1077828325 11:5835063-5835085 CAGTGGGGCTGGAGGAAAGAGGG - Intronic
1077958643 11:7049009-7049031 GAGTGAGGGTGGAGGGTGGGTGG + Intronic
1078122391 11:8523467-8523489 CAGGGCGGCCGCCGGGTGGAGGG - Intronic
1078597294 11:12698346-12698368 AAGTGGGGGTGGAGGATGGAGGG + Intronic
1078895074 11:15590837-15590859 CAGTGTGGCTGGAGTGGGTAGGG - Intergenic
1078984669 11:16581438-16581460 CAGGGCCTGTGGAGGGTGGAAGG + Intronic
1079006498 11:16794844-16794866 CAGGGTGGTGGGAGGGTGGAAGG - Intronic
1079115177 11:17635891-17635913 CTGTCAGGCTGGAGGGTGGGAGG + Intronic
1079304220 11:19308310-19308332 CTCGGAGGCTGGAGGGTGGAAGG - Intergenic
1080383354 11:31796467-31796489 CTGGGGGGATGGAGGGTGGATGG + Intronic
1080860281 11:36145216-36145238 CGGGGCGGCTGGCGGGTGGGGGG - Intronic
1082065110 11:47893083-47893105 CGGGGCGGCTGCCGGGTGGAGGG - Intergenic
1082233765 11:49798489-49798511 TGGTGCGGCTGCTGGGTGGAGGG + Intergenic
1082269781 11:50157397-50157419 TGGTGTGGCTGGAGGGGGGAGGG + Intergenic
1082801929 11:57421243-57421265 CAGGGTGGCGGGAAGGTGGAGGG - Intronic
1082803974 11:57435240-57435262 CAGGGAATCTGGAGGGTGGAAGG - Intergenic
1082821176 11:57545791-57545813 CTGTGGGGCTGGAGGGTGGGTGG - Intronic
1083118875 11:60491618-60491640 CAGGGCGGCTGCTGGGCGGAGGG - Intergenic
1083398040 11:62404799-62404821 AAATGCGGCTGTAGGGTGAAAGG + Intergenic
1083764641 11:64836050-64836072 CAGTGTGCCTGGAGGGAGCATGG - Intronic
1084258193 11:67956571-67956593 CTGTGGGGCTGGAGCGTGGTGGG + Intergenic
1084337720 11:68470607-68470629 CTGTGCTGCTGGAGGGAGGTTGG + Intronic
1084785667 11:71440426-71440448 CAGACGGGGTGGAGGGTGGATGG + Intronic
1084814553 11:71638643-71638665 CTGTGGGGCTGGAGCATGGAGGG - Intergenic
1085278298 11:75314060-75314082 CAGTGTGGCTGGAGGGTGTGTGG - Intronic
1085910444 11:80818718-80818740 TAGTCAGGCTGGAGGGTGAATGG - Intergenic
1087357777 11:97116667-97116689 CCTTGAGGCTGGAGGGCGGATGG + Intergenic
1088472218 11:110198679-110198701 GAGTGGGGTTGGGGGGTGGAGGG - Intronic
1088992568 11:114966758-114966780 CAGTCTGGCTGCAGAGTGGAAGG + Intergenic
1090274241 11:125408492-125408514 CCGTGCGGCAGGTGGGTGGGAGG + Intronic
1090686643 11:129129179-129129201 CGGTGCGGCTGCCGGGCGGAGGG - Intronic
1202810788 11_KI270721v1_random:26444-26466 CTGTGTGGCTGGAAGGTGGAGGG - Intergenic
1091555836 12:1572840-1572862 CAGTGGCGGTGGAGGGGGGATGG + Intronic
1091993605 12:4975745-4975767 CAGTGCGGCTCCAGGCTGGGCGG + Intergenic
1092429523 12:8397524-8397546 CGGTGGGGCTGGAGCGTGGTGGG + Intergenic
1092529379 12:9331883-9331905 CAGTGTGGCTGCAGGGAGGCTGG + Intergenic
1092964965 12:13632687-13632709 CAGCTAGGCTGGAGGGTTGAGGG + Intronic
1094239063 12:28201232-28201254 CGGGGCGGCTGCAGGGCGGAGGG + Intronic
1094719907 12:33052804-33052826 AAGTGTCGCTGGAGGGTGGCTGG - Intergenic
1095491193 12:42735371-42735393 AAGTAAGGTTGGAGGGTGGAGGG + Intergenic
1095571074 12:43685162-43685184 CAGGGCGGCTGCCGGGCGGAGGG - Intergenic
1096167591 12:49437112-49437134 CGGTGTGGCTGCCGGGTGGAGGG + Intronic
1096441082 12:51644911-51644933 CAGGGCGGCTGCCGGGCGGAGGG - Intronic
1099970738 12:89497445-89497467 TAGAGCGGCTGGAGGTTGTAAGG + Intronic
1100251587 12:92830325-92830347 CAGACCTGCTTGAGGGTGGAAGG - Intronic
1100578954 12:95920684-95920706 GCTTGGGGCTGGAGGGTGGATGG + Intronic
1100980146 12:100157124-100157146 CTGTAGGGGTGGAGGGTGGAGGG - Intergenic
1101301709 12:103489672-103489694 CTGTGAGGCTGCAGTGTGGATGG - Intronic
1101624540 12:106426110-106426132 CAGTGCTGCTGGCAGGAGGAGGG - Intronic
1101885188 12:108656132-108656154 CGGGGCGGCTGCCGGGTGGAGGG - Intronic
1102392917 12:112563910-112563932 CAGTGCAACTGGAGTGTTGAAGG - Intergenic
1102867922 12:116388948-116388970 GTGTGTGGCGGGAGGGTGGAGGG - Intergenic
1102918588 12:116774765-116774787 AGGTCCGGGTGGAGGGTGGAGGG + Intronic
1102956976 12:117065181-117065203 CCGTGAGCCTGGATGGTGGATGG + Intronic
1103201880 12:119094509-119094531 CAGTGAAGGTGGAGGGTGGCAGG - Intronic
1103641688 12:122357390-122357412 CAGGGCGGCTGCCGGGCGGAGGG - Intronic
1103725547 12:122995820-122995842 CAGGGTGGCTGGTGGGTGGGAGG - Intronic
1104546069 12:129714057-129714079 CAGTGTGGTTGGAGGGAGGTAGG - Intronic
1104925478 12:132311816-132311838 CAGGGAGTGTGGAGGGTGGAGGG + Intronic
1104984091 12:132586987-132587009 CAGTGCGGCTGGAGGGAGGGCGG + Intergenic
1104984097 12:132587010-132587032 CAGTGCGGCTGGAGGGAGGACGG + Intergenic
1104984102 12:132587028-132587050 GACGGCAGCTGGAGGGTGGACGG + Intergenic
1104984115 12:132587074-132587096 CAGTGCGGCTGGAGGGAGGGCGG + Intergenic
1104984121 12:132587097-132587119 CAGTGCAGCTGGAGGGAGGGCGG + Intergenic
1104984126 12:132587120-132587142 CAGTGCAGCTGGAGGGTGGACGG + Intergenic
1104984132 12:132587143-132587165 CAGTGCGGCTGGAGGGTGGACGG + Intergenic
1104984147 12:132587208-132587230 CAGTGCAGCTGGAGGGAGGGTGG + Intergenic
1104984154 12:132587231-132587253 CAGTGCGGCTGGAGGGAGGGCGG + Intergenic
1104984177 12:132587341-132587363 CAGTGCAGCTGGAGGGAGGACGG + Intergenic
1104984183 12:132587364-132587386 CAGTGCAGCTGGAGGGAGGGTGG + Intergenic
1104984188 12:132587387-132587409 CAGTGCAGCTGGAGGGAGGACGG + Intergenic
1104984192 12:132587410-132587432 CAGTGCAGCTGAAGGGAGGACGG + Intergenic
1104984198 12:132587433-132587455 CAGTGCGGCTGGAGGGAGGACGG + Intergenic
1104984204 12:132587456-132587478 CAGTGCGGCTGGAGGGAGGACGG + Intergenic
1105213956 13:18273711-18273733 CAGTGAGTTTTGAGGGTGGAGGG - Intergenic
1106454673 13:29916735-29916757 CAGAGCTGCTGGAGTGGGGAGGG - Intergenic
1107493091 13:40900501-40900523 CAGGGCGGCTGCTGGGCGGAGGG - Intergenic
1107801199 13:44109347-44109369 CATTGCTGCAGGTGGGTGGAAGG + Intergenic
1107809475 13:44186462-44186484 CAGCGTGGTTGGAGGGTGGCTGG - Intergenic
1108024390 13:46162896-46162918 CAGGGCGGCTGCCGGGCGGAGGG - Intronic
1108261961 13:48667371-48667393 CAGTCAGCCTGGGGGGTGGAGGG + Intronic
1109111085 13:58318985-58319007 CAGTGCAGCGGGGGGCTGGAGGG + Intergenic
1109400391 13:61820104-61820126 CAGAGCTACTTGAGGGTGGAGGG + Intergenic
1109817700 13:67607574-67607596 CATTGAGGGTGGAGGGTGGGAGG + Intergenic
1111418363 13:87976744-87976766 CGGGGCGGCTGCCGGGTGGAGGG + Intergenic
1113307440 13:109093823-109093845 GAGTGCGGCTGGAGAGGGGCAGG - Intronic
1113493883 13:110713462-110713484 CAGGGCCGCTGGGGTGTGGACGG - Intronic
1113924334 13:113931950-113931972 CAGAGGAGCAGGAGGGTGGAGGG - Intergenic
1114429202 14:22645902-22645924 CAGTGGGGCTGGAGAGGGGGTGG - Intergenic
1114507892 14:23232395-23232417 CAGGGCGGCTGCCGGGCGGAGGG - Intronic
1114578699 14:23736848-23736870 CAGGGCGGCTGCCGGGCGGAGGG - Intergenic
1116409113 14:44601491-44601513 CGGGGCGGCTGCCGGGTGGAGGG - Intergenic
1116782976 14:49256894-49256916 CATTGATGCTGGAGGGTGAAAGG + Intergenic
1118351701 14:64976810-64976832 CAGTGTGGCTGGGGTGGGGATGG - Intronic
1119051854 14:71377298-71377320 CAGGGCGGCTGCCGGGTGGAGGG + Intronic
1119068163 14:71551748-71551770 CAGTGTGGCTGGAGGGGAAAGGG - Intronic
1120193776 14:81462499-81462521 CAGGGCGGCTGGTGGGCGGAGGG + Intergenic
1120923812 14:89778746-89778768 CAGTCTGGCTGAAGGGCGGAGGG - Intergenic
1121104866 14:91273317-91273339 CACTGCGGCTGGCAGGTGCATGG + Exonic
1121794349 14:96723135-96723157 GAGTGCCGCTCGAGGGTAGAGGG - Intergenic
1122027694 14:98889464-98889486 CAGTGGGGCTGGAGTGTAGAGGG + Intergenic
1122044873 14:99016301-99016323 TGGTGCAGCTGGGGGGTGGAGGG + Intergenic
1122117558 14:99535451-99535473 GAGTGTGGCTGGAGCTTGGAGGG - Intronic
1122631051 14:103107923-103107945 CTGTGGGGCTGGGGGGTGGAGGG + Intronic
1122659157 14:103282828-103282850 CACTGGGGATGGAGGATGGAGGG + Intergenic
1122744026 14:103887553-103887575 CCATCCAGCTGGAGGGTGGATGG + Intergenic
1122874225 14:104656112-104656134 CAGTGCGGCTGGAGGCAGACGGG + Intergenic
1124201402 15:27681461-27681483 CAGTGCAGCGGGTGGGAGGAGGG - Intergenic
1124335073 15:28849845-28849867 CGGGGCGGCTGCCGGGTGGAGGG + Intergenic
1125331648 15:38588501-38588523 CAGGGGGGCCGGTGGGTGGAGGG - Intergenic
1125579483 15:40775397-40775419 CCGGGCGGCTGGAGCATGGAGGG + Intronic
1125631535 15:41151589-41151611 CAGTGCAGCGGGAGGCTGAAGGG - Intergenic
1126679985 15:51193109-51193131 CAGTGGGGCTTGGGGGAGGACGG + Intergenic
1127154079 15:56109798-56109820 CAGGGCGGCTGCTGGGCGGAGGG - Intronic
1127824354 15:62690253-62690275 CAGGGCGGCTGCCGGGCGGAGGG + Intronic
1127865626 15:63030220-63030242 AACTGTGGCTGGAGGGTGTAAGG - Intergenic
1128542178 15:68543807-68543829 GTGTGCGTCAGGAGGGTGGAGGG - Intergenic
1128550630 15:68595998-68596020 CAGTGAGGTTTGAGTGTGGAGGG + Intronic
1128596559 15:68956984-68957006 TAGTGCGGATGGAGATTGGATGG + Intronic
1128727496 15:69998896-69998918 CAGTGGGGCTGGGGAGTGGCAGG - Intergenic
1128878638 15:71223077-71223099 CAGTGTGTCTGGCAGGTGGAAGG - Intronic
1129057098 15:72827958-72827980 CATGGCAGCTGGAGGATGGAAGG + Intergenic
1129386850 15:75201173-75201195 AAGAGAGGCTGGAGGGGGGAAGG - Intronic
1129425594 15:75460250-75460272 CAGTGCAGCTGGCAGCTGGAGGG - Intergenic
1130531584 15:84750808-84750830 CTGTGGGGCTGGAGGGGGAAAGG + Intronic
1130946397 15:88552910-88552932 CAGGGCGGCTGGCGGGCGGAGGG + Intergenic
1131912520 15:97224158-97224180 CAGTGCAGCTGGGGGCTGAAGGG - Intergenic
1132357324 15:101181580-101181602 CAGTGGGGCTGGAGAGAGAAGGG - Intronic
1132889032 16:2195359-2195381 CTGTGGGGGTGGAGGGAGGAGGG + Intronic
1133335825 16:5006123-5006145 GAGTGGGGCTGGGAGGTGGAGGG + Intronic
1133752127 16:8733191-8733213 CGGGGCGGCTGCCGGGTGGAGGG + Intronic
1133839797 16:9397393-9397415 CAGAGCTGCGTGAGGGTGGAAGG + Intergenic
1135698262 16:24609712-24609734 TACTGCAGCTGGGGGGTGGAGGG + Intergenic
1136088388 16:27901848-27901870 CCATGAGGCTGGAGTGTGGAGGG - Intronic
1136425747 16:30168884-30168906 CGGGGCGGCTGCCGGGTGGAGGG - Intergenic
1136426809 16:30173702-30173724 CACTGCGCCTGGCGAGTGGAAGG + Intergenic
1137493480 16:48951848-48951870 CAGGGCGGCTGCCGGGCGGAGGG - Intergenic
1138414122 16:56861544-56861566 CAGTGGGGCTGAAGGCTTGAGGG - Intergenic
1139224918 16:65225278-65225300 CAGTTCTGCTGAAGGGTGGCAGG - Intergenic
1139367830 16:66444470-66444492 CAGTGCAGGGGGAGGATGGAGGG + Intronic
1139507640 16:67407195-67407217 CTGTCCGGCTAGAGGGTGGCGGG - Intronic
1139689563 16:68631578-68631600 CAGGGGGGCTGGAGGGTTGGTGG + Intergenic
1140123846 16:72104684-72104706 GAAGCCGGCTGGAGGGTGGAGGG + Intronic
1141126552 16:81404639-81404661 CAGTCTGGCTGCAGAGTGGATGG - Intergenic
1141696852 16:85624265-85624287 CAGGGCCTCTGGAGGGAGGAAGG + Intronic
1142198683 16:88750859-88750881 GAGGGTGGGTGGAGGGTGGAGGG - Intronic
1142657439 17:1403380-1403402 CGGGGCGGCTGCCGGGTGGAGGG + Intergenic
1143273110 17:5690093-5690115 CAGTGGGGTTGGGGGTTGGATGG + Intergenic
1143362372 17:6382557-6382579 CAATGTGGCCGGAGGCTGGATGG - Intergenic
1143508737 17:7383898-7383920 CCGTGCGGCAGGAGCGTGGGCGG + Intronic
1143785721 17:9254146-9254168 GAGTGCGGCTGCAGGGTTGCTGG - Intronic
1143861894 17:9897268-9897290 CGGGGTGGCTGGAGGGTAGAAGG - Exonic
1143999071 17:11035750-11035772 CAGTGGGGCTGGAGCATGGAGGG - Intergenic
1144461341 17:15460894-15460916 CACTGTGGCTGGAGGGTGGTTGG - Intronic
1144727699 17:17510206-17510228 CTGTGCGGCTGACGGGTGCATGG - Intronic
1144771559 17:17762372-17762394 CAGTGTGGTTGGAGTGTGCATGG + Intronic
1145279838 17:21458877-21458899 CAGTGCAGCTGCAGGGTGTGGGG - Intergenic
1145780528 17:27560060-27560082 CCACGTGGCTGGAGGGTGGAAGG + Intronic
1145882819 17:28364530-28364552 CAGGGCTGCTGGAGGGTGTCTGG + Exonic
1146731283 17:35195214-35195236 CGGGGCGGCTGCCGGGTGGAGGG + Intergenic
1146884741 17:36463625-36463647 CATTGAGGGTGGAGGGAGGAAGG + Intergenic
1146939755 17:36836337-36836359 CACTGGGGCTGGAGGGTGAGAGG + Intergenic
1147434611 17:40401853-40401875 CAGTGTGGCTGGAGAGGAGATGG + Intronic
1148016291 17:44524703-44524725 CGGGGCGGCTGCCGGGTGGAGGG - Intergenic
1148241064 17:45999596-45999618 CAGGGCAGCTGCAGGGTGGGAGG - Exonic
1148806897 17:50268503-50268525 CTGTGGGCCGGGAGGGTGGAGGG - Intergenic
1149585646 17:57784430-57784452 CAGTGTCGCTGATGGGTGGAGGG - Intergenic
1149613007 17:57971397-57971419 CAGGCTGGTTGGAGGGTGGAAGG - Intergenic
1149623115 17:58060803-58060825 CACTGCGGATGGAGGGGGGCGGG + Intergenic
1150217293 17:63477681-63477703 CCGGGCGAGTGGAGGGTGGATGG - Intergenic
1151414525 17:73952764-73952786 CAAGGAGGGTGGAGGGTGGAGGG - Intergenic
1152054413 17:78012336-78012358 CCTTGAGGGTGGAGGGTGGAAGG + Intronic
1152094106 17:78263242-78263264 CAGTGCGGCCGCAGGCTGGTAGG - Intergenic
1152504768 17:80741536-80741558 CCATGAGGCTGGAGGGTGGATGG + Intronic
1153250643 18:3118262-3118284 CAGGGTGTCAGGAGGGTGGAGGG + Intronic
1153806461 18:8712435-8712457 CAGTGTGGCCTGGGGGTGGAGGG + Intronic
1154286152 18:13058639-13058661 CAGTGAGGAGGGAGGGTGGCTGG + Intronic
1157369522 18:47097877-47097899 CAGTCAGGGTGGAGGGTGGGAGG - Intronic
1157449063 18:47772081-47772103 CACTGCACATGGAGGGTGGAAGG + Intergenic
1157574792 18:48736383-48736405 CAGTGCAGCTGGAGGAAGAAGGG - Intronic
1157914750 18:51654421-51654443 CAGTGCGGCAGGAAGGCGGAAGG - Intergenic
1158086204 18:53654494-53654516 CAGTGGAGCTGAATGGTGGAGGG - Intergenic
1158215619 18:55097700-55097722 CAGGGGGCCTGGAGGCTGGACGG - Intergenic
1158392233 18:57053029-57053051 CAGTATGGCTGGAGTGTGCATGG - Intergenic
1158425070 18:57332108-57332130 CATTGGGGCTGGGGGTTGGAGGG - Intergenic
1158875266 18:61728141-61728163 CAGGGCGGGAGGAGGGAGGAGGG - Intergenic
1160950985 19:1667361-1667383 CAGCGCAGCTGGAGGGAGGTGGG - Intergenic
1162145816 19:8611437-8611459 GAATGGGGCTGGAGGGGGGATGG + Intergenic
1162487634 19:10971232-10971254 CAGTGTGGCTGGAGCAGGGAAGG - Intronic
1162946834 19:14049087-14049109 GAGTGGGGCTGGAGGATGGGGGG + Intronic
1162958242 19:14111810-14111832 CAGTGGGTGGGGAGGGTGGAGGG + Intronic
1163102747 19:15107808-15107830 CTGAGGGCCTGGAGGGTGGAGGG + Intronic
1163126514 19:15247176-15247198 GAGTGGGGCTGGGGGGTGGGTGG - Intronic
1163333921 19:16659665-16659687 CAGTGCGGGTGCAGGGCGGAAGG + Intronic
1163597790 19:18230552-18230574 CAGTGTGGCTTGAGGATGGAAGG - Intronic
1163598818 19:18235774-18235796 CAGTGTGGCTGGAGGGTGGGAGG - Intronic
1163720133 19:18894870-18894892 CCGTCTGGCTGGAGGGTGCAGGG - Intronic
1163722641 19:18905544-18905566 CAGTGCGGGTGGAGAGGGGCAGG + Intronic
1164012123 19:21212604-21212626 CAGGGCGGCTGCCGGGCGGAGGG + Intergenic
1164105257 19:22105159-22105181 CAGGGCGGCTGCCAGGTGGAGGG - Intergenic
1164168532 19:22703057-22703079 CAGGGCGGCTGCTGGGCGGAGGG + Intergenic
1164168543 19:22703097-22703119 CAGGGCGGCTGCTGGGCGGAGGG + Intergenic
1164231200 19:23290092-23290114 CGGGGCGGCTGCCGGGTGGAGGG + Intergenic
1164441877 19:28285053-28285075 CAGAGAGGAAGGAGGGTGGAGGG + Intergenic
1166050433 19:40255885-40255907 GGGTGAGGCTGGAGGTTGGAAGG + Intronic
1166117120 19:40663002-40663024 GAGCGCGCCTGGAGGGTGGACGG + Intergenic
1166421451 19:42639685-42639707 CGGGGCGGCTGCCGGGTGGAGGG + Intronic
1166832696 19:45648149-45648171 CGGTGCGGCTGCTGGGCGGAGGG - Intergenic
1166852153 19:45766181-45766203 CTGTGCAGCTGGAGGGCGGGCGG + Intronic
1167106758 19:47434753-47434775 CAGAGCTGCTGGAGGGGTGAGGG - Intronic
1167902647 19:52633515-52633537 CAGTGAGGCTGGAAGGAGGGTGG + Intronic
1167925009 19:52814151-52814173 CAGGGAGGCTGGAAGGAGGATGG + Intronic
1167925231 19:52816082-52816104 CAGTGAGGCTGGAAGGAGGGTGG + Intronic
1167929565 19:52853248-52853270 CAGTGAGGCTGGAAGGAGGGTGG + Intronic
1167992647 19:53373531-53373553 CAGTGAGGCTGGAAGGAGGGTGG - Intronic
1168001318 19:53448439-53448461 CAGTGAGGCTGGAAGGAGGGTGG - Intronic
1168005704 19:53485002-53485024 CAGTGAGGCTGGAAGGAGGGTGG - Intronic
1168472330 19:56649734-56649756 CAGTGTGGCTGGAGGGTGGGAGG + Intronic
925017619 2:543730-543752 CAGGGAGGCTGGAGGGTGGGAGG + Intergenic
925017690 2:543929-543951 CAGGGAGGCTGGAGGGTGGGAGG + Intergenic
925017704 2:543967-543989 CAGGGAGGCAGGAGGGTGGGAGG + Intergenic
925044855 2:765144-765166 CACTGGAGCTGGAGGGTGCAGGG - Intergenic
925094798 2:1187999-1188021 AAGGGCGGCTGGAGAGTAGAGGG + Intronic
925407574 2:3615962-3615984 CGGGGCGGCTGCTGGGTGGAGGG + Intronic
925417278 2:3679350-3679372 TGGTGGGGCTGGAGGCTGGAGGG + Intronic
925516901 2:4692801-4692823 CAGTACAGAAGGAGGGTGGATGG - Intergenic
926168659 2:10536878-10536900 CAGTGCTGGTGGAGGATGCAGGG + Intergenic
926366772 2:12140397-12140419 CACTGCGGCAGGTGGGGGGAGGG + Intergenic
927246435 2:20960385-20960407 TCCTGAGGCTGGAGGGTGGAAGG - Intergenic
927520827 2:23696994-23697016 GTGTGTGGCTGGAGGGAGGAAGG - Intronic
927747232 2:25633964-25633986 CGGGGCGGCTGCCGGGTGGAGGG - Intronic
928121935 2:28590095-28590117 CAGTGCAGCCGGAGCCTGGAAGG - Intronic
928188362 2:29136771-29136793 CAGTCCAGCTGGAGTGTGAAGGG + Intronic
928243390 2:29606016-29606038 CAGTGGGGGTGGGAGGTGGAAGG - Intronic
928542196 2:32294270-32294292 CGGGGCGGCTGCCGGGTGGAGGG + Intronic
928585556 2:32754941-32754963 CGGGGCGGCTGCTGGGTGGAGGG + Intronic
929065083 2:37964218-37964240 CAGGGCGGCTGCCGGGCGGAGGG + Intronic
929246432 2:39708247-39708269 CAGTGGGGCTGGAGGGAGTGAGG + Intronic
929956123 2:46460060-46460082 CTGTGGGCCTGGAAGGTGGAAGG - Intronic
930363600 2:50411662-50411684 CAGGGCGGCTGCCGGGCGGAGGG - Intronic
930461999 2:51693160-51693182 CAGAGCTTCTTGAGGGTGGAGGG + Intergenic
930665608 2:54096156-54096178 CGGGGCGGCTGCCGGGTGGAGGG + Intronic
931584243 2:63809094-63809116 CAGGGCGGCTGCCGGGCGGAGGG - Intronic
931656207 2:64512148-64512170 CGGGGCGGCTGGCGGGCGGAGGG + Intergenic
932253808 2:70267032-70267054 CAGGGCGGCTGCTGGGCGGAGGG + Intronic
932338495 2:70944385-70944407 GAGTGGGGCTGGTTGGTGGAGGG - Intronic
934300367 2:91773038-91773060 CAGTGAGTTTTGAGGGTGGAGGG + Intergenic
934714126 2:96533426-96533448 CAGATTGGCTGGAGGTTGGAGGG + Intergenic
935366160 2:102293103-102293125 CAGTGCAGTTGGCAGGTGGAGGG + Intergenic
936828104 2:116605955-116605977 CACCCAGGCTGGAGGGTGGAGGG + Intergenic
937069294 2:119050504-119050526 CAGGGCGGCGGGCGGGCGGACGG - Intergenic
937334946 2:121056486-121056508 CAGTGGGGATGGAGAGAGGATGG + Intergenic
937457586 2:122055786-122055808 CAGTGGGGCTGGTGGGGGAAAGG - Intergenic
938647074 2:133342638-133342660 CAGTGCAGATGGTGGCTGGAGGG - Intronic
938911375 2:135888554-135888576 AATTGCTGCTGGAGGTTGGAAGG + Intergenic
938967782 2:136403988-136404010 CAGTTTGGATGGAGGGTGGATGG - Intergenic
940784666 2:157968320-157968342 CAGTGCAGCGGGAGGCTGAAGGG + Intronic
940817250 2:158310565-158310587 CAGGGCGGCTGCCGGGCGGAGGG + Intronic
940882122 2:158957190-158957212 CAGAGCCTCTGGAGGGAGGATGG + Intergenic
941024003 2:160439298-160439320 CAGGGCGGCTGCCGGGCGGAAGG + Intronic
941047328 2:160691194-160691216 CAGTGGGGGTGGGAGGTGGAGGG + Intergenic
941197575 2:162470459-162470481 CAGGGCGGCTGCCGGGCGGAGGG - Intronic
945715237 2:213350336-213350358 CACTGCAACTTGAGGGTGGAGGG - Intronic
945957224 2:216097812-216097834 GAGTACTGGTGGAGGGTGGAAGG + Intronic
946177350 2:217929691-217929713 CGGGGCGGGTGGGGGGTGGAGGG - Intronic
946182042 2:217954747-217954769 CTGGGAGGCTGGATGGTGGAAGG - Intronic
946216471 2:218187579-218187601 CCAGGGGGCTGGAGGGTGGAGGG + Intergenic
946292421 2:218755190-218755212 CAGTCCAGGGGGAGGGTGGAAGG + Exonic
946385917 2:219384470-219384492 GAGTGGGGGTGGAGGGTTGAAGG - Intronic
947526416 2:230879258-230879280 GAGTGTGGCTGGAGGGGAGATGG + Intergenic
948371902 2:237494984-237495006 CATTCCAGCTGGAGGCTGGAGGG + Intronic
948512265 2:238476488-238476510 CAGTGAGGCTGGAGTGCAGAGGG + Intergenic
948701917 2:239765925-239765947 CAGAGAGGCTGGAGGCTGGCGGG + Intronic
948756493 2:240162577-240162599 CAGGGCGGGTGGAGGGAGGCGGG + Intergenic
948890399 2:240904624-240904646 CAGGGCGGGTGGAGTGAGGAAGG - Intergenic
949010036 2:241673069-241673091 CAGCCAGGCTTGAGGGTGGACGG + Exonic
949046322 2:241874131-241874153 CACTGAGGCTGGAGGGAAGAGGG - Intergenic
1168857627 20:1019832-1019854 GAGGGTGGGTGGAGGGTGGATGG - Intergenic
1168862185 20:1053570-1053592 CTGTCTGGCTGGAGGGAGGAGGG - Intergenic
1168862523 20:1056062-1056084 CTGTGTGGCTGGAGGGTGACAGG - Intergenic
1169056514 20:2626303-2626325 CAGCTCAGCTGGAGGCTGGAGGG + Intronic
1169208456 20:3752892-3752914 AAGAGCAGCTGGAGGGTGGATGG + Exonic
1169276322 20:4235829-4235851 CGGTGGGGCTGGGGGGTGCACGG + Intronic
1169441806 20:5639401-5639423 CGGGGCGGCTGCCGGGTGGAGGG + Intergenic
1170693742 20:18638583-18638605 CAGTGTGGCTGGAGCTTGGAGGG + Intronic
1170789176 20:19493806-19493828 CAGTGTTTCTGGAGTGTGGAGGG - Intronic
1171848486 20:30291855-30291877 CAGGGCGGCTGCCGGGCGGAGGG + Intergenic
1172735827 20:37126012-37126034 CGGGGCGGCTGCCGGGTGGAGGG - Intronic
1172910756 20:38407513-38407535 CAGGGCGGCTGCTGGGTGGAGGG - Intergenic
1172940428 20:38650170-38650192 CTGGAGGGCTGGAGGGTGGAGGG - Exonic
1173273171 20:41555474-41555496 CAGGGCGGCTGCCGGGCGGAGGG + Intronic
1173778702 20:45735808-45735830 CAGTGCAGCTGCAGGCTGAAGGG - Intergenic
1173822958 20:46030522-46030544 CAGCGCCGCTGGAGAGTGGGGGG - Intronic
1174065206 20:47859808-47859830 CAGTGAGGCTGGAGGCAGCAGGG - Intergenic
1174087473 20:48019366-48019388 ATGTGTGGCTGGAGGGTGAAGGG + Intergenic
1174128814 20:48327604-48327626 ATGTGTGGCTGGAGGGTGAAGGG - Intergenic
1174150552 20:48483309-48483331 CAGTGGGGCTGGTGGGTGGGAGG - Intergenic
1175392627 20:58636698-58636720 CCGTGAGGCTGGAGTGTGGCAGG - Intergenic
1175524333 20:59623199-59623221 CAGGGCGGCTGGAGACAGGATGG + Intronic
1175872233 20:62213973-62213995 CAGTGCTGGGGGTGGGTGGAGGG - Intergenic
1176087489 20:63304608-63304630 CTGCGCAGCTGGAGGGAGGAAGG - Intronic
1176095095 20:63337831-63337853 CAGTGTGGCTGGTGTGTGGGAGG + Intergenic
1176184219 20:63769318-63769340 CTCTGAGGGTGGAGGGTGGAGGG + Intronic
1176591264 21:8652389-8652411 CTGTGCGGCTGTGGGGTGGGGGG + Intergenic
1179400096 21:41075805-41075827 CAGTACCGGTGGAGGGTGGGAGG - Intergenic
1179411543 21:41167383-41167405 CTGGGAGGGTGGAGGGTGGAAGG - Intergenic
1179547430 21:42122176-42122198 CACTGCTGAAGGAGGGTGGAGGG + Intronic
1179549643 21:42135733-42135755 CACTTTGGCTGGAGGGTGGGAGG + Intronic
1179626381 21:42651940-42651962 CAGTTCCCCAGGAGGGTGGAGGG - Intergenic
1179712669 21:43272360-43272382 CAGTGAGCCTGGAGGGAGGCAGG + Intergenic
1179713351 21:43275409-43275431 CAGAGCAGATGGAGGGAGGAGGG - Intergenic
1179828416 21:43981412-43981434 CAGTGGGGCTGCAGTGGGGATGG - Intronic
1179982617 21:44904190-44904212 CAGGGGGGCTGAAGGCTGGAGGG - Intronic
1179998788 21:44985868-44985890 CAGAGCGGGTGGGGGGTGAACGG + Intergenic
1180155496 21:45975349-45975371 CAGTGAGGGTGGACGGCGGAGGG - Intergenic
1180155738 21:45976776-45976798 CAGTGCTGCTGGTGGCTGGTGGG - Intergenic
1180274112 22:10629500-10629522 CTGTGCGGCTGTGGGGTGGGGGG + Intergenic
1180639978 22:17290666-17290688 CAGTGAGGGTGGAGGGTGTCGGG - Intergenic
1181311281 22:21946211-21946233 CAGGGCCACTAGAGGGTGGAGGG + Intronic
1181528482 22:23502871-23502893 GATTGGGGATGGAGGGTGGAGGG - Intergenic
1181544256 22:23592102-23592124 CAATGGGGCTGGAGCATGGAGGG + Intergenic
1181567131 22:23745895-23745917 GAGTGCGACTGGAGGGTAGAGGG - Intronic
1182061244 22:27399342-27399364 TAGTGTGGCTGGCGGGTGGGGGG + Intergenic
1182331122 22:29552497-29552519 CGGGGCGGCTGCTGGGTGGAGGG - Intronic
1182686457 22:32124067-32124089 CAGAGCGGTAGGAGGGTGGCTGG + Intergenic
1183029756 22:35094723-35094745 CTGAGCGGCTGGCTGGTGGAAGG - Intergenic
1183185785 22:36290939-36290961 CGGGGCGGCTGCAGGGCGGAGGG - Intronic
1183628372 22:39018450-39018472 CAGAGCGGGTCCAGGGTGGAGGG - Exonic
1183645629 22:39124372-39124394 CAGTGAAGCTGGGAGGTGGACGG + Intronic
1183866408 22:40707751-40707773 CTGTGAGGCTGGAGGCTAGATGG + Intergenic
1184147015 22:42617706-42617728 CAGTGTGGCTGGAGGGGAGTGGG - Intergenic
1184192731 22:42905770-42905792 CAGTGCTCCTGGTGGGTGGATGG + Intronic
1184219901 22:43093248-43093270 CAGGGCGGGGGGAGGGGGGAGGG + Intergenic
1184486667 22:44783839-44783861 CTCTGCGGCTGGAGGCAGGATGG - Intronic
1184717546 22:46290533-46290555 CAGCGTGGCTGGAGGGTGTTAGG + Intronic
1185014047 22:48333246-48333268 GAGTGAGGCTGGAGGGAGGCGGG - Intergenic
1185067682 22:48640250-48640272 CAGCTCTGCTGGAGGGTGGAGGG + Intronic
1185101836 22:48844745-48844767 GAGAGAGGCTGGAGGGAGGAAGG - Intronic
1185134285 22:49060308-49060330 CAGGAGGGCTGGAGGGTGGAAGG - Intergenic
1185376400 22:50484453-50484475 CTGAGAGGCTGCAGGGTGGAGGG + Exonic
949551133 3:5113818-5113840 CAGGGCGGCTGCCGGGCGGAGGG + Intergenic
949992644 3:9592007-9592029 CAGGGCGGCTGCCGGGCGGAGGG - Intergenic
950139890 3:10608196-10608218 CAGTGTGGATGGAGTGAGGAGGG - Intronic
950158826 3:10743753-10743775 CAGTGGCGGGGGAGGGTGGAGGG - Intergenic
950412722 3:12849762-12849784 CAGGGCGGCTGCCGGGCGGAGGG + Intronic
950742374 3:15061888-15061910 CAGGGCGGCTGCCGGGCGGAGGG - Intronic
951520454 3:23606329-23606351 CAGTTCTGCGGGAGGCTGGATGG + Intergenic
952484670 3:33798414-33798436 CACTGCGGCAGGAAGGAGGAAGG + Intronic
952711249 3:36434182-36434204 CATGGCGGCTGGAGTGTGAAGGG + Intronic
952876283 3:37947148-37947170 CACTGGGGCTGCTGGGTGGAGGG - Exonic
953322291 3:41983289-41983311 CAGGGCGGCTGCTGGGAGGAGGG + Intergenic
953797128 3:45994667-45994689 TAATGCGGCTGGAGGGTGTTGGG - Intronic
954148785 3:48647302-48647324 GAGGGAGGGTGGAGGGTGGAGGG + Intronic
954317955 3:49811520-49811542 CAGGGTGGATGGAGGGTGGCTGG - Intronic
954394565 3:50286662-50286684 CAGTGTGCCTGCTGGGTGGATGG - Exonic
954399646 3:50312272-50312294 CAGGGCGGCTGCTGGGCGGAGGG + Intronic
954567073 3:51608070-51608092 CGGGGCGGCTGCCGGGTGGAGGG + Intronic
955173054 3:56584375-56584397 CGGGGCGGCTGCCGGGTGGAGGG + Intronic
955803965 3:62714523-62714545 CAGTGTGGGTGAAGGGAGGAAGG + Intronic
957073142 3:75581087-75581109 CTGTGGGGCTGGAGCGTGGTGGG + Intergenic
957789274 3:84918822-84918844 CGGGGCGGCTGCCGGGTGGAGGG - Intergenic
958957359 3:100477837-100477859 CGGGGCGGCTGGCGGGTGGGGGG + Intergenic
959201707 3:103255104-103255126 CAGGGCGGCTGCCGGGCGGAGGG + Intergenic
959419291 3:106111708-106111730 CGGGGCGGCTGGCGGGCGGAGGG + Intergenic
961168620 3:124780309-124780331 CAGTGGGGCTGCAGGAAGGAAGG + Intronic
961329001 3:126128018-126128040 CAGTGGGGCATGAGGGTGGAGGG + Intronic
961381783 3:126500240-126500262 CAGTGGGGCTGGAAGTTGGTGGG - Intronic
961554794 3:127690456-127690478 CAGGGCTGCTGGAGGGAGGGTGG + Exonic
961704423 3:128773348-128773370 CGGGGCGGCTGCCGGGTGGAGGG - Intronic
961815963 3:129550525-129550547 CAGAGTGGCTGGAGGGTTAACGG - Intronic
961873454 3:130003892-130003914 CTGTGGGGCTGGAGCGTGGTGGG + Intergenic
962787907 3:138784986-138785008 CGGGGCGGCTGCCGGGTGGAGGG - Intronic
963249097 3:143086831-143086853 CGGGGCGGCTGCCGGGTGGAGGG + Intergenic
963249109 3:143086871-143086893 CGGGGCGGCTGCCGGGTGGAGGG + Intergenic
963554592 3:146772257-146772279 CAGTGCAGCGGGAGGCTGAAGGG - Intergenic
963892716 3:150653589-150653611 ATGTGCGGGTGGAGGGAGGAGGG - Intergenic
965650050 3:170923709-170923731 CGGGGCGGCTGCCGGGTGGAGGG - Intergenic
965672306 3:171159196-171159218 CAGAGCGGGTGGAGGAGGGAAGG + Intronic
965700938 3:171459158-171459180 CAGTGGGGCTGGGGGGAGGGAGG + Intronic
967332134 3:188301088-188301110 TAGAGAGGCAGGAGGGTGGATGG - Intronic
967949747 3:194831701-194831723 CAGTGTGTCTAGAGGGTGGAAGG + Intergenic
968045913 3:195623890-195623912 GGGTGGGGTTGGAGGGTGGATGG + Intergenic
968308741 3:197666197-197666219 GGGTGGGGTTGGAGGGTGGATGG - Intergenic
968473622 4:792737-792759 AGGAGCGGCTGGAGGGTGGTGGG - Intronic
968538261 4:1148776-1148798 GACTGAGGCAGGAGGGTGGAAGG - Intergenic
968814920 4:2817330-2817352 CAGGGCGGCTGGAAGGAGGTGGG + Intronic
968890341 4:3365342-3365364 CAGGGAGTCTGGAGGGAGGAGGG + Intronic
969016749 4:4108381-4108403 CTGTGGGGCTGGAGCGTGGAGGG + Intergenic
969575787 4:8034996-8035018 CAGTGCGGGTGGGTGGTGGGTGG + Intronic
969737218 4:8999934-8999956 CTGTGGGGCTGGAGCATGGAGGG - Intergenic
972270744 4:37509283-37509305 CAGGGCGGCTGCTGGGCGGAGGG + Intronic
973570241 4:52231405-52231427 CAGTGAAGGTGGAGGATGGATGG + Intergenic
973746051 4:53964513-53964535 CAGAGAGGCTGCAGGGGGGATGG + Intronic
974660973 4:64888406-64888428 CAGTGGGACTGGAGGCAGGAGGG + Intergenic
975795951 4:78007247-78007269 CAGGGCGGCTGCGGGGCGGAGGG + Intergenic
975848367 4:78548091-78548113 CAGGGCGGCTGCCGGGCGGAGGG - Intergenic
975994879 4:80302749-80302771 CAGTGCAGCTGCAGGCTGAAGGG - Intronic
977491383 4:97716693-97716715 CTGTGGGGGTGGGGGGTGGAAGG + Intronic
977696502 4:99971856-99971878 CAGTGCGGTTGGGGGAAGGATGG - Intergenic
980056543 4:128083905-128083927 CGGGGCGGCTGCCGGGTGGAGGG + Intronic
980578852 4:134721889-134721911 TACTGCGGGTGGAGGGTGGGAGG + Intergenic
981993681 4:150954074-150954096 CGGGGCGGCTGCTGGGTGGAGGG - Intronic
983652215 4:170046466-170046488 CAGGGCGGCTGCCGGGCGGAGGG - Intergenic
983906041 4:173183882-173183904 CGGGGCGGCTGCCGGGTGGAGGG + Intronic
984140795 4:176002053-176002075 CAGTGGGTCGGGAGGGTGGGGGG - Intronic
984931470 4:184851262-184851284 CTGTGCTGGTGAAGGGTGGATGG + Intergenic
984981615 4:185287433-185287455 CAGTGGGGCTGCAGGGGAGAGGG + Intronic
985145363 4:186890027-186890049 CAGTGCGGCGGCGGGCTGGAGGG - Intergenic
985736426 5:1586162-1586184 CAGGGCGGCTGCTGGGCGGAGGG - Intergenic
986660039 5:10051606-10051628 CAGTGAGCCTGGGGGATGGAAGG + Intergenic
986950698 5:13080897-13080919 CAGTGCTGGTGGAGGTTGGGAGG - Intergenic
988591448 5:32553217-32553239 CAGTGCAGCTGCAGGCTGAAGGG + Intronic
988814955 5:34825659-34825681 CCGTGCTGCTGGAGGAAGGAGGG + Intronic
989068176 5:37483838-37483860 CGGGGCGGCTGCCGGGTGGAGGG + Intronic
989574746 5:42979447-42979469 CAGGGCGGCTGCTGGGCGGAGGG - Intergenic
989574758 5:42979487-42979509 CAGGGCGGCTGCCGGGCGGAGGG - Intergenic
991683649 5:69162366-69162388 CAGTGGGGTTGGAGGGCTGAAGG + Intergenic
992801760 5:80301363-80301385 CAGGGCGGCTGCCGGGTGGAGGG - Intergenic
992964233 5:81983746-81983768 CAGGGCGGCTGCTGGGCGGAGGG + Intronic
994106229 5:95952300-95952322 CTTTGAGGGTGGAGGGTGGAAGG + Intronic
995456841 5:112360986-112361008 CAGGGCGGCTGCCGGGCGGAGGG - Intronic
995942355 5:117599987-117600009 CAGGGCGGCTGCCGGGCGGAGGG + Intergenic
996038805 5:118787721-118787743 CAGTGTGGAAGGAGGGTGGTTGG + Intergenic
996386332 5:122913545-122913567 CAGGGCGGCTGCTGGGCGGAGGG + Intronic
996575955 5:124976547-124976569 CAGTGCGGCGGTAGGCTGAAGGG + Intergenic
997321644 5:132983174-132983196 CAGGGCGGCTGCCGGGCGGAGGG + Intergenic
997358702 5:133280769-133280791 CAGCGTGGCTGGAATGTGGAGGG - Intronic
997536358 5:134625304-134625326 CACTGCTGGTGGAGGGTGGAAGG - Intronic
997643641 5:135466171-135466193 CAGAGCGGTTGGAGAGTGAATGG + Intergenic
998128355 5:139638817-139638839 CAGTGAGGCAGGAGGCTGGCTGG - Intergenic
998163718 5:139828423-139828445 CATTGGGGCTGGATGGTGGAGGG + Intronic
998387785 5:141767915-141767937 CCGGGTGGCTCGAGGGTGGACGG + Intergenic
999455660 5:151714129-151714151 CGGGGCGGCTGCCGGGTGGAGGG + Intergenic
999532642 5:152480013-152480035 CAGGGCGGCTGCCGGGCGGAGGG + Intergenic
999532665 5:152480093-152480115 CGGGGCGGCTGCCGGGTGGAGGG + Intergenic
999986984 5:157014215-157014237 CGGGGCGGCTGCTGGGTGGAGGG - Intergenic
1000990151 5:167903529-167903551 GGGTGGGGGTGGAGGGTGGAAGG + Intronic
1001544102 5:172559209-172559231 GGCTGCGGCTGGGGGGTGGAGGG + Intergenic
1001579819 5:172790952-172790974 CAGTGGGGGTGGGGGATGGAGGG - Intergenic
1002466625 5:179411931-179411953 CGGTGGGGGGGGAGGGTGGAAGG - Intergenic
1002466717 5:179412141-179412163 CGGTGGGGGGGGAGGGTGGAAGG - Intergenic
1002466977 5:179412739-179412761 CGGTGGGGGGGGAGGGTGGAAGG - Intergenic
1003774872 6:9348944-9348966 CAGTGCAGCTGGGTGGTGGAAGG + Intergenic
1004152486 6:13134087-13134109 CAGGGCGGCTGCCGGGCGGAGGG - Intronic
1004321952 6:14638935-14638957 CTCTCCTGCTGGAGGGTGGAGGG - Intergenic
1004692542 6:18004772-18004794 CAGTGAGGCTGGAGGGAGCCAGG - Intergenic
1005122323 6:22403296-22403318 CAGTGTCCTTGGAGGGTGGAAGG - Intergenic
1005860393 6:29895948-29895970 CTGGGCGGCTGCTGGGTGGAGGG + Intergenic
1006141523 6:31932359-31932381 CAGGGCGGCTGCCGGGCGGAGGG + Intronic
1006225375 6:32532336-32532358 CGGGGCGGCTGCAGGGCGGAGGG - Intergenic
1006379916 6:33691480-33691502 CACTGTGGCTGGACAGTGGAGGG + Intronic
1006509348 6:34513517-34513539 CAGTGTGGGTGGTGGGTGGCAGG - Intronic
1006929388 6:37678592-37678614 CAATGTGGCTGGAGTGGGGAGGG - Intronic
1007523010 6:42466547-42466569 CGGGGCGGCTGCCGGGTGGAGGG - Intergenic
1008184366 6:48371417-48371439 CGGGGCGGCTGCCGGGTGGAAGG + Intergenic
1008482401 6:51999461-51999483 CAGAGCAGCTGGAGCCTGGAAGG - Intronic
1009049051 6:58257799-58257821 CGGGGCGGCTGCTGGGTGGAGGG - Intergenic
1010400620 6:75442037-75442059 CGGGGCGGCTGCCGGGTGGAGGG + Intronic
1010513151 6:76744446-76744468 CAGGGCGGCTGCCGGGCGGAGGG - Intergenic
1011410389 6:87060205-87060227 CAGTGCAGCGGCAGGCTGGAGGG + Intergenic
1012247043 6:96937717-96937739 CTGTGAGGATGGAGGGTAGAGGG - Intronic
1016123645 6:140373952-140373974 CGGGGCGGCTGCCGGGTGGAGGG + Intergenic
1017048870 6:150372177-150372199 CAGAGCTGCAGGAGGTTGGATGG - Intronic
1017493808 6:154966430-154966452 CGGGGCGGCTGCCGGGTGGAGGG + Intronic
1018698857 6:166411752-166411774 CAGTCCAGCTGGAGGCTGGAGGG - Exonic
1018840612 6:167514123-167514145 CAGTGTGACTGGGGGGTGGGGGG + Intergenic
1019290192 7:246518-246540 GAGCGCGGATGGAGGGAGGAAGG - Intronic
1019323597 7:426469-426491 GAGTGTTGGTGGAGGGTGGAGGG - Intergenic
1019486035 7:1289576-1289598 CTGTGGGTTTGGAGGGTGGAAGG - Intergenic
1019488495 7:1300349-1300371 CACTGCAGGTGGAGGGTGGAAGG - Intergenic
1019674434 7:2302894-2302916 CAGGGCGGCTGCCGGGCGGAGGG - Intronic
1019709389 7:2511386-2511408 GAGTGAGGCAGGAGGCTGGAGGG - Intergenic
1020010628 7:4804004-4804026 CAGTGGGGCTGGAGGGTTCCTGG - Intronic
1020188079 7:5974036-5974058 CAGTGCAGCTGGGGTGAGGAAGG - Intronic
1020261030 7:6530964-6530986 GGGTGGGGCTGGAGCGTGGAGGG - Intronic
1020294839 7:6750733-6750755 CAGTGCAGCTGGGGTGAGGAAGG + Intergenic
1021991867 7:26148211-26148233 CGGGGCGGCTGCCGGGTGGAGGG - Intergenic
1022044805 7:26614127-26614149 CAGAGTGGCTGGGGGGTTGAAGG + Intergenic
1022187870 7:27987407-27987429 CGGGGCGGCTGCCGGGTGGAGGG - Intronic
1022444187 7:30456372-30456394 CAGTGCCTCTGAAGGCTGGAGGG - Intronic
1022968530 7:35496428-35496450 CAGTGCGTCAGGTGGATGGATGG - Intergenic
1023170342 7:37385340-37385362 CAGTGTGGCTGGAGGGGAGGGGG - Intronic
1023312492 7:38902340-38902362 CAGTGTGGCTGGAGGGTCACAGG - Intronic
1023530647 7:41149853-41149875 GAGCGAGGGTGGAGGGTGGAGGG - Intergenic
1023558042 7:41443643-41443665 CAGTGAGGAAGGAGGGTGGTGGG + Intergenic
1023856305 7:44186174-44186196 CAGGGCAGCTGGAGGGAGGAAGG + Intronic
1024024826 7:45401196-45401218 CAGTGCAGGAGGATGGTGGAGGG + Intergenic
1024262036 7:47580579-47580601 CGCTGCAGCTGGAGGGTGGAGGG - Intronic
1024282054 7:47726494-47726516 CATTCTGGCTGGAGGGTGCAGGG + Intronic
1024555630 7:50600875-50600897 AAGTGGGGCTGTGGGGTGGAAGG - Intronic
1025000577 7:55311968-55311990 CGGGGCGGCTGCCGGGTGGAGGG - Intergenic
1025573018 7:62599931-62599953 CAGGGCGGCTGCCGGGCGGAGGG + Intergenic
1026035160 7:66825239-66825261 CAGGGCAGCTGGAGGGGGGCTGG + Intergenic
1026760935 7:73125194-73125216 CAGTGAGGCAGCAGCGTGGATGG - Intergenic
1026984379 7:74545844-74545866 CAGGGCGGCTGGAGGGGGGCCGG - Intronic
1027037277 7:74933990-74934012 CAGTGAGGCAGCAGCGTGGATGG - Intergenic
1027086285 7:75267462-75267484 CAGTGAGGCAGCAGCGTGGATGG + Intergenic
1028392595 7:90334333-90334355 CAGTGCGGCGGGGGGCTGAAGGG - Intergenic
1029392588 7:100285489-100285511 CAGTGAGGCAGCAGCGTGGATGG + Intergenic
1029496532 7:100897881-100897903 CAGTTCGTCTGGAGGGTGACAGG - Intergenic
1029716643 7:102331693-102331715 CAGTGCAGTTGGAGGGTGACTGG + Intergenic
1029817806 7:103114464-103114486 CAGTTCAGCAGGAGAGTGGAGGG - Intronic
1030199746 7:106890794-106890816 CAGTGTGGCATGAGGCTGGAGGG - Intronic
1030706367 7:112697389-112697411 CAGGGCGGCTGCCGGGCGGAGGG + Intergenic
1030725695 7:112922708-112922730 CAGGGCGGCTGCCGGGCGGAGGG - Intronic
1031660377 7:124416912-124416934 CGGGGCGGATAGAGGGTGGAAGG - Intergenic
1033169940 7:139075063-139075085 CAGTGGGGCTGGTGGGGGGGTGG + Intronic
1033299360 7:140173390-140173412 CTGTCAGGCTGCAGGGTGGATGG - Intronic
1036242306 8:7091197-7091219 CTGTGGGGCTGGAGCGTGGTGGG - Intergenic
1036259543 8:7228959-7228981 CTGTGGGGCTGGAGCGTGGTGGG + Intergenic
1036307080 8:7610565-7610587 CTGTGGGGCTGGAGCGTGGTGGG - Intergenic
1036311587 8:7687529-7687551 CTGTGGGGCTGGAGCGTGGTGGG + Intergenic
1036357926 8:8058552-8058574 CTGTGGGGCTGGAGCGTGGTGGG - Intergenic
1036737281 8:11330256-11330278 CAGGGCGGCTGGCCGGTGGGGGG - Intergenic
1036830433 8:12015933-12015955 CTGTGGGGCTGGAGCGTGGTGGG + Intergenic
1036891965 8:12602258-12602280 CTGTGGGGCTGGAGCGTGGTGGG + Intergenic
1036893021 8:12608394-12608416 CTGTGGGGCTGGAGCGTGGTGGG + Intergenic
1037894449 8:22642394-22642416 CAGTGCCTCTGGGGAGTGGAGGG + Intronic
1038103746 8:24410292-24410314 AATGGCGGGTGGAGGGTGGAAGG - Intergenic
1038131406 8:24735991-24736013 CAGTGGGGCAGGTGGGTAGAAGG + Intergenic
1040543300 8:48378536-48378558 CAGTGCCGGTGGAGAGTGGCTGG - Intergenic
1041261909 8:56028246-56028268 CAGTGTGGAGGGAGGGAGGACGG + Intergenic
1041623492 8:59999776-59999798 CAGTGCAGCGGCAGGCTGGAGGG - Intergenic
1041847278 8:62344097-62344119 CAGCCAGGCTGGGGGGTGGAGGG + Intronic
1041986970 8:63933380-63933402 CACAGGGGCTGGAGGGGGGAAGG - Intergenic
1042134000 8:65616845-65616867 CAGGGCGGCTGCCGGGTGGAGGG - Intronic
1042475676 8:69245767-69245789 CAGGGCGGCTGCCGGGCGGAGGG - Intergenic
1042705709 8:71664134-71664156 CAGTGTGGCTGGAGGAGGGTGGG - Intergenic
1044597222 8:93970732-93970754 CGGGGCGGCTGCTGGGTGGAGGG + Intergenic
1044597235 8:93970772-93970794 CGGGGCGGCTGCTGGGTGGAGGG + Intergenic
1045298699 8:100892762-100892784 CGGTGCGGCTGCCGGGCGGAGGG + Intergenic
1046497705 8:115036620-115036642 CAGTGCAGCGGCAGGGTGAAGGG - Intergenic
1047768092 8:128005762-128005784 CACTGCTGCTGAAAGGTGGAGGG + Intergenic
1048107861 8:131430967-131430989 CAGTGAGGTTGGAGGGTGGGAGG - Intergenic
1048440903 8:134458380-134458402 CTGGGAGGCTGGAGGGAGGAGGG + Intergenic
1048703619 8:137123858-137123880 CAGTACCACTGGTGGGTGGATGG - Intergenic
1049167073 8:141133120-141133142 CAGTGAGCGTGGGGGGTGGAGGG + Intronic
1049573009 8:143378364-143378386 CAGGGCTGCAGGAGGGTGGGTGG - Intronic
1050340810 9:4636841-4636863 CATTGTGGCTGGAGCGTGGCTGG - Intronic
1051273162 9:15374685-15374707 CAGTGCGGTTGGTGGGAGCATGG + Intergenic
1052831741 9:33221404-33221426 CAGTGTGCCTGGAGGGTTCAGGG - Intronic
1059581600 9:115555521-115555543 CATGGTGGCAGGAGGGTGGAGGG + Intergenic
1060401802 9:123353928-123353950 CAGTGCTGCTGGTGGGTGGGGGG + Intergenic
1060465441 9:123900460-123900482 AAGTGCGGCAGGAGGGTAAAGGG + Intronic
1060995320 9:127872452-127872474 CAGGGTGGCTGAAGGATGGAGGG + Intronic
1061556512 9:131373334-131373356 CAGTCCGGCTCGAGGGCGGAGGG - Intergenic
1061701772 9:132421565-132421587 CAGCGGGGCTGGAGTTTGGAGGG + Intronic
1061789490 9:133051616-133051638 CAGTGTGGCCGGAGTGTAGAGGG - Intronic
1061961206 9:133990276-133990298 CCCTGCTGCTGGGGGGTGGACGG - Intronic
1062186628 9:135221900-135221922 CAGTGTGTCTGGAGGGAGCAAGG - Intergenic
1062196362 9:135276398-135276420 CTGTGTGGCAGGAGGTTGGAGGG - Intergenic
1062262285 9:135668911-135668933 CACTGGGGTTGGGGGGTGGAGGG - Intergenic
1062318204 9:135978391-135978413 CAGGGCTGCTGCAGGGGGGATGG - Intergenic
1062699544 9:137891738-137891760 CTGTGGGGCTGTAGAGTGGAGGG + Intronic
1186605118 X:11081487-11081509 CAGTATGTCTGGAGGGTGGCAGG + Intergenic
1187223396 X:17352783-17352805 TTGTGCGGGTGGAGGGTGGAGGG - Intergenic
1187464997 X:19519207-19519229 CAGTGGGGCTGGGGGGAGGTAGG - Intergenic
1188000981 X:24981348-24981370 TATTGGGGCTGGAGGGGGGAAGG - Intronic
1189179107 X:38986767-38986789 CAGAGGGGCTGCAGGGAGGAGGG - Intergenic
1189235093 X:39480852-39480874 GGGTGCGGCTGGGAGGTGGAGGG + Intergenic
1189880876 X:45491080-45491102 CAGTGGAGCTGGTGGGGGGAAGG - Intergenic
1189882095 X:45503974-45503996 CTGGGCGGCTGCTGGGTGGAGGG + Intergenic
1190063854 X:47227098-47227120 CGGTGAGGCTGGTGGGTGGGTGG + Exonic
1190119754 X:47650395-47650417 CTCTGGGCCTGGAGGGTGGAGGG - Intronic
1191606108 X:63064758-63064780 AATTGAGGGTGGAGGGTGGAAGG - Intergenic
1192386775 X:70679615-70679637 CAGCGCGGCTGCCGGGCGGAGGG - Intronic
1192464091 X:71341770-71341792 CGGGGCGGCTGCCGGGTGGAGGG + Intergenic
1192794203 X:74412789-74412811 CGGGGCGGCTGCCGGGTGGAGGG + Intergenic
1192813495 X:74568942-74568964 CGGGGCGGCTGCTGGGTGGAGGG + Intergenic
1192813522 X:74569059-74569081 CGGGGCGGCTGCTGGGTGGAGGG + Intergenic
1193300987 X:79887905-79887927 GAGTGAGGCTGGGAGGTGGATGG + Intergenic
1193362199 X:80591181-80591203 CGGGGCGGCTGCCGGGTGGAGGG - Intergenic
1194181192 X:90713821-90713843 CGGGGCGGCTGCAGGGCGGAGGG - Intergenic
1194914225 X:99685318-99685340 CAGTGCTGCTGGTGGCTGGCTGG - Intergenic
1195009773 X:100723756-100723778 CGGTGCGGCTGCCGGGCGGAGGG - Intronic
1195264181 X:103164135-103164157 CACAGGGGCTGGAGGGTGGGAGG + Intergenic
1195909668 X:109876307-109876329 CAGTGCAGCGGCAGGCTGGATGG + Intergenic
1196052332 X:111318790-111318812 AATTGAGGGTGGAGGGTGGAAGG + Intronic
1196683613 X:118493313-118493335 CAGTGTGGCTGGAGCGTAGAAGG - Intergenic
1197018371 X:121655285-121655307 CAGTGAGGGTGGTGGGTGGTGGG + Intergenic
1197747200 X:129939631-129939653 CAGTGGGGCGGCAGGGTGGAGGG - Intergenic
1198575298 X:138004175-138004197 CAGTGTGGCTGGAGCATAGAGGG + Intergenic
1198600800 X:138282782-138282804 CGGGGCGGCTGCCGGGTGGAGGG + Intergenic
1199264872 X:145818178-145818200 CAGTGGGGATTGAGGGTAGAGGG - Exonic
1199642085 X:149872142-149872164 CAATGCAGCTGGATGGGGGATGG - Intergenic
1199836762 X:151599508-151599530 CGGGGCGGCTGCCGGGTGGAGGG + Intronic
1200094749 X:153652075-153652097 AAGGGCAGCTGGAGGGTGGCGGG + Intergenic
1200174001 X:154099062-154099084 CAGTGTTGCTGGAGAGTGGTAGG + Intergenic
1200229845 X:154438401-154438423 CAGTGGGGATGGTGGGTGGAAGG + Intronic
1200257574 X:154592560-154592582 TAATGCGGCTGTGGGGTGGAAGG - Intergenic
1200387434 X:155907842-155907864 CGGGGCGGCTGCCGGGTGGAGGG + Intronic
1200527820 Y:4295750-4295772 CGGGGCGGCTGCAGGGCGGAGGG - Intergenic