ID: 1104984297

View in Genome Browser
Species Human (GRCh38)
Location 12:132587871-132587893
Sequence CTGGGAGCACTCTGTGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 439
Summary {0: 2, 1: 0, 2: 1, 3: 35, 4: 401}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104984287_1104984297 10 Left 1104984287 12:132587838-132587860 CCTTCTTGGGAGCATTCGTGAGG 0: 1
1: 0
2: 0
3: 7
4: 77
Right 1104984297 12:132587871-132587893 CTGGGAGCACTCTGTGAGGAGGG 0: 2
1: 0
2: 1
3: 35
4: 401

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104984297 Original CRISPR CTGGGAGCACTCTGTGAGGA GGG Intergenic
900575229 1:3379516-3379538 CTGGGAGGACTGTGTTGGGATGG - Intronic
900575282 1:3379684-3379706 CTGGGAGGACTGTGTTGGGATGG - Intronic
900575294 1:3379726-3379748 CTGGGAGGACTGTGTTGGGATGG - Intronic
901759899 1:11463875-11463897 ATGGGAGCACCCTGGGAGGGAGG + Intergenic
901878321 1:12179611-12179633 CTGTGAACACACTGTGAGCAGGG - Intronic
902217009 1:14940607-14940629 CTGGGAGCTCTTTGTGAGGGTGG + Intronic
902554670 1:17239968-17239990 CTGGGAGCTCTCTGAGGGCATGG - Intronic
902632838 1:17715858-17715880 CTGGGAGAATTCAGTGAGGCAGG - Intergenic
902767305 1:18625921-18625943 CAGGGAACACTCTGTAAAGATGG + Intergenic
904224882 1:29008393-29008415 CTGCAATAACTCTGTGAGGATGG + Intronic
904343661 1:29854146-29854168 CTGGGCTCACCCTGTGAGGCGGG - Intergenic
906075717 1:43050518-43050540 CTTGGGGCGCCCTGTGAGGAAGG + Intergenic
907225370 1:52941330-52941352 CTGGAAGCACTCTGAGGGCAAGG + Intronic
909475437 1:76075832-76075854 CTGGGGGAACTGTGTGACGATGG + Intronic
910472242 1:87567107-87567129 CTGGGAACAATCTGTAAGCATGG + Intergenic
911104439 1:94118747-94118769 CTGGGAGCACACTGTGGAGAAGG + Intronic
911130300 1:94380973-94380995 GTGGGGGCAAACTGTGAGGAAGG - Intergenic
912303456 1:108540568-108540590 CTGGGAGCACTATGGGAGACTGG - Intergenic
912483506 1:110004462-110004484 CTGGGAGCATTGTGTTGGGAAGG + Intronic
912529958 1:110313056-110313078 ATGGCAGCACGCTGTGAGGGAGG - Intergenic
912807161 1:112766241-112766263 CTGGGAGCACTATGGGAGACTGG - Intergenic
915601382 1:156924857-156924879 CTGGGAGAACGGTGTGGGGAGGG + Intronic
915669151 1:157472846-157472868 ATGAGAGTACTCTGTGAGTAGGG - Intergenic
917253792 1:173092378-173092400 CTGGGAGCACTATGTTAAGCAGG + Intergenic
917854341 1:179088991-179089013 CAGGGCTCACTTTGTGAGGATGG + Intronic
918114654 1:181485539-181485561 CTGGGATCACTCTGTGAGAGTGG - Intronic
919917081 1:202145214-202145236 CTGGGTGCATTTTGAGAGGATGG - Intergenic
921427371 1:215020167-215020189 ATGGGAGCATTCTTTAAGGATGG + Intronic
923098466 1:230793876-230793898 AAGGGAGCACTCAGAGAGGAGGG + Intronic
923413132 1:233729776-233729798 TTGGGAGCACTTTGGGAGGCAGG + Intergenic
923789065 1:237095691-237095713 CTGGGACCACTCTGTGGAAATGG - Intronic
1063017890 10:2096480-2096502 CTGGGAGGAATCTGAGAGAAGGG + Intergenic
1063160366 10:3414142-3414164 CTGGGAGGAATGTGTGAGGGTGG + Intergenic
1063229467 10:4049941-4049963 CTGGGAGGACTTTGTGTGGTAGG + Intergenic
1063624953 10:7680104-7680126 CTGGGAGCCCTCAGTGGGGGTGG - Intergenic
1064282908 10:13967791-13967813 ATGCCAGCACTCTGGGAGGATGG + Intronic
1064620936 10:17216756-17216778 TTGGGAGCCCTCTGAGAGGAAGG + Intergenic
1065179974 10:23114965-23114987 CTGGGATCACTCTCAGAGGCTGG - Intronic
1065228639 10:23574079-23574101 CTGGGAGGACCCTCTGAGGTAGG - Intergenic
1066111055 10:32197585-32197607 CTGGAATCTCTCTGGGAGGAGGG + Intergenic
1067465839 10:46498146-46498168 CTGGGAACACTCTGGAAGAAAGG - Intergenic
1067621348 10:47886460-47886482 CTGGGAACACTCTGGAAGAAAGG + Intergenic
1068515624 10:58022030-58022052 CTGGGAGCACTATGGGAGACTGG - Intergenic
1070325379 10:75385263-75385285 CTGGGAGCATTCTCTTGGGATGG + Intergenic
1070582921 10:77736846-77736868 CTGGGAGCACTATGGGAGACTGG - Intergenic
1070849466 10:79551881-79551903 CGGGAAGCACACAGTGAGGAGGG - Intergenic
1071490758 10:86134931-86134953 CTGGGAGCCCTGTGAGAGCAGGG + Intronic
1073205488 10:101767260-101767282 CTGAGAGCCCTAGGTGAGGAAGG + Intergenic
1073678583 10:105677790-105677812 CTGGGAGCACTGTGGGAGACTGG - Intergenic
1075305368 10:121362953-121362975 CTCACATCACTCTGTGAGGATGG + Intergenic
1076711061 10:132335018-132335040 CTGGGAGCCTCATGTGAGGATGG - Intronic
1076911085 10:133390005-133390027 CTGGGAGCACCGTCTGAGAAGGG - Intronic
1077148417 11:1056303-1056325 CTGGGAGCACTGCCTGAGCATGG - Intergenic
1077506336 11:2931488-2931510 CTTGGAGGACTCTGTGGGGAGGG + Intergenic
1077552036 11:3204696-3204718 CTGAGAACACTGTGTGAGCAAGG + Intergenic
1077819192 11:5719438-5719460 CAGGGAGCGCTCTGTGGAGATGG - Intronic
1078994943 11:16687524-16687546 TTGGGAGCACTTTGGGAGGCAGG - Intronic
1079249455 11:18776456-18776478 CAGGGAGCTCTGTGTGAGGCTGG - Intronic
1080203654 11:29704951-29704973 CTGGGAGCACTATGGGAGACCGG - Intergenic
1080896472 11:36452530-36452552 CTGGGAGGAATGAGTGAGGAAGG - Intronic
1081461246 11:43274652-43274674 CTGGGAGCACTATGGGAGACTGG + Intergenic
1084244027 11:67843379-67843401 CTGGGAGCACTATGGGAGACTGG + Intergenic
1084742488 11:71148569-71148591 CTGGGTGCGTTCTGTGGGGAAGG + Intronic
1085319546 11:75565500-75565522 CTGGGAGCACTGTGGGTAGATGG + Intronic
1087006129 11:93473827-93473849 CTGGGAGGACTGTGTGAGATAGG + Intergenic
1088967259 11:114736277-114736299 CTGGGAGCACTATGGGAGACTGG + Intergenic
1089286769 11:117412438-117412460 CCGGGAGCCCTTTGGGAGGAAGG + Exonic
1089500154 11:118927205-118927227 CTGGGGACCATCTGTGAGGAGGG - Intronic
1090222872 11:125045898-125045920 CTGGGAGCACTATGGGAGACTGG - Intergenic
1090877463 11:130803750-130803772 CTGGGAACACTCTGTCAAGATGG - Intergenic
1091230247 11:133983681-133983703 CTTGGCCCCCTCTGTGAGGAAGG - Intergenic
1091243030 11:134067200-134067222 CTGGAAGCATTCCGTGAGCAGGG - Intergenic
1092131744 12:6117863-6117885 CTCGGAACACTCAGTGAAGAGGG + Intronic
1092250407 12:6891914-6891936 CTGTGAATACTCTGGGAGGATGG + Intronic
1094020063 12:25904619-25904641 CTGAGAGCAATTTCTGAGGAAGG - Intergenic
1094326752 12:29248700-29248722 CTGGGAGCACTATGGGAGACTGG + Intronic
1095722500 12:45415777-45415799 CAGGGATGACTCTGTCAGGAAGG - Intronic
1096486105 12:51982466-51982488 CTGGGAGCTCTGTGAGGGGAGGG - Intronic
1097957975 12:65505964-65505986 CTCGCCGCACTCTGAGAGGAGGG + Intergenic
1098784627 12:74735920-74735942 GTGGGAGTAAACTGTGAGGATGG - Intergenic
1099117753 12:78648836-78648858 CTGGGAGCACTATGGGAGCCTGG - Intergenic
1101080280 12:101174341-101174363 CTGGCAGCACTCTTAGAAGATGG + Intronic
1102308021 12:111821177-111821199 CTGGGAGCACTATGGGAGACTGG + Intergenic
1102474084 12:113177380-113177402 CTGGGGGCACTGTGGGTGGAAGG - Intronic
1102537018 12:113589228-113589250 CTGGGAGATCTCTTGGAGGATGG + Intergenic
1103341047 12:120221349-120221371 CTGGGAGCACCCAGGGAGGAAGG + Intronic
1104257060 12:127148098-127148120 TTGGGAGCAATGTGTGAGGGAGG + Intergenic
1104811336 12:131622028-131622050 CAGAGAGCAGTGTGTGAGGAGGG - Intergenic
1104984297 12:132587871-132587893 CTGGGAGCACTCTGTGAGGAGGG + Intergenic
1104984319 12:132587960-132587982 CTGGGAGCACTCTGTGAGGAGGG + Intergenic
1106390922 13:29335265-29335287 CTGGGAGCACTATGGGAGACCGG - Intronic
1112449334 13:99494716-99494738 CTGGGAGCACTATGGGAGTCCGG + Intergenic
1113557448 13:111249753-111249775 TTGTGAGCACTTTGTGAGGAAGG + Intronic
1113748767 13:112764492-112764514 CAGGGAGAACTCTGTCTGGAAGG + Intronic
1114544841 14:23491754-23491776 CTGGAAGCACACTGTAAAGAGGG + Intronic
1119437198 14:74605332-74605354 CTGGGAGCTCCCTGGGAGGGAGG - Intronic
1121009931 14:90513828-90513850 CTGGGAGCTCTCTGAGAGGCAGG + Intergenic
1121595501 14:95158620-95158642 CTGTGTGCACCCTGTGAGGTAGG + Intergenic
1121661732 14:95640185-95640207 GAGGGAGCAACCTGTGAGGATGG - Intergenic
1121825435 14:97006702-97006724 CTGGGATCACCCTGGTAGGAAGG + Intergenic
1122861549 14:104584812-104584834 CTGGGAGGACACTGTCTGGACGG - Intronic
1123690368 15:22833601-22833623 CTGGGAGCACTATGGGAGACTGG + Intergenic
1124403816 15:29376639-29376661 CTGTGAGCACTCAGTGAGGGAGG - Intronic
1125567324 15:40686514-40686536 CTGGGAGCACTCTGAGAAACTGG + Intergenic
1126276168 15:46884007-46884029 CTGGGAGCACTATGGGAGACCGG + Intergenic
1127733172 15:61818691-61818713 GAGGGAACACTCTGTGGGGATGG - Intergenic
1127755108 15:62084509-62084531 CTGGGAGCACTATGGGAGACTGG + Intergenic
1127920081 15:63487520-63487542 CTGGGAGAGCTCTGCGCGGAAGG + Intergenic
1128089955 15:64912537-64912559 CTGGGCGCACTCCTTGAGGGAGG - Intronic
1128477188 15:68007298-68007320 CTGGGAGCACTATGGGAGACGGG - Intergenic
1129797524 15:78389412-78389434 CTGGGATCAGTTTGAGAGGAGGG - Intergenic
1129888578 15:79056045-79056067 CAGGGAGCACCCTCTGAGGCAGG + Intronic
1130098476 15:80873861-80873883 CAGGGAGCACACTGCCAGGATGG + Exonic
1130948166 15:88564914-88564936 CTGTGAGGACTCCGTGAGGTGGG + Intergenic
1132506796 16:314165-314187 CTGGGACCTCCCTATGAGGAAGG - Intronic
1132533204 16:463945-463967 CAGGCAGCCCTCTCTGAGGAGGG + Intronic
1132568581 16:634381-634403 CTAGGAGCACCTTGTGAGGTTGG - Intergenic
1135301139 16:21328497-21328519 CTGGGAGCACTATGGGAGACTGG - Intergenic
1135813505 16:25611027-25611049 CTGGGAGCACTATGGGAGACTGG + Intergenic
1136254402 16:29028738-29028760 CAGGGACCACCCTCTGAGGAAGG - Intergenic
1136407697 16:30058127-30058149 CTTGCAGCCCTCTGTGGGGAAGG - Intronic
1136449133 16:30342829-30342851 CTGTGACCACTCTGTGACAAGGG + Intergenic
1136491233 16:30609827-30609849 CTGGGCGCGCTCGGTGAGGCCGG - Exonic
1137484683 16:48881413-48881435 CTGGGAGCCCTTTGTAAGGGTGG + Intergenic
1137804323 16:51289037-51289059 CTGGGAGCTCTCTCTGAGGAAGG - Intergenic
1137838089 16:51613306-51613328 CTGGGGGCGCACTGTGAGGGTGG + Intergenic
1138209985 16:55155406-55155428 CTGGGAATAGTCTGTGAAGATGG + Intergenic
1138352350 16:56352679-56352701 CTGGGAGCAGTGTGTGAAGAAGG + Intronic
1138490490 16:57373497-57373519 GTGGGGGCACTCCCTGAGGAGGG - Intronic
1138541528 16:57690543-57690565 CAGGGACCACTCTGGGATGAGGG - Intergenic
1138679164 16:58672569-58672591 CAGGAAGCATTCTCTGAGGAAGG - Intronic
1139959877 16:70711323-70711345 CTGGCAGGAGTCTGAGAGGATGG + Intronic
1141268179 16:82515869-82515891 CTGGAAGCACTGTGTGAAGGAGG + Intergenic
1141379736 16:83565539-83565561 CTGGGAACTCCCTGAGAGGAAGG + Intronic
1142266595 16:89066817-89066839 ACTGGAGCACTCTGAGAGGACGG - Intergenic
1142716476 17:1749723-1749745 AAGGGAGAATTCTGTGAGGAGGG + Intronic
1143091382 17:4450956-4450978 CTGGGAGGGCCCTGTGTGGATGG + Intronic
1143155655 17:4834309-4834331 CTGGGAGCCCTCGGGGAGGAGGG + Intronic
1143270088 17:5668931-5668953 CTGTGAGCACTGTCTGAGGGAGG - Intergenic
1143866854 17:9929890-9929912 CTGTGAGGACACTTTGAGGAAGG - Intronic
1143977762 17:10842988-10843010 ATGGGAGCACTCAGTTAGAAGGG - Intergenic
1144888445 17:18479371-18479393 CTGGCAGCGTTCTGAGAGGACGG - Intronic
1145143761 17:20464931-20464953 CTGGCAGCGTTCTGAGAGGACGG + Intronic
1145765100 17:27453581-27453603 CTGGAGGCCATCTGTGAGGAAGG + Intergenic
1145960714 17:28885159-28885181 CTTGGAGCACCTTGTGTGGAAGG - Intronic
1146688427 17:34856920-34856942 ATGGGAGGACTCTCTTAGGATGG + Intergenic
1146704662 17:34992229-34992251 CTGTAAGAACTCTGTGAGAAAGG - Intronic
1147258330 17:39195141-39195163 CTGGGCCCTCTCCGTGAGGATGG - Intronic
1147427264 17:40351827-40351849 CTGGCAGCTCTCTGTCAGGCTGG + Intronic
1148391317 17:47275239-47275261 CTGGGCCCACTTGGTGAGGATGG + Intronic
1148545262 17:48513888-48513910 CTCAGAGCACTTGGTGAGGATGG + Intergenic
1148964707 17:51425221-51425243 CTTGGAGCACCCTGAGAGGGAGG - Intergenic
1149574211 17:57699891-57699913 CAGTGGGCACTCTCTGAGGAAGG + Intergenic
1150331100 17:64294986-64295008 CTAGGATCACCCAGTGAGGAAGG - Intergenic
1150630620 17:66877782-66877804 CTGGGAGCAGAGTGTGGGGAAGG - Intronic
1151864681 17:76793217-76793239 CTGGGAGCACTATGGGAGACTGG + Intergenic
1152071780 17:78137719-78137741 CTGGGAGAACTCCGTGGGGGAGG + Exonic
1152120178 17:78413679-78413701 CTGGGTGCCCTGTGGGAGGAAGG + Intronic
1152469499 17:80482934-80482956 CTGGGAGCCCTTGGTGAGGGCGG + Intergenic
1153485502 18:5593679-5593701 CTGGGAGCACTATGGGAGACTGG + Intronic
1155177064 18:23310209-23310231 ATGGGAGCATTAGGTGAGGACGG - Intronic
1155854511 18:30816091-30816113 CTGGGAGCACTATGGGAGACTGG - Intergenic
1156411247 18:36829512-36829534 CTGGGGGCACTCTGACAGGGTGG - Intronic
1158890065 18:61864322-61864344 CTAGCAGAACTCTGTGAGAATGG + Intronic
1159850168 18:73517419-73517441 CTGGGAGCACTATGGGAGACTGG + Intergenic
1159914076 18:74173334-74173356 CTGGGAGGACTGGGTGAGGAAGG - Intergenic
1160370554 18:78369172-78369194 CAGGGAGCACTCACTGAGCACGG + Intergenic
1161181823 19:2888863-2888885 CTGGGAGCAATCTGAGGGGCGGG + Intergenic
1161572960 19:5040319-5040341 CAGGGAGCCCTCTCTGAGGAGGG - Intronic
1163557128 19:17999200-17999222 CTGGGACCACACTGCGAGGAAGG + Exonic
1164172118 19:22734501-22734523 CTGGGAGCACTATGGGAGGCTGG - Intergenic
1164365653 19:27579285-27579307 CTGGGAGCACTATGGGAGACTGG - Intergenic
1164378733 19:27712681-27712703 CTGGGAGCACTATGGGAGACTGG + Intergenic
1164617623 19:29676279-29676301 CTGTGGGCACCCTGTGAGGGAGG + Intergenic
1164979601 19:32603900-32603922 CTGTGTTCACACTGTGAGGATGG + Intronic
1165665414 19:37623321-37623343 CTGGGAGCACTATGGGAGACTGG - Intronic
1165815929 19:38642260-38642282 CTGGGAGCACTTGGTCTGGACGG + Intergenic
1165937393 19:39397683-39397705 CTGGGGGCACTCTGTGAAGTGGG + Exonic
1166364803 19:42272960-42272982 CTGGGTACTCACTGTGAGGAGGG + Intronic
926556320 2:14362336-14362358 CTGGGAGCACTATGGGAGACTGG + Intergenic
926620141 2:15040034-15040056 AGAGGAGCACTCTGCGAGGATGG + Intergenic
927467438 2:23347950-23347972 CTGAGAGCACACAGTGAGGAAGG + Intergenic
927756357 2:25711421-25711443 CTGGGTGCACTTTGGGAGGCTGG + Intergenic
928253762 2:29704365-29704387 CTTGGAGACCTCTGAGAGGAAGG + Intronic
929212993 2:39379551-39379573 CTGGGAGCATTCTGTAAAGGAGG + Intronic
929567989 2:43001701-43001723 CTGGGAGCTCTCTGAGGGGCAGG - Intergenic
929910110 2:46082607-46082629 CAGCAAGCACTCAGTGAGGATGG + Intronic
930904502 2:56549846-56549868 CTGGCAGCTCTCTGTAAGCAAGG + Intergenic
931638258 2:64359922-64359944 CTGAAAGCACTCTCTGAGGCTGG + Intergenic
932760320 2:74435334-74435356 CTGTGAGAATTCTGTGAGGCAGG + Intronic
933170071 2:79115213-79115235 AAGGGAGGACTCTGGGAGGAGGG - Intergenic
933333094 2:80920002-80920024 CTGGGAGCACTATGGGAGACTGG - Intergenic
934106751 2:88702129-88702151 CTGGGAGTACAATTTGAGGAGGG + Intronic
936239986 2:110779236-110779258 CTGGGAGCATTCTGTAACAAAGG - Intronic
937894781 2:126970677-126970699 CTGGGAGGATTCTGGAAGGATGG - Intergenic
941571149 2:167172476-167172498 CTGGGAGCACTATGGGAGACTGG + Intronic
942380814 2:175388252-175388274 CTGGGAGCACTATGGGAGACTGG - Intergenic
942607315 2:177706353-177706375 CTGGGAGCACTTTAAGAGAAGGG + Intronic
943606622 2:189984213-189984235 CTGGGAGCACTATGGGAGACTGG + Intronic
944178618 2:196862277-196862299 CTGGGAGCACTATGAGAGACTGG - Intronic
944244963 2:197521554-197521576 CTGGGAGCACTATGGGAGACTGG + Intronic
944780074 2:203008612-203008634 CTGGGAGCACTATGGGAGACTGG - Intronic
946170339 2:217891597-217891619 CTCTGAGTGCTCTGTGAGGATGG - Intronic
946582980 2:221150730-221150752 ATGTGAGCACACTGTGAGAAAGG - Intergenic
946703103 2:222432128-222432150 CTGAGAGCACTGTGTTAAGAAGG + Intronic
946946823 2:224830072-224830094 CTGGGAGCAGCCTGGGGGGAGGG - Intronic
947805105 2:232961080-232961102 TTGGATGAACTCTGTGAGGATGG + Intronic
948484503 2:238271911-238271933 CTGGAATCTCTCTGGGAGGAGGG - Intronic
1169731780 20:8793841-8793863 CTGGGAGCACTATGGGAGACTGG + Intronic
1170154945 20:13261008-13261030 CTGAGAACACTCGGTGAAGAAGG - Intronic
1171495462 20:25551958-25551980 CTGTGAGCAATTTGTGAGGGAGG + Intronic
1172105602 20:32515520-32515542 GTGGGTGCACACTGAGAGGATGG + Intronic
1172230265 20:33331565-33331587 CTGGGTGCACTCTGAGCAGACGG - Intergenic
1172264388 20:33598276-33598298 CTGGGAGCACTATGGGAGACTGG + Intronic
1173461616 20:43247657-43247679 CTGGGATCACTCTCTGTGGAAGG + Intergenic
1173614150 20:44391658-44391680 CTGAGAGCAAGCTTTGAGGATGG - Intronic
1174062092 20:47839983-47840005 CTGGCAGCACCCAGTGAGAAAGG - Intergenic
1174069413 20:47889248-47889270 CTGGCAGCACCCAGTGAGAAAGG + Intergenic
1175335336 20:58192500-58192522 GTGTGAGCACTCAGTGAAGATGG + Intergenic
1175410139 20:58762351-58762373 GTGGAAGGGCTCTGTGAGGAGGG + Intergenic
1176112157 20:63415691-63415713 CTGGCAGGACAGTGTGAGGAAGG - Intronic
1176164970 20:63668049-63668071 CTGGGCACACACTGGGAGGAGGG - Intronic
1176290825 21:5043725-5043747 CTGGGAGAATGCAGTGAGGAAGG + Intergenic
1177405533 21:20662793-20662815 CTGGAATCAATCTGTGAGGTGGG + Intergenic
1178605806 21:34035710-34035732 CTGGGAGCCCTCTTTGCGCACGG + Intergenic
1179866430 21:44219916-44219938 CTGGGAGAATGCAGTGAGGAAGG - Intergenic
1180162555 21:46004741-46004763 CTGCGAGTACTCTCTGAGGTCGG - Exonic
1180749130 22:18111957-18111979 CTGGGAGCCCGCTAGGAGGAGGG - Intronic
1181031031 22:20148999-20149021 CGGGGAGCCCTGTCTGAGGAGGG - Intronic
1181512295 22:23394403-23394425 CGGGGAGCCCTGTCTGAGGAGGG + Intergenic
1181606825 22:23985144-23985166 CTGGGAGCACTATGGGAGACTGG + Intergenic
1182443870 22:30379309-30379331 CTGGGAGCTGCCTGTAAGGAGGG + Exonic
1183063620 22:35349666-35349688 CAGGAGGCTCTCTGTGAGGACGG + Intergenic
1184105636 22:42366037-42366059 CTCGCAGCACTCTGTGAGGGAGG + Intergenic
1184525654 22:45020888-45020910 GTGGGAGCCCTATGTGAGGTGGG + Intergenic
949397281 3:3628479-3628501 CTGCAAGCACCCTGTGAGGCAGG - Intergenic
950922354 3:16707420-16707442 AGGCGAGCAGTCTGTGAGGAGGG + Intergenic
951398442 3:22200667-22200689 CTGGGAGCACTATGGGAGACTGG + Intronic
951399616 3:22215497-22215519 CTGGGAGCACTATGGGAGACTGG - Intronic
951459587 3:22935667-22935689 CTACGACCACTCTGTGAGGTTGG - Intergenic
952725366 3:36578560-36578582 CTGGGAGCACTCTGGGAGACCGG + Intergenic
952934031 3:38381695-38381717 CTGGGAGCACTATGGGAGACTGG - Intronic
953604806 3:44404911-44404933 CTGTGAGGACCCTGTGAGCATGG - Intronic
954277845 3:49554279-49554301 CTGCGAGGGCCCTGTGAGGAGGG - Intergenic
954960825 3:54563439-54563461 CTGGGAGCACCCTCTGTGGAGGG - Intronic
955003543 3:54949065-54949087 CTGGGGGCACTGGATGAGGAAGG - Intronic
955562368 3:60205585-60205607 CTGGGAGCACTCCAGGAAGAGGG + Intronic
956210847 3:66799728-66799750 CTGGCAGCACTCTGAGAAGATGG - Intergenic
957014147 3:75043702-75043724 CTGCACGCACTCTGTGAAGAAGG + Intergenic
957585072 3:82122670-82122692 CTGAGAGCACTCCTTGGGGATGG - Intergenic
958684207 3:97371875-97371897 CTGGGAGCACTATGGGAGACCGG - Intronic
958752882 3:98213379-98213401 CTGGGAGCACTATGGGAGACTGG - Intergenic
958998990 3:100939812-100939834 CTGGGAGCACTGTGGGAGACTGG + Intronic
959118817 3:102208826-102208848 CTGGGAGCACTATGGGAGACTGG + Intronic
960597350 3:119418176-119418198 CTGAGAGCACTGAGTGAGCAAGG + Exonic
961041801 3:123683190-123683212 CAAGGAGCACTCTTTGGGGACGG + Intronic
961049568 3:123734926-123734948 CTGGGATGCGTCTGTGAGGAAGG - Intronic
961773824 3:129269636-129269658 TTGGGAGCCTACTGTGAGGAAGG - Intronic
961923669 3:130452772-130452794 CTGGGAGCACTATGGGAGACTGG + Intronic
962290400 3:134131503-134131525 CTGGGAGCACTATGGGAGACTGG + Intronic
962651554 3:137498939-137498961 CTGGGAGCACTCTGGGAGACTGG - Intergenic
963786163 3:149536542-149536564 CCAGGAGCCCTCTGTCAGGATGG + Intronic
964157104 3:153599680-153599702 CTGGGAGCTCTGTGTGATAAAGG - Intergenic
964754478 3:160081292-160081314 CTGGGAGCACTATGGGAGACTGG + Intergenic
965703325 3:171480829-171480851 CTGGGAGTTCTGTGTGAGAAGGG - Intergenic
966035139 3:175402881-175402903 CTGTGAGCTCTCTGAGAGAAGGG + Intronic
966142580 3:176772553-176772575 CTGGGAGCACTATGGGAGACTGG - Intergenic
966151298 3:176869833-176869855 CTGGGAGCACTATGGGAGACTGG + Intergenic
967567156 3:190986657-190986679 CTGGGAGCACTATGGGAGACTGG - Intergenic
967807544 3:193728999-193729021 CCGGGTGCACTCAGTGAGGAAGG - Intergenic
968410723 4:387354-387376 CTGGCAGCATGGTGTGAGGAAGG - Intergenic
968420974 4:484628-484650 CTGGGAGCACTATGGGAGACTGG - Intronic
969409011 4:7015644-7015666 CTGGGAGACCTGTGTGTGGAAGG + Intronic
970027137 4:11635487-11635509 CTGGGAGCACTGAGTGTGGTAGG + Intergenic
970418444 4:15882308-15882330 CTGGCAGCATTCGGGGAGGAAGG - Intergenic
971365825 4:25976420-25976442 CTGGGAGCACTATGGGAGACTGG - Intergenic
973314689 4:48747916-48747938 TTGCGAGCCCTGTGTGAGGATGG + Intronic
973585884 4:52390668-52390690 CTGGGAGCACTATGGGAGACTGG - Intergenic
973700168 4:53529305-53529327 CTGGGAGCAGGCAGTGGGGACGG + Intronic
974017050 4:56656868-56656890 CGGGGAGCACACAGTGAGGCAGG - Intronic
974983319 4:68989253-68989275 CTGGGAGCACTATGGGAGATGGG - Intergenic
975756722 4:77578604-77578626 CTGGAATCAATCTGTGAGGTGGG + Intronic
975958996 4:79878010-79878032 CTGGGAACACTCTTTGAGATAGG - Intergenic
976437427 4:85034063-85034085 CTGGGAGCACTATGGGAGACTGG - Intergenic
977913773 4:102567071-102567093 GTGGGAAAACACTGTGAGGATGG + Exonic
980161879 4:129174254-129174276 CAGGAAGCACACTGTGATGATGG + Intergenic
981000696 4:139826015-139826037 ATGGGAGCCCTGTGGGAGGAAGG + Intronic
981843620 4:149141010-149141032 CTGGGAGCTCACTGAGAGAAGGG + Intergenic
982807868 4:159789101-159789123 CTGGGAGCACTATGGGAGACTGG - Intergenic
983307027 4:166002671-166002693 CTGGGAGGACTGTTTGAGGTCGG - Intronic
986041498 5:3998457-3998479 CTGGGAGCCCTCAGAGAGAAAGG + Intergenic
986836695 5:11646917-11646939 CTGGAAGCACTGTGTGTGCAGGG - Intronic
988717732 5:33844492-33844514 CTGGGAGCACTATGGGAGACTGG - Intronic
989317881 5:40103520-40103542 CTGGGAGCACTATGGGAGACTGG - Intergenic
989572287 5:42955712-42955734 CTGGGAGCACTATGGGAGACTGG + Intergenic
989624354 5:43415221-43415243 CTGGGAGCACTATGGGAGACTGG - Intergenic
990063504 5:51682009-51682031 CTGGGGGTAATCTGAGAGGAGGG + Intergenic
990346416 5:54876184-54876206 CTGGGAGCACTATGGGAGACTGG - Intergenic
992431894 5:76717815-76717837 CTGGGAGGCCACTGTGAGAAAGG - Intronic
995534202 5:113119271-113119293 CATGGAGCACTCCCTGAGGATGG - Intronic
997089752 5:130843154-130843176 CTGGGAGCACTATGGGAGACTGG - Intergenic
997674533 5:135702841-135702863 CCGGGAGCACCCTTTGAGAAAGG + Intergenic
998720448 5:144940692-144940714 GTGGGGGGAGTCTGTGAGGAGGG + Intergenic
998940016 5:147271711-147271733 CTGGGAGCACTATGGGAGACTGG - Intronic
999188006 5:149727215-149727237 CTGTGAGCAACCTGTGATGAAGG + Intergenic
999893192 5:156000917-156000939 CAGGGACCACACTTTGAGGATGG + Intronic
1000021211 5:157320892-157320914 CTGGGAGCCGTCGGTCAGGAGGG + Intronic
1000471783 5:161652072-161652094 CTGGGAGCACTATGGGAGACTGG + Intronic
1000556454 5:162732431-162732453 CTGGAATCAGTCTGTGAGGTGGG - Intergenic
1000615259 5:163419118-163419140 CTGGGAGCACTATGGGAGACTGG - Intergenic
1001301596 5:170537574-170537596 CTGGGAGGACTCTGTGAATGAGG + Intronic
1001649974 5:173309421-173309443 CTGGGAGCAGCCTGGGAAGAGGG - Intergenic
1002323466 5:178389529-178389551 GTGGGCACCCTCTGTGAGGAGGG - Intronic
1002451531 5:179321663-179321685 TTGGGAGCGCTCTGTATGGAGGG - Intronic
1002647727 5:180669282-180669304 CTGGGATCACTCAGAGAGGCAGG + Intergenic
1003087564 6:3072954-3072976 CTGGGATCACTCTGTCAGCAGGG - Intronic
1003154876 6:3583941-3583963 CTAGCAGAACTGTGTGAGGAGGG - Intergenic
1004780077 6:18898425-18898447 CTGTCACCACTCTGGGAGGAGGG - Intergenic
1004865669 6:19851604-19851626 CTGTGCACACTTTGTGAGGAGGG + Intergenic
1005118886 6:22368849-22368871 CTGGCAGGACTGTGTGGGGATGG + Intergenic
1005353330 6:24958809-24958831 CTGGAATCACGGTGTGAGGAGGG + Intronic
1005545052 6:26858644-26858666 TTGGGAGCACTTTGGGAGGCGGG - Intergenic
1005748954 6:28866002-28866024 CAATGAGCACTCTGTGAAGATGG - Intergenic
1007290878 6:40785821-40785843 CTGGGAGCAGTGAGTGGGGATGG - Intergenic
1007648454 6:43400891-43400913 CTGGGAGGAGTTTTTGAGGAGGG - Intergenic
1007838212 6:44693900-44693922 CTGGGTGCACAGTGCGAGGAAGG - Intergenic
1008012474 6:46483027-46483049 CTGGGAGCTGTCTGGTAGGAAGG + Intronic
1008100482 6:47385316-47385338 CTGGGAGCACTATGGGAGACTGG - Intergenic
1008585471 6:52944510-52944532 CTGGGAGCACTATGGGAGACTGG - Intergenic
1008909706 6:56720080-56720102 CTGGGAGCACTATGGGAGACTGG + Intronic
1009015841 6:57900260-57900282 TTGGGAGCACTTTGGGAGGCGGG - Intergenic
1009545738 6:65017948-65017970 TTGGGAGCACTTTGTTAAGAGGG - Intronic
1010102988 6:72131772-72131794 CTGGGAGCACTATGGGAGACTGG + Intronic
1010622206 6:78090427-78090449 CTGGAATCTCTCTGGGAGGATGG + Intergenic
1011959802 6:93073525-93073547 CTGGGAGCACTATGGGAGACTGG - Intergenic
1012216506 6:96592170-96592192 CTGGGAGCACTATGGGAGACTGG + Intronic
1012446501 6:99312293-99312315 CTGGGAACACTCTGGGAGACAGG + Intronic
1012460694 6:99457030-99457052 CTGGGAGCACTATGGGAGACTGG - Intronic
1012576277 6:100803584-100803606 GTGGGAGCGCTCTTGGAGGAAGG + Intronic
1012837882 6:104293464-104293486 CTCGGCTCACTCTGTGAGGATGG - Intergenic
1014005354 6:116411430-116411452 CAGGCTGCACTCTGGGAGGAGGG + Intronic
1014608872 6:123515673-123515695 CTGGGAGCAAGGTGAGAGGAAGG + Intronic
1015488613 6:133800136-133800158 CTGGGAGCTCTGTCTCAGGAAGG + Intergenic
1016586811 6:145697541-145697563 CTGGGAGCACTATGGGAGACTGG + Intronic
1016709739 6:147156179-147156201 CTGGGAGCAGTCTCTGAGTGTGG - Intergenic
1017332583 6:153217091-153217113 TTTGGAGCTCTCTGTGAGCAGGG + Intergenic
1017446031 6:154508764-154508786 CTGGGAGAACTCCTTGAGAACGG - Intronic
1018893053 6:167996196-167996218 CTGGGAGCCCTTGGTGAGGGGGG - Intergenic
1019257883 7:63300-63322 CTGGGAGCCCTCTGTGTGTGGGG + Intergenic
1019446104 7:1072146-1072168 GTGGGGGCACTCTGTGTGCATGG - Intronic
1020048476 7:5062666-5062688 CTGGGAGCACTATGGGAGACTGG + Intronic
1020387759 7:7626445-7626467 CTGGGAGCACTATGGGAGACTGG + Intergenic
1022331259 7:29381542-29381564 CTGGAAGCCCACTGTGAGAATGG + Intronic
1022503323 7:30895954-30895976 CTGGGAGCACATTGAGGGGATGG + Intergenic
1022992990 7:35726651-35726673 CTGGGAGGAGTCTGTTAGGGCGG - Intergenic
1023990957 7:45127925-45127947 CTGGGGGCACCCTGTGGAGATGG - Intergenic
1024294319 7:47830616-47830638 GTTGAATCACTCTGTGAGGATGG - Intronic
1024479507 7:49849431-49849453 CTGGGAGCAGACTGTCAGGAAGG + Intronic
1024497434 7:50064467-50064489 CTGGGAGCACTATGGGAGACTGG + Intronic
1024942364 7:54776093-54776115 CTGGGAGCACTATGGGAGACTGG - Intergenic
1025232360 7:57211183-57211205 CTGGCAGCACCCAGTGAGAAAGG + Intergenic
1025600153 7:62986705-62986727 CTGGGAGCACTATGGGAGACTGG + Intergenic
1025760065 7:64381451-64381473 CTGGGAGCACTATGGGAGACTGG - Intergenic
1027224337 7:76234540-76234562 CTGGGAGCAGACTGGGAGGTAGG + Intronic
1028787045 7:94807337-94807359 CTGGGAGCACTATGGGAGACTGG + Intergenic
1030041354 7:105453166-105453188 CTGGAATCAATCTGTGAGGTGGG + Intronic
1030615154 7:111731005-111731027 GTGGGAGCTCTGTGTGAGTAAGG + Intronic
1031371850 7:120977704-120977726 CTGGGAGAACACTGGGAGGCAGG + Intergenic
1031699837 7:124910424-124910446 CTGTTAGCCCTCTGTGATGATGG - Intronic
1032155829 7:129466921-129466943 CTGGCATCACTCAGTCAGGATGG - Intronic
1032534141 7:132646556-132646578 CTGTGAGGACACAGTGAGGATGG + Intronic
1033104336 7:138506813-138506835 CTGGGGGCATTTGGTGAGGATGG + Intronic
1034626836 7:152499987-152500009 CTGGGGGCAAATTGTGAGGAAGG - Intergenic
1034737284 7:153440773-153440795 CAGGGGCCACTCTGTGAGCAAGG - Intergenic
1035029193 7:155846352-155846374 GGGGGAGCATTCTGGGAGGAGGG + Intergenic
1035058167 7:156050648-156050670 CTGGAAGCAGCCTGTGAGGTGGG + Intergenic
1035123675 7:156591482-156591504 CTGGGAGCACTATGGGAGACTGG - Intergenic
1035553187 8:545134-545156 CGGGGACCACACTGGGAGGAGGG - Intronic
1035686890 8:1530159-1530181 CTGGGAGCACTATGGGAGACTGG + Intronic
1036935798 8:13001306-13001328 CTGGGTCCACTCAGTGAGGCGGG + Intronic
1037780903 8:21868498-21868520 TTGGGAGCCCTCTCTGAGTATGG - Intergenic
1038786569 8:30622624-30622646 CTGGGAGCACTATGGGAGACTGG + Intronic
1040538857 8:48333395-48333417 CTGGGAGCACTATGGGAGACTGG + Intergenic
1041930254 8:63279098-63279120 CTGAGAGCAGTCAGTGAAGAAGG - Intergenic
1041940638 8:63383330-63383352 CTGAGAGGATTCTGTGAAGATGG - Intergenic
1042202058 8:66288620-66288642 ATGTGAGCTCTCTGTGAGCAAGG + Intergenic
1042442305 8:68842725-68842747 CTGGAATCAATCTGTGAGGTGGG - Intergenic
1045057200 8:98379480-98379502 GTGGGAGCAATCTGTGAGCCTGG - Intergenic
1046076669 8:109320238-109320260 CTGGGAGCACTATGGGAGACTGG + Intronic
1046293399 8:112191938-112191960 CTGGCAGCATACTGTGAGCAAGG + Intergenic
1048206454 8:132419155-132419177 ATGGCAGCACTCTTTGAAGAAGG + Intronic
1048825723 8:138423786-138423808 CTGGGAGCACTATGGGAGACTGG + Intronic
1050471464 9:5995605-5995627 CTGGGAGATCTCTGGGAAGAGGG - Intronic
1050966272 9:11807243-11807265 ATGGGAGCACCGTGTGATGATGG + Intergenic
1051798910 9:20908901-20908923 CTGGGAGCTCATTGTGAGGAAGG - Intronic
1052354879 9:27494094-27494116 CTGGGAGCACTATGGGAGACTGG - Intronic
1053131137 9:35616590-35616612 CTGGGAGTGCGCTGTGAGTAAGG - Exonic
1053176067 9:35925089-35925111 CCTAGAGCCCTCTGTGAGGAAGG - Intergenic
1053525623 9:38827559-38827581 GTGGGAGATCTCTGTGATGATGG - Intergenic
1054197856 9:62051993-62052015 GTGGGAGATCTCTGTGATGATGG - Intergenic
1054640499 9:67536379-67536401 GTGGGAGATCTCTGTGATGATGG + Intergenic
1054842208 9:69755231-69755253 TTTGGAGCAGTCTGTGATGAAGG - Intronic
1055373628 9:75625637-75625659 CTGGGAGCTCTGTGTCAGGGAGG + Intergenic
1055630754 9:78220897-78220919 ATGGAAGGACTCTGTGAGGAGGG + Intergenic
1055784842 9:79861817-79861839 CTGGGAGCACTATGGGAGACTGG - Intergenic
1055908054 9:81316412-81316434 CTGGGAGCACTATGGGAGACCGG + Intergenic
1056277400 9:85006636-85006658 CTGGGAGAAGTCAGTGAGAAGGG - Intronic
1058268431 9:102937236-102937258 CTGGGAGCACTATGGGAGACTGG - Intergenic
1058853526 9:109036978-109037000 CTGCAAGCACCCTGTGAGGCGGG - Intronic
1058922619 9:109631832-109631854 CTGGGAGCACTATGGGAGGCTGG - Intergenic
1060091719 9:120748773-120748795 CGGGGGGCACTCTGTGACCAGGG + Intergenic
1060777208 9:126383761-126383783 GTGGCAGCCCTGTGTGAGGAGGG + Intronic
1061893494 9:133634951-133634973 CTGGGTGCAATCAGTGGGGAGGG + Intergenic
1062103832 9:134741960-134741982 CAGGGAGCAGGGTGTGAGGAAGG - Intronic
1062248674 9:135583508-135583530 CTGAGAGCACTCGGGGAGGCAGG - Intergenic
1062325805 9:136012014-136012036 CTGACAGTACACTGTGAGGACGG + Exonic
1062427839 9:136514178-136514200 CTGGCAGCACTCTGCCTGGATGG - Intronic
1062606996 9:137352885-137352907 CTATGAGCACTCGGGGAGGAGGG + Intronic
1186132071 X:6478718-6478740 CTGGGAGCACTATGGGAGACTGG - Intergenic
1190616298 X:52236532-52236554 CTGGGAGCACTATGGGAGACTGG - Intergenic
1191148399 X:57193261-57193283 CTGGGAGCACTATGGGAGACTGG - Intergenic
1191803114 X:65103128-65103150 CTGGGAGCACTATGGGAGACCGG + Intergenic
1192077634 X:68016655-68016677 CTGGGAGCACTATGGGAGACTGG - Intergenic
1192218063 X:69177697-69177719 CTGGGCCCACTCTGTAGGGAGGG + Intergenic
1192658188 X:73014440-73014462 TTGTGAGCAATTTGTGAGGAAGG + Intergenic
1194194942 X:90881523-90881545 CTGGGAGCACTATGGGAGACTGG - Intergenic
1194535921 X:95105853-95105875 CTGGGAGCACTATGGGAGACTGG - Intergenic
1195734296 X:107997090-107997112 CTGGGAGCACTATGGGAGACTGG - Intergenic
1196079147 X:111612560-111612582 CTGGCAGGACTGTGTCAGGATGG - Intergenic
1197316218 X:124969587-124969609 CTTGTAGCACCCTGTGAGGTAGG + Intergenic
1198912444 X:141629605-141629627 CTGGGAGCACTATGGGAGACTGG - Intronic
1199938585 X:152601836-152601858 CTGGGAGCCATCAGTGAGGAGGG - Intergenic
1200016279 X:153166089-153166111 CTGGGAGCACTATGGGAGACTGG - Intergenic
1200541563 Y:4463931-4463953 CTGGGAGCACTATGGGAGACTGG - Intergenic
1201478489 Y:14410754-14410776 CTGGGAGCACTATGTGAGACTGG + Intergenic
1201768719 Y:17596978-17597000 CTGGGAGCACTATGGGAGACTGG - Intergenic
1201832835 Y:18309007-18309029 CTGGGAGCACTATGGGAGACTGG + Intergenic
1202328771 Y:23722570-23722592 CTGGGAGCACTATGGGAGGCTGG - Intergenic
1202542000 Y:25947484-25947506 CTGGGAGCACTATGGGAGGCTGG + Intergenic