ID: 1104986474

View in Genome Browser
Species Human (GRCh38)
Location 12:132600432-132600454
Sequence CAGCGTGACGGGACTGGAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 111}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104986474_1104986482 8 Left 1104986474 12:132600432-132600454 CCCACTCCAGTCCCGTCACGCTG 0: 1
1: 0
2: 0
3: 12
4: 111
Right 1104986482 12:132600463-132600485 GGCCTGAACCCATGAATGCGAGG 0: 1
1: 0
2: 1
3: 13
4: 181
1104986474_1104986486 30 Left 1104986474 12:132600432-132600454 CCCACTCCAGTCCCGTCACGCTG 0: 1
1: 0
2: 0
3: 12
4: 111
Right 1104986486 12:132600485-132600507 GACACGATCAGTCCACAGCAAGG 0: 1
1: 0
2: 2
3: 16
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104986474 Original CRISPR CAGCGTGACGGGACTGGAGT GGG (reversed) Intergenic
900537148 1:3184522-3184544 CAGCGGGAAGGGACAGGAGGTGG - Intronic
905121357 1:35684478-35684500 CAGCTTGATGGGACAGGAGTAGG - Intergenic
906747544 1:48232254-48232276 GATTGTGACTGGACTGGAGTAGG + Intronic
907138292 1:52159637-52159659 CATCCTGAAGGGACTGCAGTAGG + Intronic
907907628 1:58798854-58798876 CAGCATGATGGGGCTGGAGTGGG + Intergenic
913130934 1:115838252-115838274 CAGCGTGTCGGACCTGGAGCCGG - Exonic
921030112 1:211328970-211328992 CAGGGTGAGGGGCCTGGAGCAGG - Intronic
1064144938 10:12819838-12819860 CAGCGTGGCAGGGATGGAGTGGG + Intronic
1068099567 10:52534446-52534468 CACCTTGAAGGAACTGGAGTAGG - Intergenic
1074776597 10:116771902-116771924 CAGCCTGCCTGGACTGGAGTTGG - Intergenic
1076664580 10:132079026-132079048 GAGGGTGACGGGGCAGGAGTGGG - Intergenic
1077151071 11:1073391-1073413 CAGGGTCAGGGGACTGCAGTTGG + Intergenic
1078251071 11:9617010-9617032 CAGTGTGACAGGAGTGGAGTGGG + Intergenic
1079866026 11:25735184-25735206 CAACGTGAGGTTACTGGAGTGGG + Intergenic
1080648151 11:34202325-34202347 CAGTGTGAAGGCTCTGGAGTGGG + Intronic
1082627304 11:55501236-55501258 CAGCGTAACGGAACTGGGGATGG + Intergenic
1083904539 11:65661638-65661660 CAGCATGAGGGGACAGGAGGCGG - Intronic
1084106513 11:66984225-66984247 CAGGGTGAGGTGACTGGAGGAGG + Intergenic
1084459159 11:69286643-69286665 CAGCGTGACGAGAGTGGGGATGG + Intergenic
1087317051 11:96615119-96615141 CAGGGAGACGGGAGTGGAGCTGG - Intergenic
1089587139 11:119517305-119517327 CAGCGCGATGTGACTGGAATGGG - Intergenic
1101614614 12:106324367-106324389 CATTGTGACGGGAGTAGAGTTGG + Intronic
1101986406 12:109450779-109450801 CAACTGGACGGGGCTGGAGTTGG + Exonic
1102459084 12:113089203-113089225 CAGGGTGGCTGGAGTGGAGTGGG + Intronic
1104968598 12:132521039-132521061 CAGCCTCAGGGGACTGCAGTGGG - Intronic
1104986474 12:132600432-132600454 CAGCGTGACGGGACTGGAGTGGG - Intergenic
1110229517 13:73153713-73153735 CAGCCTGATTGCACTGGAGTGGG + Intergenic
1112210739 13:97374698-97374720 CAGTTTGATGGGACTGGAGGGGG + Intronic
1119999622 14:79288215-79288237 CAGCGTGACTGCACTGAAGTTGG - Intronic
1125462540 15:39920449-39920471 CAGCCCGAGGGGACTGGAGAGGG - Exonic
1126750021 15:51867096-51867118 CAGTGTGACTGGAATGGAGAGGG + Intronic
1126989875 15:54362220-54362242 CAGTGGGATGGAACTGGAGTTGG + Intronic
1129866115 15:78910049-78910071 CAGCTTTAGGGCACTGGAGTAGG - Intergenic
1132101287 15:99025163-99025185 CAGAGTGCTGGGACTGCAGTGGG + Intergenic
1132265913 15:100470515-100470537 CAGAGTGACTGTAGTGGAGTGGG + Intronic
1132430090 15:101753390-101753412 CGGCGTGACGAGACTCGCGTGGG + Intergenic
1132430130 15:101753734-101753756 CGGCGTGACGAGACTCGCGTGGG + Intergenic
1132430394 15:101756082-101756104 CGGCGTGACGAGACTCGCGTGGG + Intergenic
1132430617 15:101758089-101758111 CGGCGTGACGAGACTCGCGTGGG + Intergenic
1132430664 15:101758525-101758547 CGGCGTGACGAGACTCGCGTGGG + Intergenic
1132430713 15:101758960-101758982 CGGCGTGACGAGACTCGCGTGGG + Intergenic
1132430867 15:101760350-101760372 CGGCGTGACGAGACTCGCGTGGG + Intergenic
1132430981 15:101761402-101761424 CGGCGTGACGAGACTCGCGTGGG + Intergenic
1132431030 15:101761837-101761859 CGGCGTGACGAGACTCGCGTGGG + Intergenic
1132431128 15:101762733-101762755 CGGCGTGACGAGACTCGCGTGGG + Intergenic
1132431249 15:101763785-101763807 CGGCGTGACGAGACTCGCGTGGG + Intergenic
1132431336 15:101764564-101764586 CGGCGTGACGAGACTCGCGTGGG + Intergenic
1138272912 16:55709051-55709073 AAGAGTGAAGGGTCTGGAGTTGG + Intergenic
1138549562 16:57740153-57740175 CATCGAGACGGGACTAAAGTGGG + Intronic
1139488011 16:67270122-67270144 TAGGGTGAGGGGACTGGAGATGG + Intronic
1141979685 16:87542184-87542206 CAGCCTGAAGGAACTGGGGTGGG + Intergenic
1143580419 17:7822344-7822366 CTGCGTGGCTGGAGTGGAGTGGG - Intronic
1146356693 17:32140515-32140537 CAGAGTAACGGGATTGGAATAGG + Intergenic
1148678057 17:49456533-49456555 CAGCGTGACCAGAGTGGAGGGGG - Intronic
1151993474 17:77593621-77593643 CAGGGTGATGGGACTGCAGTGGG - Intergenic
1152277038 17:79363911-79363933 CAGGGTGGCTGGAGTGGAGTGGG - Intronic
1163497905 19:17657248-17657270 CAGCGTGGCCGGAATGGAGGAGG - Intronic
1165921906 19:39304296-39304318 CAGTGTGTCTGGACTGAAGTGGG - Intergenic
1166215664 19:41333056-41333078 CAGTGTGGCTGGAGTGGAGTAGG - Intronic
1166266042 19:41685126-41685148 CAGCGAGACGAGGATGGAGTTGG + Intronic
1168715955 19:58527518-58527540 CAAAGTGACAGGACTGGAGAGGG - Intronic
928732357 2:34246085-34246107 CAGCTTGAGGGGACTGCACTAGG - Intergenic
936229972 2:110692122-110692144 CAGCTTTACGGGACTGGGGTAGG - Intergenic
939956586 2:148532516-148532538 CATGGTGCCTGGACTGGAGTAGG - Intergenic
1171249544 20:23637767-23637789 CGGCTTGCCGGGACTGGAGCCGG + Exonic
1175966567 20:62662776-62662798 TGGTGTGACGGGGCTGGAGTGGG - Intronic
1179652141 21:42818462-42818484 CAGCATCACAGGCCTGGAGTAGG + Intergenic
1179877782 21:44279947-44279969 CAGCATGACCAGACTGGAGAGGG + Intergenic
1181107849 22:20585277-20585299 CAGAGGGCCGGGACTGGTGTGGG + Intronic
1182087394 22:27570738-27570760 CAGCGTGGCTGGAGTGGAGTGGG - Intergenic
1182741415 22:32570668-32570690 CAGTGTGAAGGGACGTGAGTTGG + Intronic
1182856093 22:33518772-33518794 CCCCCTGAGGGGACTGGAGTGGG + Intronic
1185397785 22:50601319-50601341 CTGCGGGAAGGGACTGGGGTTGG + Intronic
952404907 3:32997209-32997231 CACCGTGCTGGAACTGGAGTGGG - Exonic
960444896 3:117735855-117735877 CAGTGTGACTGGACTAGAATGGG - Intergenic
961993147 3:131213736-131213758 CAGATTGGCAGGACTGGAGTAGG - Intronic
962714600 3:138115537-138115559 CAGGTTGGCGGCACTGGAGTGGG - Exonic
962809357 3:138947667-138947689 CAGAGTGACTGGGCTGGAATGGG + Intronic
964550108 3:157876177-157876199 CAGAGTAGCTGGACTGGAGTGGG - Intergenic
967494761 3:190130273-190130295 CAGCAGGACTGGACTGGTGTAGG - Intergenic
969873128 4:10116780-10116802 GGGCGTGCCGGGAGTGGAGTGGG + Exonic
973392082 4:49565524-49565546 CAGGGCCATGGGACTGGAGTAGG - Intergenic
975745162 4:77468143-77468165 CAGGGTGATGGGACTGAAGAAGG + Intergenic
984992677 4:185396507-185396529 GGGCGTGAGAGGACTGGAGTAGG - Exonic
987395672 5:17420874-17420896 CAGTGTGCAGGGACTGGAGAGGG - Intergenic
989963339 5:50441076-50441098 CAGCGAGAAGGCACTGGAGGAGG + Exonic
992498478 5:77317756-77317778 CAGCATGACGGGAATGGGGACGG - Intronic
992879969 5:81098055-81098077 CAGCATGGCAGGAGTGGAGTTGG + Intronic
995565599 5:113430787-113430809 CAGCGTGAAGAGACTGCAGATGG + Intronic
997453396 5:134001222-134001244 CAGCCTGGCAGGAGTGGAGTTGG - Intronic
999723415 5:154415862-154415884 CAGCGTGACAGGGCTGGTGTGGG - Exonic
1006611712 6:35298061-35298083 CAGCGTCCCGGGCCTGGGGTCGG + Intronic
1006811117 6:36821237-36821259 CCGTGTGACTGGAGTGGAGTGGG + Intronic
1008092582 6:47308707-47308729 CAGCGCGCCGGCACTGGAATGGG - Intronic
1011728135 6:90231490-90231512 CAGGGTCACTGGATTGGAGTTGG - Intronic
1016347020 6:143124747-143124769 CAGGGTGGCAGGACAGGAGTGGG + Intronic
1017805035 6:157938081-157938103 CAGCGTGATGACACTGGAGTGGG + Intronic
1018957312 6:168418826-168418848 GAGCGTGACAGGCCTGGAGGAGG - Intergenic
1019485289 7:1286354-1286376 CAACGTGGCCGGAGTGGAGTGGG + Intergenic
1023699444 7:42878029-42878051 CAGTGTGGCGGCCCTGGAGTGGG - Intergenic
1026184529 7:68072122-68072144 CAGCCAGACTGGAGTGGAGTGGG + Intergenic
1026206043 7:68258372-68258394 CAGAGTCAGGAGACTGGAGTGGG + Intergenic
1027224491 7:76235309-76235331 CCGCGGGGCGGGACTGGGGTGGG + Intronic
1029483736 7:100827276-100827298 CAGCAAGACGTGGCTGGAGTTGG + Exonic
1030045249 7:105489451-105489473 CAGAGTGAAGGGGCAGGAGTGGG - Intronic
1034841883 7:154405643-154405665 CAGTGTGAGGGGACTGGAGCTGG + Intronic
1035332083 7:158102964-158102986 GAGCCTGACGGGACAGGAGCTGG + Intronic
1039204903 8:35141388-35141410 CAGGGTGACGGCTGTGGAGTAGG - Intergenic
1044533819 8:93337592-93337614 CACCCTGAAGGAACTGGAGTGGG + Intergenic
1047642387 8:126834275-126834297 CAGCGACACGGGCCTTGAGTGGG - Intergenic
1048334186 8:133490816-133490838 CATCGTGGCTGGACTGGAGAGGG + Intronic
1049582767 8:143420389-143420411 CAGAGGGGCTGGACTGGAGTCGG - Intronic
1053417843 9:37957952-37957974 CAGAGTGACTGGAAGGGAGTTGG + Intronic
1056553650 9:87671960-87671982 GAGCGTGGCGGAGCTGGAGTTGG - Intronic
1056935850 9:90914335-90914357 CAGAGGGACGGCACTGGAGCGGG - Intergenic
1057047065 9:91894114-91894136 GAGAGTGACGGGGCTGGAGTTGG - Intronic
1057700246 9:97358789-97358811 CAGCCTGAAGGTTCTGGAGTGGG + Intronic
1058645828 9:107130837-107130859 CAGCGTGACAGGGCTGGAAGGGG + Intergenic
1060588463 9:124801323-124801345 CAGCATGTGGGGACTGGAGGTGG - Intronic
1060915407 9:127386457-127386479 CAGCGTGACGCCACTGCAGGTGG + Intronic
1062488405 9:136792273-136792295 CGGGGTGACGAGAGTGGAGTCGG + Exonic
1062600571 9:137317070-137317092 GAGCGTGGCGGGCCTGGAGGGGG + Intronic
1196704992 X:118709825-118709847 CTGAGTGACTGGAGTGGAGTGGG - Intergenic
1196898185 X:120358639-120358661 CAGAGTGATGGCACTGCAGTGGG - Intergenic