ID: 1104988470

View in Genome Browser
Species Human (GRCh38)
Location 12:132610944-132610966
Sequence TTTGTGATCGACCATGTGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 109}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104988470 Original CRISPR TTTGTGATCGACCATGTGCC AGG Intergenic
902828775 1:18996102-18996124 ATTGAGGTCTACCATGTGCCAGG + Intergenic
903496406 1:23770742-23770764 TTTATGATTTACGATGTGCCAGG - Intergenic
904616278 1:31751904-31751926 TTAGGCATCTACCATGTGCCAGG + Intronic
907570166 1:55476144-55476166 TTTATGAACAATCATGTGCCAGG + Intergenic
912874120 1:113339296-113339318 CTTGTCATCTATCATGTGCCAGG - Intergenic
916246475 1:162693463-162693485 TTTGAGAGTGACAATGTGCCGGG + Intronic
917739840 1:177951774-177951796 TTTGTTAATCACCATGTGCCAGG - Intronic
919494577 1:198248567-198248589 TTTGATATTTACCATGTGCCAGG - Intronic
923770225 1:236931754-236931776 GTTGTGAGCAACCATTTGCCTGG - Intergenic
1070391785 10:75977360-75977382 TTTTTGACTGAACATGTGCCAGG + Intronic
1073550724 10:104398461-104398483 TTTGTGACCTACCATATCCCAGG - Intronic
1075332281 10:121582315-121582337 TTTGAGACCTACTATGTGCCAGG - Intronic
1075439854 10:122471314-122471336 TCTGGGAAGGACCATGTGCCTGG + Intronic
1076081656 10:127587182-127587204 TTTGTGATCAACCAACTGCAAGG + Intergenic
1080809018 11:35683937-35683959 TTTTTTATTTACCATGTGCCAGG + Intronic
1092349936 12:7748035-7748057 GTTGTGAGCCACCACGTGCCCGG + Intronic
1095127092 12:38492670-38492692 TTTATCACCCACCATGTGCCAGG + Intergenic
1097639132 12:62158175-62158197 ATTGAGATCTACTATGTGCCAGG - Intronic
1100353518 12:93807510-93807532 TTTATTATCTACCATGTGCTAGG + Intronic
1100853237 12:98735697-98735719 ATTGAGATGTACCATGTGCCTGG + Intronic
1103064192 12:117883364-117883386 TTCGTCATCTACTATGTGCCAGG - Intronic
1103150614 12:118635497-118635519 TTTATTAACTACCATGTGCCAGG + Intergenic
1103204076 12:119114620-119114642 TTAGTCATTTACCATGTGCCAGG - Intronic
1104259786 12:127172042-127172064 GTTGAGCTAGACCATGTGCCTGG + Intergenic
1104988470 12:132610944-132610966 TTTGTGATCGACCATGTGCCAGG + Intergenic
1110054315 13:70946028-70946050 TGTGTGTTCAACCATATGCCAGG + Intergenic
1119897106 14:78229660-78229682 TCTATGATCGACTCTGTGCCAGG + Intergenic
1121666437 14:95676075-95676097 TTGATGATCTACCGTGTGCCAGG + Intergenic
1123051181 14:105544337-105544359 TTTGTGAGCTACTGTGTGCCTGG + Intergenic
1130878278 15:88032787-88032809 TTGGTGATAGACCATGTACCTGG - Intronic
1136017794 16:27415841-27415863 TTGGAGATGGACTATGTGCCTGG + Intronic
1137584605 16:49657003-49657025 TTTATGAACCACCATGTCCCAGG + Intronic
1140973829 16:80040367-80040389 TTTGTGATGAAACATTTGCCAGG + Intergenic
1142752946 17:1999078-1999100 TGTGTGATCGCGCATGTGTCTGG - Intronic
1144554878 17:16273366-16273388 TTTGTGATCTGGCATTTGCCTGG - Intronic
1152888416 17:82866165-82866187 TTTGTGGTCGCCCAGGTGCCTGG + Intronic
1153148812 18:2066667-2066689 TTTGTGATACACAATGTGCCTGG + Intergenic
1153705813 18:7744604-7744626 TTTATTACCTACCATGTGCCAGG - Intronic
1156888276 18:42160630-42160652 TTTCTGATCTATCATGTGCCAGG + Intergenic
1157415934 18:47502865-47502887 TTTGAGACCCACTATGTGCCAGG + Intergenic
1160429194 18:78799982-78800004 TTTGTGGGCGACTCTGTGCCCGG - Intergenic
1164821818 19:31256632-31256654 TTGGTTATCTACCATGTGCCAGG + Intergenic
927380930 2:22478077-22478099 TTTGTGAAGGACCATTTTCCGGG - Intergenic
931069275 2:58626240-58626262 TTTGTGGTTTACTATGTGCCAGG + Intergenic
934057897 2:88267963-88267985 TTTGTGATCAGCACTGTGCCAGG + Intergenic
936043776 2:109170724-109170746 TTGGGCATTGACCATGTGCCAGG + Intronic
937250707 2:120522122-120522144 TTACTGATCTAACATGTGCCAGG - Intergenic
941598740 2:167511903-167511925 TTGGGCATCCACCATGTGCCAGG + Intergenic
942723091 2:178974726-178974748 TTTAGGATCTACCATGTGGCAGG + Intronic
946109415 2:217401228-217401250 TGTGTGATGGACCATCTGACAGG - Intronic
946541649 2:220690410-220690432 TTTAGCATCTACCATGTGCCTGG - Intergenic
947735091 2:232450142-232450164 GCTGTGATCGCCCAGGTGCCAGG + Intergenic
1168833529 20:860770-860792 TCTGTGATCTGCCAAGTGCCTGG - Intergenic
1170036151 20:11992417-11992439 TTTGTGATAGACAATTTCCCGGG + Intergenic
1171529759 20:25845260-25845282 TTTATCACCTACCATGTGCCAGG + Intronic
1173870434 20:46338313-46338335 TTGTTGATCAACTATGTGCCTGG + Intergenic
1174196254 20:48774808-48774830 TCTGTGGGCCACCATGTGCCTGG - Intronic
1178367143 21:31997421-31997443 TCTGTGTTGGAGCATGTGCCAGG - Intronic
1178678984 21:34655853-34655875 ATTGTTATCGACTACGTGCCAGG + Intergenic
1182006114 22:26961035-26961057 TTTTAAATCCACCATGTGCCAGG + Intergenic
1182911034 22:33984877-33984899 TTTGTGAATGCCCAAGTGCCAGG + Intergenic
1183051325 22:35264082-35264104 TTTGTGATACACCAGGTACCAGG + Intronic
949200224 3:1368548-1368570 TTTGTGATCTTGCATTTGCCAGG + Intronic
951446437 3:22786254-22786276 ATTGAGATAGACCATGTTCCAGG + Intergenic
952198237 3:31098360-31098382 GTTGTGCTGGATCATGTGCCAGG - Intergenic
957208547 3:77230987-77231009 TGTGTGATTGAACATGTGCTTGG + Intronic
960046419 3:113203200-113203222 TTGGGCATCCACCATGTGCCAGG + Intergenic
960057741 3:113287202-113287224 CTCGTGATGAACCATGTGCCTGG - Exonic
960429053 3:117546490-117546512 ATTGAGAACTACCATGTGCCAGG + Intergenic
960635312 3:119779364-119779386 TTTGAGAAAGACCATGTGACTGG + Intergenic
965920072 3:173902839-173902861 TTTGTGAACTACTGTGTGCCAGG + Intronic
966130398 3:176631336-176631358 TTTGAGACTGACCATGTGACAGG + Intergenic
970607538 4:17694681-17694703 CTTGAGATCTACTATGTGCCAGG + Intronic
977323227 4:95546476-95546498 TTTGTTATCCTCCATGTTCCAGG - Intronic
977830854 4:101590900-101590922 TTTGGGATTGACCACATGCCTGG - Intronic
978857254 4:113407335-113407357 TTTATGACCCACGATGTGCCTGG + Intergenic
988041889 5:25900356-25900378 TTCGTGATGGACCATCTACCTGG - Intergenic
989652892 5:43713274-43713296 TTTGTTATGTGCCATGTGCCAGG + Intergenic
989732409 5:44664472-44664494 TTTGTGCTGGAGCAGGTGCCGGG - Intergenic
990389954 5:55308437-55308459 TTTATTAACGACTATGTGCCAGG - Intronic
990894975 5:60689131-60689153 TTAGTTCTCAACCATGTGCCAGG - Intronic
993999135 5:94757163-94757185 TTTGTGTACGCCCATGTGCATGG - Intronic
996347762 5:122505613-122505635 TTGATCATCTACCATGTGCCAGG + Intergenic
997894996 5:137708538-137708560 TTTGTGTCCTACCATGTACCAGG + Intronic
998004542 5:138648410-138648432 TTTGTGATCTCCCAAGTCCCTGG + Intronic
1000160542 5:158593236-158593258 TTTATGATTTACCATGTACCCGG + Intergenic
1003143178 6:3488467-3488489 TCTGTGATGGCCGATGTGCCCGG + Intergenic
1005640848 6:27794673-27794695 TTTTTGAACGAACATGAGCCAGG + Intergenic
1005670173 6:28097877-28097899 TTTGTGATCCTCCATGAGCATGG + Intergenic
1009448034 6:63766614-63766636 TTTGTCACTTACCATGTGCCAGG + Intronic
1011561569 6:88622806-88622828 ATACTGATCAACCATGTGCCCGG + Intronic
1012659369 6:101867477-101867499 TCTGTGATAGACCATGTTTCTGG - Intronic
1014413669 6:121156922-121156944 TCTGTGATTGACCATATGCTTGG - Intronic
1020025659 7:4898141-4898163 TTTGTGATGGCCCATGTTCGTGG - Intergenic
1025302221 7:57826920-57826942 ATTATGAGCTACCATGTGCCAGG - Intergenic
1026121870 7:67544783-67544805 TATGAGATTTACCATGTGCCAGG + Intergenic
1031552870 7:123136601-123136623 TTTGGTATCTACCAAGTGCCAGG + Intronic
1033307544 7:140236051-140236073 TTGGGCATCTACCATGTGCCTGG - Intergenic
1033483142 7:141761356-141761378 TTTGTGCTGGACCCTGTGCTAGG + Intronic
1034850013 7:154484654-154484676 ATGGTGATAGACCATGTGGCTGG + Intronic
1042530684 8:69811749-69811771 TTAGTGTTTAACCATGTGCCAGG + Intronic
1047871424 8:129086764-129086786 TGTGTCATGGACCATGTGCCAGG - Intergenic
1048353560 8:133635200-133635222 TGTATGATCCACCATGTGTCAGG + Intergenic
1048857183 8:138695239-138695261 CTGATGATCTACCATGTGCCAGG - Intronic
1050375543 9:4968732-4968754 TTTTAGATAGACCATGTGTCAGG + Intergenic
1053002504 9:34585082-34585104 TGTGGGCACGACCATGTGCCTGG - Intronic
1054704167 9:68445867-68445889 TTTGTGCTCTACCATGTATCTGG + Intronic
1056579732 9:87882150-87882172 TGTGTGCTCCACCATGAGCCAGG - Intergenic
1056683449 9:88740083-88740105 TTGGGGATCAACCATGTGACTGG - Intergenic
1060262183 9:122085518-122085540 TTTGAGATCTACTTTGTGCCAGG - Intronic
1060385118 9:123218770-123218792 ATTATGATTAACCATGTGCCAGG + Intronic
1186059250 X:5686052-5686074 TTTGTGACCTAAGATGTGCCAGG - Intergenic
1186495919 X:10013198-10013220 TTTGTGATGTCGCATGTGCCAGG - Intergenic
1192285200 X:69727903-69727925 TTTTTGATGTACTATGTGCCAGG + Intronic
1196670712 X:118364579-118364601 TTGGTTATCTACCATGTGCCAGG - Intronic
1197916053 X:131536869-131536891 ATTGAGATTTACCATGTGCCAGG + Intergenic
1200423699 Y:2999526-2999548 TTTGTGATGGACATTGTGCAAGG - Intergenic