ID: 1104989945

View in Genome Browser
Species Human (GRCh38)
Location 12:132619394-132619416
Sequence CTCCGGAGGCGACCCTGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 98}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104989945_1104989952 0 Left 1104989945 12:132619394-132619416 CCTTCCCAGGGTCGCCTCCGGAG 0: 1
1: 0
2: 0
3: 6
4: 98
Right 1104989952 12:132619417-132619439 CCGGCGCCGCCCCTGCCCGCAGG 0: 1
1: 1
2: 8
3: 89
4: 574

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104989945 Original CRISPR CTCCGGAGGCGACCCTGGGA AGG (reversed) Intronic
900972931 1:6001419-6001441 CTCCGGGGGTGCCACTGGGAGGG + Intronic
901921471 1:12540535-12540557 CTTCGGAGCTGTCCCTGGGAGGG - Intergenic
902574294 1:17367585-17367607 TTCCGGAAGCGCACCTGGGAGGG + Intergenic
902770594 1:18643343-18643365 CTCCGGTGGAGACCAAGGGAGGG + Intronic
902811845 1:18892483-18892505 CTGAGGAGGTGACCCTGAGAGGG + Intronic
902869264 1:19303822-19303844 GGCCCGAGGAGACCCTGGGAGGG + Intergenic
902896871 1:19485390-19485412 CTCCGGAGGGGCCCCCGGGCCGG + Intronic
905741366 1:40374009-40374031 CTCAGGAGGTGCCCCTGGGCGGG + Exonic
912682850 1:111739837-111739859 CCCCGAAGAGGACCCTGGGAAGG + Intronic
913082427 1:115400924-115400946 CTCAGGAGGCTAAGCTGGGAGGG + Intergenic
913090661 1:115474647-115474669 CTTGGGAGGGGACTCTGGGAAGG - Intergenic
916074242 1:161191148-161191170 CTTCGGCGGCGCCCCTGGGCGGG - Exonic
921167161 1:212515291-212515313 CTCCGAGGGTGACCCTGGGGAGG + Intergenic
1063108001 10:3010539-3010561 CTTCGGAGGCCACCAGGGGAAGG - Intergenic
1063678315 10:8161880-8161902 CTCCGGAGGCGATCAGGTGATGG - Intergenic
1064230698 10:13528184-13528206 CCCCGGAGGCGCCCCGAGGAGGG + Intronic
1069785996 10:70988313-70988335 CTCAGGAGGTGACATTGGGAGGG - Intergenic
1072196030 10:93117999-93118021 CTGCAGAGGTGACCCAGGGATGG - Intergenic
1084549253 11:69831136-69831158 CTCCTGAGGCCACCTTGAGAGGG - Intergenic
1084892799 11:72244605-72244627 CTGCGGAGGCGGCCCAGGAAGGG + Intronic
1086584918 11:88439873-88439895 CTCCGCAGAAGACCCTGTGAAGG - Intergenic
1087337787 11:96866178-96866200 CTCTGGAGGGGACCCTGCAAGGG - Intergenic
1091992131 12:4963989-4964011 CTTCAGTGGGGACCCTGGGAAGG - Intergenic
1097154970 12:57006103-57006125 CTCCGGAGTCGCATCTGGGAGGG + Intronic
1099714421 12:86272742-86272764 CTCAGGAGGCTGCACTGGGAGGG + Intronic
1101968280 12:109295443-109295465 CTCTGGAGGTGACCCTAGGCAGG - Intronic
1102224530 12:111218406-111218428 CTCCGGAGGCTAAGGTGGGAGGG + Intronic
1102855927 12:116293402-116293424 CTGCGTAGGTGACCCTGTGAGGG + Intergenic
1103902581 12:124311123-124311145 CTCTGGAGGAGAACCTGGGTAGG + Intronic
1104989945 12:132619394-132619416 CTCCGGAGGCGACCCTGGGAAGG - Intronic
1106436869 13:29730952-29730974 CTGCGGATGAGACCCTGGCAGGG + Intergenic
1107671835 13:42754116-42754138 CTCCGGAGTCATCCCAGGGAGGG - Intergenic
1113649667 13:112026734-112026756 CACCCGTGGAGACCCTGGGAGGG - Intergenic
1114254490 14:20989978-20990000 CTCCGGAGGCGAACCGGAAACGG - Exonic
1114821869 14:26030264-26030286 CTCCGGAGGCCAAATTGGGACGG + Intergenic
1117424614 14:55580806-55580828 CTCCGGCGGCGTCCCCGGGCCGG + Intronic
1118318890 14:64741986-64742008 TTCCGGAGGGAGCCCTGGGAAGG + Exonic
1121924122 14:97912576-97912598 CCCCTGAGGCTCCCCTGGGATGG - Intergenic
1122317957 14:100836674-100836696 CTCCGAAGGGGTCCCTGGGCCGG - Intergenic
1122877816 14:104677027-104677049 CTCCTCAGGCGGCCCTGGGGCGG - Intergenic
1122902442 14:104787419-104787441 CTCCCCAGGCCACCCTGGGTGGG - Intronic
1122946590 14:105013665-105013687 CTCCAGAGGGGCTCCTGGGAAGG - Intronic
1124815749 15:32990261-32990283 CTGCAGAGGCAACACTGGGAGGG + Intronic
1127017749 15:54708111-54708133 GTCCGGAGGTGACCATGGGAGGG + Intergenic
1129691568 15:77716897-77716919 TTCTGGAGGTGACCCTGGGAAGG - Intronic
1129692024 15:77719141-77719163 CCCAGGAGGTGCCCCTGGGAGGG - Intronic
1134290881 16:12902199-12902221 CTCCGGAGGCGGCCCCGGAGCGG - Exonic
1138442281 16:57042317-57042339 CTTCTGAGGCCACCCTGGGGAGG + Intronic
1152377300 17:79925471-79925493 CTCCTGAGAAAACCCTGGGAGGG - Intergenic
1152588334 17:81199027-81199049 CTCTGGAGGCACCCCCGGGAAGG + Intronic
1152652629 17:81502633-81502655 CTCTGGAGGGCACCCTGAGAAGG + Intergenic
1158534173 18:58292419-58292441 CTCCACAGGCTCCCCTGGGAGGG + Intronic
1160527201 18:79544781-79544803 CTCCGGAGGCTCCCCAGGCAGGG - Intergenic
1162761598 19:12891822-12891844 CTCGGGACGCGAGGCTGGGAAGG - Exonic
1163666139 19:18604961-18604983 CCCCCGTGGGGACCCTGGGATGG - Intronic
1165791311 19:38494343-38494365 CTCCTGCAGGGACCCTGGGAAGG - Exonic
1166139684 19:40799361-40799383 CTGCCGGGGCGACCCCGGGAAGG + Intronic
1166377804 19:42337330-42337352 CTTAGGAGGCAAGCCTGGGATGG + Intronic
1166443860 19:42841179-42841201 CTCTGTAGGCCACCCTAGGATGG - Intronic
1166451302 19:42903861-42903883 CTCTGTAGGCCACCCTAGGATGG - Intronic
1167498191 19:49831261-49831283 CTCCGGGGGCCATCCTGTGAGGG - Intronic
927679836 2:25132065-25132087 CACCGGGGGCGGCCCGGGGATGG + Intronic
927997383 2:27495331-27495353 CTCCGGAGGCGCCATTGGGAGGG - Intergenic
932092907 2:68822662-68822684 CTCCCCAGGGGACCCTGGCAGGG - Exonic
932304796 2:70694496-70694518 ATCTGGAGGTGACCTTGGGAAGG - Intronic
937269303 2:120637902-120637924 CTGCAGAGGCGGCCCTGGGGAGG + Intergenic
940251452 2:151681388-151681410 CTGCAGAGGAGACCCTGGGTAGG + Intronic
945839873 2:214874961-214874983 CTCAGGAGGCTAACGTGGGAGGG - Intergenic
948672833 2:239579425-239579447 CTCCGGTGGCCACCCTGTCAGGG + Intronic
948711722 2:239829288-239829310 TCCCAGAGGGGACCCTGGGAAGG + Intergenic
1172542174 20:35727239-35727261 CTCGGGAGGCTAACCTGGGTGGG + Intronic
1176024505 20:62978841-62978863 CTCCGGAGGGGTCCCTGAGGAGG - Intergenic
1176673049 21:9751983-9752005 CTGCGGGGGAGACCCTGGGCTGG - Intergenic
1180083084 21:45495349-45495371 ATCCCGGGGCGACCCTGGGGCGG - Exonic
1180703961 22:17797384-17797406 CTCAGGAGGCTACGGTGGGAGGG + Intronic
1181553354 22:23653494-23653516 CTCCCAAGGTGACTCTGGGAAGG - Intergenic
1181804716 22:25367786-25367808 CTCCGGAGCTGGCCCTGGGGTGG - Intronic
1182459873 22:30476077-30476099 CTCCAGTGGGGACCCTGGGTTGG + Intergenic
1183632193 22:39040390-39040412 CCTCGGAGGCCACCGTGGGAGGG - Intergenic
1183638014 22:39076791-39076813 CCTCGGAGGCCACCGTGGGAGGG - Intronic
1184757433 22:46524945-46524967 AGCCGGAGGGGACCCTCGGAGGG - Intronic
950532995 3:13563840-13563862 TTCTGGAGGCGACCCTGGGGCGG + Intronic
953931898 3:47009757-47009779 CTCAGACGGCGACCCTGGGACGG - Intergenic
954493544 3:50930754-50930776 CTGGGGATGCGACCCTGGGCGGG + Intronic
961831768 3:129626802-129626824 CTGCGAAGGCAACCCAGGGAGGG + Intergenic
969691255 4:8705394-8705416 CTCCCCAGGCCACCCTGGGGTGG - Intergenic
983867618 4:172787676-172787698 CTGAGGAGGAGACCATGGGAGGG + Intronic
992529526 5:77641096-77641118 TTCCGGGGGCGACTGTGGGATGG - Intergenic
992674800 5:79095354-79095376 CTCAGGGGGCAACCCTGAGAAGG + Intronic
1002633902 5:180597822-180597844 TTCAGGAGGTGACCCTGGGCAGG + Intergenic
1006855216 6:37128235-37128257 CTCGGAAGGCCTCCCTGGGAAGG - Intergenic
1017737728 6:157380307-157380329 CTGCGGGCGCGGCCCTGGGACGG - Intergenic
1026867962 7:73834923-73834945 CTCTGGAGGCCACCCTGGACAGG - Exonic
1029366387 7:100119231-100119253 CCCCGGAGGAGACCCTTTGAAGG - Intronic
1034979470 7:155467016-155467038 CTCCCGAAGCGCCCCCGGGAGGG + Intergenic
1046969600 8:120206955-120206977 CTCCGTAGGCGGCCCAGTGATGG - Exonic
1047306194 8:123654919-123654941 CTCTGGAGCAGCCCCTGGGAAGG + Intergenic
1049423339 8:142526415-142526437 CACGGGAGGTGACCCTGGGTGGG + Intronic
1049573964 8:143382083-143382105 CCCAGGAGGCGGCCCAGGGAGGG - Intronic
1049614779 8:143571380-143571402 CTCCGGAGCCAACCCCAGGACGG + Intronic
1059405872 9:114098217-114098239 CTCCGGCGGCTACCCGGGGTGGG + Intronic
1060356402 9:122913096-122913118 TTCTGGAGGCAACCCTGCGAAGG + Intronic
1060481670 9:124019857-124019879 ATGAGGAGGCGACCTTGGGAGGG + Intronic
1060663040 9:125415628-125415650 CCCCGGAGGCCAGCCTGGGAGGG - Intergenic
1195981258 X:110580983-110581005 CTGCTGAGGTGAACCTGGGATGG + Intergenic