ID: 1104990445

View in Genome Browser
Species Human (GRCh38)
Location 12:132621343-132621365
Sequence CAGGTGCCTGCACCTGCTGG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 340
Summary {0: 1, 1: 1, 2: 2, 3: 38, 4: 298}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104990439_1104990445 2 Left 1104990439 12:132621318-132621340 CCGCATTGACGTCATTGTGCATG 0: 1
1: 0
2: 0
3: 6
4: 52
Right 1104990445 12:132621343-132621365 CAGGTGCCTGCACCTGCTGGGGG 0: 1
1: 1
2: 2
3: 38
4: 298
1104990434_1104990445 30 Left 1104990434 12:132621290-132621312 CCCGCACGCTCATCAAGGCCTAC 0: 1
1: 0
2: 0
3: 2
4: 48
Right 1104990445 12:132621343-132621365 CAGGTGCCTGCACCTGCTGGGGG 0: 1
1: 1
2: 2
3: 38
4: 298
1104990438_1104990445 12 Left 1104990438 12:132621308-132621330 CCTACGGGATCCGCATTGACGTC 0: 1
1: 0
2: 1
3: 1
4: 4
Right 1104990445 12:132621343-132621365 CAGGTGCCTGCACCTGCTGGGGG 0: 1
1: 1
2: 2
3: 38
4: 298
1104990435_1104990445 29 Left 1104990435 12:132621291-132621313 CCGCACGCTCATCAAGGCCTACG 0: 1
1: 0
2: 0
3: 2
4: 33
Right 1104990445 12:132621343-132621365 CAGGTGCCTGCACCTGCTGGGGG 0: 1
1: 1
2: 2
3: 38
4: 298

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104990445 Original CRISPR CAGGTGCCTGCACCTGCTGG GGG Exonic
900399288 1:2466450-2466472 GTGGTGACTGCAGCTGCTGGTGG + Intronic
900503461 1:3017713-3017735 CTTGTGTCTGCACCTCCTGGAGG - Intergenic
900890377 1:5445426-5445448 AAGGTGCCAGCATCTGGTGGGGG + Intergenic
901627301 1:10631497-10631519 CGGCTGCCTCCACCTGCTGGAGG + Intergenic
901678062 1:10898355-10898377 CAGGGCCCTGGACCTGCTGTAGG + Intergenic
903300803 1:22377288-22377310 CATAGGCCTGCAGCTGCTGGTGG + Intergenic
903375791 1:22865015-22865037 GGGGTGCCTGCACCCGCTGCGGG + Exonic
903687440 1:25142297-25142319 CAGGTCACTTCACCTCCTGGAGG - Intergenic
904300419 1:29550194-29550216 CAGGAGCCTGCTCCTGCTGAGGG - Intergenic
904473581 1:30750684-30750706 CAGGTGTCTGCTCCAGGTGGAGG - Intronic
904669853 1:32155674-32155696 CAGGTGACTGAATCTGTTGGCGG - Intronic
907826921 1:58026867-58026889 CAGGTGCCTGCACCTGTCCAGGG + Intronic
914944142 1:152048592-152048614 CTGGTGACTTCACCAGCTGGTGG + Intergenic
917968917 1:180195057-180195079 CAGGCGCCTGCACTTGGTCGTGG + Intronic
918203797 1:182291400-182291422 CAGGAGCCTGCTCCTGCAGTTGG - Intergenic
920052228 1:203171166-203171188 CAGGAGCCTGATGCTGCTGGGGG + Exonic
920128592 1:203713271-203713293 TAGGTGCCTGCAACAGCTGAAGG + Intronic
920535589 1:206734577-206734599 AAGGTGCCAGCACCTGGTGGTGG - Intergenic
921046152 1:211479308-211479330 CAGGTTCCGGCAGCTGCTGGCGG - Exonic
922045325 1:221939797-221939819 CAGCTGGCAGCCCCTGCTGGTGG + Intergenic
922175720 1:223195556-223195578 CAGGTGCAAGGACCTGCTGCTGG + Intergenic
922420667 1:225459348-225459370 GAGGTGACTGCAGCTGCTGAGGG + Intergenic
923857641 1:237862330-237862352 CATGAGCCTGGACCTGCTAGGGG - Intergenic
1064180902 10:13113628-13113650 CAGGTCGATGCACCAGCTGGGGG + Intronic
1065180104 10:23116316-23116338 CAAGTGCCTGCATCTGCTCTTGG - Intronic
1067064072 10:43093882-43093904 CAGGCGCAGGCTCCTGCTGGTGG + Intronic
1067080362 10:43209045-43209067 GAAGTGCCTGCCCCTGCTGTTGG - Intronic
1067479094 10:46583957-46583979 CAGGGCCCAGCACCTGCTGGCGG + Intronic
1067615645 10:47757844-47757866 CAGGGCCCAGCACCTGCTGGCGG - Intergenic
1067742851 10:48909531-48909553 CAGGTGCCGGCACCTCCTTCTGG + Exonic
1067774524 10:49153326-49153348 GAGATGCCAGCACTTGCTGGTGG - Intergenic
1068123932 10:52814680-52814702 CAGCTGGCAGCAGCTGCTGGGGG - Intergenic
1069706625 10:70462757-70462779 CAGGTGACTGGGCCTGCAGGCGG + Intergenic
1069712860 10:70500994-70501016 CAGGAGCCCCCACCTGCTGGTGG - Intronic
1070174195 10:73956507-73956529 CAGGGGCCAGCTCCTGGTGGAGG - Intergenic
1070320956 10:75354166-75354188 CAGGTGGCTGCAAGTGGTGGTGG + Intergenic
1070720723 10:78755169-78755191 AGGGTGCCTGCCCCTGCTTGGGG + Intergenic
1071437403 10:85660173-85660195 CAGGTGCCTGCAATGCCTGGGGG + Intronic
1075161709 10:120030100-120030122 CAGGTTCAGGCACCTGCTGGGGG + Intergenic
1075812203 10:125232456-125232478 CAAGTCCCTACTCCTGCTGGTGG - Intergenic
1076130271 10:128009147-128009169 CAGCAGCCTGCACATTCTGGAGG + Intronic
1076556149 10:131322703-131322725 CAGGTGCCAGCGCCTGGTGACGG + Intergenic
1076556177 10:131322803-131322825 CAGGTGCCAGCGCCTGGTGACGG + Intergenic
1076725066 10:132409377-132409399 CCGGTGCCTGCACCTGAAGCAGG - Intronic
1077043354 11:534169-534191 CAGGTGCCAGCAGCTGCTGCGGG - Intronic
1077436425 11:2541523-2541545 CAGGTCCCTGGACCTGGCGGTGG + Intronic
1077864437 11:6210988-6211010 CATGTCCCTGCCCCTGCTGCAGG + Exonic
1078035992 11:7805987-7806009 CTGCTGCCTGCAACTGCTGTAGG + Intergenic
1079122855 11:17697393-17697415 CAGGTGCCTGGACAGGCTTGGGG + Intergenic
1080712973 11:34769325-34769347 CAGGTGCTTGCAGTTGCTGTGGG + Intergenic
1081442934 11:43100390-43100412 GAGGTGTCTGCCCCTACTGGGGG + Intergenic
1082064767 11:47891066-47891088 CAGGTGCCTGCTAATTCTGGTGG + Intergenic
1083185232 11:61013797-61013819 CATGTGCCTGCAAGTGTTGGGGG + Intronic
1084163693 11:67365161-67365183 AGGGTGACTGCAGCTGCTGGAGG + Exonic
1084302981 11:68263487-68263509 CAGCTGCCTGGTCCTGCTAGGGG + Intronic
1084517126 11:69643120-69643142 GAGCCGCCTGCAGCTGCTGGGGG + Exonic
1084872674 11:72108715-72108737 GAGGGACCTGCAGCTGCTGGAGG + Exonic
1085509425 11:77080623-77080645 CTGTTCCCTGGACCTGCTGGAGG - Intronic
1085642415 11:78200712-78200734 CAGCTGCCTGGAGCAGCTGGCGG + Exonic
1086662271 11:89434132-89434154 AAGGTGTCTGCTTCTGCTGGTGG - Intronic
1088827684 11:113509557-113509579 CAGGTGCATGCCCCTGCGAGCGG + Intergenic
1090672667 11:128960032-128960054 CAGTTGCCTGGACCTGCAGCAGG + Intergenic
1091385014 12:88255-88277 AAGGTCCCTGCAGCAGCTGGTGG + Intronic
1092052442 12:5481179-5481201 CCGGTTCCTGCCCTTGCTGGAGG + Intronic
1092476556 12:8823717-8823739 CAGGTACCACCTCCTGCTGGTGG + Exonic
1096679038 12:53242554-53242576 CAGCTGCCTCTACCTGCTTGAGG - Intergenic
1097153705 12:56997325-56997347 CATCTGCCAGCACCTGCTGCTGG - Intergenic
1100402702 12:94246113-94246135 CAGGAGCTGGCCCCTGCTGGGGG - Intronic
1100820148 12:98422552-98422574 CAGCTGTCTGCAGCTGCTGCTGG - Intergenic
1102486381 12:113260518-113260540 CAGTTGTCTGCACCTGTTGGTGG + Intronic
1102506672 12:113388479-113388501 CAGGATCCTGAGCCTGCTGGCGG + Exonic
1104322844 12:127768209-127768231 CAAGTGTCTGCACTTGGTGGGGG - Intergenic
1104932348 12:132346312-132346334 CAGGGGCCTTCACCTGCTCTCGG + Intergenic
1104970565 12:132528887-132528909 CATGTGCCTGGACTTGCTGTGGG + Intronic
1104990445 12:132621343-132621365 CAGGTGCCTGCACCTGCTGGGGG + Exonic
1108107297 13:47024951-47024973 TAGGTGCTTTCACCTGCTTGGGG - Intergenic
1108266344 13:48712689-48712711 CAGCTGCCTTCATCTGCTTGGGG - Intergenic
1111544422 13:89712189-89712211 CAGGTGCCTGCAGATACTAGTGG - Intergenic
1115070277 14:29314297-29314319 CAGATGCCTGCACTTGATGTTGG - Intergenic
1117533979 14:56686748-56686770 CTGCTGCCTCGACCTGCTGGGGG + Intronic
1120938193 14:89919318-89919340 CAGGTGCTTGGACCTGCTCTTGG - Intronic
1120959850 14:90114713-90114735 CAGGAGCGTACACCTCCTGGTGG - Intronic
1121259512 14:92555928-92555950 CAGGATCCTGCACCGGGTGGTGG + Exonic
1121693225 14:95892651-95892673 CATGAGCCTGAAACTGCTGGAGG - Intergenic
1122061509 14:99139428-99139450 GATGGGCCTGCACCAGCTGGAGG - Intergenic
1122400138 14:101462119-101462141 CAGGAGCCAGGACCTGCTGGAGG - Intergenic
1122686647 14:103511404-103511426 CAGGTGCCCGCAGATGCAGGCGG - Intergenic
1122866943 14:104610535-104610557 CAGGTGCCAGCATCTGCTGAGGG - Intergenic
1123783035 15:23645729-23645751 CCGATGCCTGGGCCTGCTGGGGG + Exonic
1124101863 15:26703241-26703263 CAGGCACCGGCACCTGGTGGGGG + Intronic
1124177636 15:27441252-27441274 CAGTTTCCTGTACCTGCTGTAGG + Intronic
1124179033 15:27456137-27456159 CAGGTGCCAGTAACTGCTGTTGG + Intronic
1124575396 15:30903680-30903702 CAGGCGCCTGCCTCTGCGGGTGG + Intergenic
1124949508 15:34303802-34303824 AAGGTGCCAGCATCTGCTGAGGG - Intronic
1128033339 15:64500923-64500945 CAGGTGCCTGCAGCCCCAGGAGG + Intronic
1129239508 15:74243124-74243146 GAGGTGCCTGCCCATGCAGGGGG - Intronic
1130644090 15:85708465-85708487 CAGGGGCATTGACCTGCTGGTGG + Intronic
1130653929 15:85778756-85778778 CTGGTGCTGGGACCTGCTGGTGG - Intronic
1131054195 15:89365923-89365945 CAGGTTCCTGGAGCTGCAGGAGG + Intergenic
1132151921 15:99468009-99468031 CAGGGCTCTGCAGCTGCTGGGGG - Intergenic
1132552228 16:558282-558304 GGGGGCCCTGCACCTGCTGGTGG - Intergenic
1132845302 16:1998534-1998556 GAGTTGCCGGGACCTGCTGGGGG - Exonic
1133050160 16:3112874-3112896 CAGGTGGTTGCAGCTGCAGGGGG + Exonic
1133281990 16:4671783-4671805 CACGTCCCTGCAGCTCCTGGGGG + Intronic
1133593673 16:7270197-7270219 CAGGTTCCTGCTCCTGCCTGGGG - Intronic
1134121325 16:11586805-11586827 GTGGCGCCAGCACCTGCTGGGGG - Intronic
1134196975 16:12166727-12166749 CTGATGCCTGAAGCTGCTGGTGG - Intronic
1137670031 16:50273479-50273501 GCAGTGCCTGCACCTGCTGCAGG + Intronic
1138541103 16:57688349-57688371 CAGGTGTCTTCATCTGCTGCTGG + Exonic
1138554159 16:57762419-57762441 CAGTTGCCCGCAGCTGGTGGAGG - Intronic
1138729750 16:59182169-59182191 CATGTGCACGCACATGCTGGTGG + Intergenic
1140645938 16:77029878-77029900 AAGATGCCGGCACCTGCTGAGGG + Intergenic
1141920461 16:87132357-87132379 CAGGAGCCTGCACCTGTTCCTGG - Intronic
1142143957 16:88484973-88484995 CAGGTGTCTGCAGCACCTGGGGG - Intronic
1142184451 16:88687842-88687864 CAGCAGCCTCCACCTCCTGGAGG - Intergenic
1142425586 16:90000676-90000698 CGGTCGCCTGCACCTGCTGCTGG + Intergenic
1143025034 17:3936509-3936531 CTGGAGCCTGCATCTGCCGGGGG - Intronic
1144437076 17:15251679-15251701 CAGGTCCCTGCCAGTGCTGGGGG - Intronic
1144620002 17:16812482-16812504 CACGTTCCTGGAGCTGCTGGAGG + Intergenic
1144631212 17:16873410-16873432 CAGGTGCCAGCACCTCTTGATGG - Intergenic
1144766911 17:17738019-17738041 CAGGTGGCTTCACATGCTGGTGG + Intronic
1144912709 17:18696227-18696249 CAGGTGCCTGCCACTGCTCCTGG + Intergenic
1146634302 17:34492736-34492758 TATCTGCCTGCACCTGCTGCTGG + Intergenic
1146822858 17:35998594-35998616 CAGATGCCTTCCCCTTCTGGGGG - Intronic
1147266278 17:39236768-39236790 CAGGTGCCTGGAGATGCAGGTGG + Intergenic
1147961334 17:44169456-44169478 CAGGTGGCTGCAGCAGCTGAAGG + Intergenic
1148437717 17:47695799-47695821 CAGGAGCCTGCCCCTGCTGCCGG + Exonic
1148938266 17:51182660-51182682 CAGATGCCTGCAGGGGCTGGTGG - Intronic
1149988725 17:61368337-61368359 CAGGAGCGTGACCCTGCTGGAGG + Exonic
1151495496 17:74455699-74455721 CAGGCCACTGCAGCTGCTGGTGG - Intergenic
1151576666 17:74955894-74955916 CAAGTTGCTGCACCTGCTGGAGG - Exonic
1151713719 17:75820799-75820821 CTGGTGTCTGCAGCTGCTGGGGG - Intronic
1151971683 17:77460636-77460658 CAGGAGCCCCCAGCTGCTGGGGG - Intronic
1152111628 17:78360240-78360262 CCGGTCCCTGCCCCTGCTCGCGG - Intergenic
1152419418 17:80184064-80184086 CGAGGGCCTGCACCAGCTGGAGG + Exonic
1152780652 17:82226178-82226200 CAGGTGCCTCCACCTGCCCCTGG - Intergenic
1153715372 18:7842034-7842056 CAGGTGCCCTCACCTGCTCAAGG - Intronic
1154177026 18:12092506-12092528 CAAGTGCCTGGATCTGCTGGTGG - Intergenic
1159017153 18:63110597-63110619 GAGCTGCCTGCACCAGCTGGTGG + Intergenic
1160147916 18:76379346-76379368 CCGGTGCCTGCCCCGGGTGGCGG - Exonic
1160344776 18:78123914-78123936 CAGGTGCCTGCACCTCTCCGTGG + Intergenic
1160797514 19:952846-952868 CAGGTCCCAGCAGCTGCGGGGGG - Intronic
1161034718 19:2078191-2078213 CAGGTACATGGACCTGCTGATGG - Exonic
1161714416 19:5867249-5867271 CAGGTGCCGGCAGTTGCTGGGGG + Exonic
1161768409 19:6218962-6218984 CAGCTGCCTCCTCCTGATGGAGG - Intronic
1162959092 19:14115840-14115862 CAGCTGGCCTCACCTGCTGGGGG + Intronic
1163133087 19:15288740-15288762 CGGGTGCCTGCCCCTGCAGATGG + Intronic
1163182739 19:15615667-15615689 CCCGTGGCTGCTCCTGCTGGTGG + Exonic
1165183113 19:33989875-33989897 CAAGTCCCTGCCCCTGGTGGTGG - Intergenic
1165342426 19:35222592-35222614 CCTGTGCCTGCAACTGCTTGGGG + Intergenic
1166305328 19:41934352-41934374 CGTGTGCCTGCACATGCTGTGGG + Intergenic
1166831822 19:45643816-45643838 CCGGTGCCTGGACCTGCAGAGGG + Intronic
1167520201 19:49950172-49950194 TAGGTGGCTGCACCTGGGGGCGG + Exonic
1167604620 19:50475271-50475293 CAGGTGCCTGGAGCTGAGGGAGG + Intronic
1167749761 19:51372502-51372524 CCGGTCCCTGGCCCTGCTGGGGG - Exonic
1168241385 19:55090861-55090883 CTGTTTCCTGCTCCTGCTGGGGG - Intergenic
1168257745 19:55175867-55175889 CTGGGCCCTGCAGCTGCTGGTGG - Exonic
1168378298 19:55899169-55899191 CACGTTCATGCACCTGCGGGGGG - Intronic
925270239 2:2600854-2600876 CTGGTGTCTGCCTCTGCTGGAGG - Intergenic
925719907 2:6817255-6817277 CACCTGCCTGCCCCAGCTGGTGG - Intergenic
926153127 2:10435545-10435567 CAGGTGCATGACCCTCCTGGCGG + Intergenic
926679036 2:15650072-15650094 GAGGAGCCTGCACCGCCTGGAGG - Intergenic
927537131 2:23872306-23872328 CAGGTGCATGCAGTTCCTGGGGG - Intronic
927937509 2:27083953-27083975 CAGCTCCCTGCAGCTCCTGGAGG + Exonic
930883316 2:56296451-56296473 CAGCTGCCTGCTCCTTCTGCAGG - Intronic
933278051 2:80303694-80303716 CAGCTGCGGGCACCCGCTGGGGG + Exonic
934028378 2:88019162-88019184 CTGTTGCCTGCTCCTGCTGGAGG + Intergenic
934089536 2:88539193-88539215 CTGGAGCCTGAAGCTGCTGGGGG - Intergenic
934580883 2:95436740-95436762 CAGTTTCCTGGAGCTGCTGGAGG - Intergenic
934598568 2:95639975-95639997 CAGTTTCCTGGAGCTGCTGGAGG + Intergenic
935317676 2:101852790-101852812 CATATATCTGCACCTGCTGGGGG - Intronic
936071360 2:109373910-109373932 CTCGGGCCTGCACCTGCTTGCGG - Intronic
937969280 2:127536832-127536854 CATCTCCCTGGACCTGCTGGGGG + Intronic
939072613 2:137561174-137561196 CAGTTGTCTGCACCTGCAGCAGG - Intronic
941583723 2:167331504-167331526 CTGGTCCCTGGACCTGCAGGTGG + Intergenic
944535555 2:200705965-200705987 CAGGTGCTTGCAGCTGGTGGTGG - Intergenic
946161430 2:217838336-217838358 CAGATGCCTGCAGCAGCTTGGGG + Intronic
946377976 2:219325398-219325420 CATTTGCCTGCAGCTGCAGGTGG - Intergenic
946530914 2:220569514-220569536 CATTTGCCTGCACCTGCTGGGGG + Intergenic
947206550 2:227666566-227666588 CTGATGCCTTCTCCTGCTGGGGG - Intergenic
947603387 2:231468272-231468294 CAGGCCCCTGAGCCTGCTGGAGG + Intronic
947873106 2:233450555-233450577 CAGCAGCCTGCACAGGCTGGGGG - Intronic
948197747 2:236107784-236107806 CTGGGGCCTGCACCTGCCGGGGG + Intronic
948708939 2:239813381-239813403 CGGGTGCCTTCAGCTGCTGGAGG + Intergenic
1169039394 20:2480571-2480593 ATGGTGCCAGCACCTGGTGGGGG - Intronic
1169192831 20:3668843-3668865 AAGCTGCCTGCAGGTGCTGGAGG + Exonic
1170304238 20:14919988-14920010 CAGGTGTGCTCACCTGCTGGGGG - Intronic
1170827532 20:19809377-19809399 CAGCGTCCTGCATCTGCTGGAGG + Intergenic
1171445133 20:25197320-25197342 CTCCTGCCTCCACCTGCTGGAGG + Intronic
1172939654 20:38645757-38645779 GAGGGTCCTGCACCTGCTGAGGG - Intronic
1173825265 20:46044005-46044027 CAGGTCCCAGCACCTCCTGATGG - Intronic
1173845981 20:46189090-46189112 CAGGTGCAGCCACCTCCTGGGGG + Intronic
1174009309 20:47436631-47436653 CAGGTGCGTGCCACTGCTGCCGG + Intergenic
1174254776 20:49246437-49246459 CACGTGCCTCCATCTCCTGGAGG + Exonic
1175203071 20:57291200-57291222 CCGCTCCCTGCACCTGCAGGGGG - Intergenic
1175215992 20:57391935-57391957 CAGGTGCGGGCGCCGGCTGGAGG - Intronic
1175743275 20:61435664-61435686 CGGGTCCTTGCACCTGCAGGAGG + Intronic
1177310347 21:19384150-19384172 AAGGTGCCTGCATCTGGTGTGGG - Intergenic
1178134114 21:29606905-29606927 CAGGTGCCTGCACCCAGTTGTGG - Intronic
1178931193 21:36820439-36820461 GAAGTGCCTGCTCCTGCTGCAGG + Intronic
1179417194 21:41208354-41208376 CAGGTGCCTGCACCTTCTGGGGG + Intronic
1179417374 21:41209212-41209234 CAGGTGCCTGCGCCTTCTGGGGG + Intronic
1179480089 21:41671503-41671525 AGGGAGCCTGCACCTGCAGGTGG + Intergenic
1179907057 21:44427862-44427884 CAGGTGGCTGCAGCTGCAGGCGG + Intronic
1180021166 21:45128180-45128202 CAGGTGCCTCTACCTGCTGCAGG + Intronic
1180033400 21:45228039-45228061 CAGCTGCGTTCACCTACTGGTGG - Intergenic
1180921134 22:19522278-19522300 CCTGTGCCAGCCCCTGCTGGGGG - Intergenic
1180964047 22:19776461-19776483 CAGGGGCCTGCACGGGGTGGAGG + Intronic
1181557684 22:23681319-23681341 CATGTGCTTGCACCAGCAGGGGG - Intergenic
1181605440 22:23977484-23977506 CGGATGCCTGCAGCTGCTCGAGG - Intronic
1182282657 22:29226243-29226265 CAGGTCCCTGGTCCTGCTGCCGG + Intronic
1183078889 22:35443759-35443781 CAGGTGCTTGCACTTGTTTGTGG + Intergenic
1183760397 22:39811313-39811335 CAGTGGCCTGGACCTGCTGCAGG - Intronic
1184439177 22:44498206-44498228 CCGGTCCCTGCACCTGCCGGAGG - Exonic
1184559778 22:45255511-45255533 AAGGTGCCAGCATCTGGTGGGGG + Intergenic
1185195101 22:49464433-49464455 CAGGACCCCGCACCGGCTGGTGG + Intronic
950267361 3:11584456-11584478 CAGATGCATACAGCTGCTGGTGG + Intronic
950686442 3:14621865-14621887 CATCTGCCTGCACCTTCTTGAGG + Intergenic
952267592 3:31801542-31801564 CAGGGGCCTGGGCCTGCTGTGGG - Intronic
953448574 3:42988106-42988128 CAGGTGTCTACACTGGCTGGAGG - Intronic
954314614 3:49794437-49794459 CAGAAGCCTTCCCCTGCTGGGGG + Intronic
954468522 3:50673015-50673037 CAGGTGCATGGTCCTGCTGAAGG + Intergenic
955217286 3:56994857-56994879 GAGGTGACTGGACCTGGTGGTGG + Intronic
955874793 3:63477443-63477465 CAGGTTCCTGCCCCAGCTGAGGG + Intronic
961175952 3:124835072-124835094 GAGGTGTCTACACGTGCTGGTGG - Intronic
961746074 3:129064246-129064268 CAGGGGCCTGGAATTGCTGGCGG - Intergenic
962530784 3:136277888-136277910 CAGGTGCCTGGCCCTGCAGGTGG - Intronic
962919236 3:139935841-139935863 CAGGTGTCTGCTCCTGCCTGGGG + Intronic
964386242 3:156151063-156151085 AAGGTGCCTGCACCTGAGGTGGG - Intronic
964646073 3:158959725-158959747 GAGATGCCTGCATGTGCTGGAGG + Intergenic
964723564 3:159791539-159791561 CAGCTTTCTGCAGCTGCTGGAGG + Intronic
965678398 3:171224119-171224141 CATGAGCCTGCAGCTGCTGCTGG + Intronic
968046930 3:195629864-195629886 CAAGTGCCTTCAGCTGCTGCTGG + Intergenic
968190207 3:196661617-196661639 CAGCTGCCTCACCCTGCTGGTGG + Exonic
968279695 3:197466972-197466994 CAGGCCCCCGCACTTGCTGGTGG + Intergenic
968307723 3:197660180-197660202 CAAGTGCCTTCAGCTGCTGCTGG - Intergenic
968571946 4:1346714-1346736 CAGGTCCCTTCACCTGCAGAGGG - Intergenic
968737324 4:2304160-2304182 CAGGGCCCAGCACCTGCCGGTGG + Intronic
969264903 4:6057884-6057906 CAGGTGCCTCCACCTCAGGGAGG - Intronic
970039688 4:11781928-11781950 CAGGTGCCTGCCCCTGCACCTGG - Intergenic
970384611 4:15543665-15543687 GAGGTCCCTGCCCCTGCTGTGGG + Intronic
970867142 4:20772198-20772220 AAGGTGAGTGCACCTGCGGGGGG + Intronic
971481105 4:27115860-27115882 CAGGTGCCTGCAACTGCCTCTGG + Intergenic
972739374 4:41876200-41876222 AAGGTGCCTGCACAGGCTTGAGG - Intergenic
975473217 4:74794060-74794082 CCTGGGGCTGCACCTGCTGGAGG - Intronic
975681832 4:76885179-76885201 CAGGTGCCAGCACATGGTGAAGG - Intergenic
977666505 4:99651218-99651240 CAGCTGTCTGCAGCAGCTGGCGG - Exonic
978186369 4:105860852-105860874 GAGGTGTCTGCCCCTACTGGGGG - Intronic
978966054 4:114743047-114743069 AAGGTACCTGCACCAGCTGGAGG + Intergenic
979839787 4:125423713-125423735 CAGCTGCCTTCACAGGCTGGTGG - Intronic
980155193 4:129096111-129096133 CAGCTGCCTACACGTTCTGGGGG - Intronic
981045137 4:140257829-140257851 CAGGTCCCTAGAACTGCTGGAGG + Intronic
981615025 4:146637341-146637363 CCAGTGCCTGCACCTGCTCCCGG + Intergenic
984682668 4:182628005-182628027 CAGGAGTGTGAACCTGCTGGGGG - Intronic
985744684 5:1639279-1639301 CAAGTGCCTTCAGCTGCTGCTGG - Intergenic
986873736 5:12081192-12081214 CAGCAGCCTGCAGCTGCTGGAGG - Intergenic
987262884 5:16221422-16221444 CAGGTCCCTGCTCCAGCTGGAGG + Intergenic
992352510 5:75944862-75944884 TAGGTGCCTGCACCAAATGGTGG - Intergenic
992736097 5:79723294-79723316 CAGGTGCCTGCCACTGCTCCCGG - Intronic
994687544 5:102974394-102974416 CAGGTGCCTTCACCAGGTGGGGG - Exonic
995543080 5:113203167-113203189 CAGGGGCCTGAACCTGCAAGAGG + Intronic
997634694 5:135396644-135396666 TAGGTTACTGTACCTGCTGGGGG + Intronic
999197208 5:149790516-149790538 CAGTAGCCTGCACTTCCTGGAGG + Intronic
999483801 5:151972762-151972784 CATGTGCCTGAACTTTCTGGCGG + Intergenic
999519262 5:152333653-152333675 TAGGGGTCTGCACCTGATGGTGG + Intergenic
1000974023 5:167745207-167745229 CAGGTGGCTACCCCTGATGGAGG + Intronic
1002277980 5:178115420-178115442 AAGGTCCCACCACCTGCTGGGGG - Intronic
1002535832 5:179874870-179874892 CGGGTTCCTTCTCCTGCTGGGGG - Intronic
1002604026 5:180371393-180371415 CAGGAGTCCGCACCAGCTGGTGG - Intergenic
1002604040 5:180371460-180371482 CAGGAGTCCGCACCAGCTGGTGG - Intergenic
1002640210 5:180627165-180627187 CAGGTGCCTGCCCCTGGTGCTGG + Intronic
1003007756 6:2397525-2397547 CCTGTGCTTGCACCTGCAGGTGG + Intergenic
1004473583 6:15950496-15950518 CAGGTGCCAGCATCTGCTCCTGG - Intergenic
1005753880 6:28908411-28908433 CAGGTGCCAGCTCGGGCTGGAGG - Intronic
1007368935 6:41413608-41413630 CAGCTGCCTACACCAGCAGGAGG - Intergenic
1010020893 6:71158767-71158789 CAGGTGGCTGCTGTTGCTGGTGG - Intergenic
1012359763 6:98362399-98362421 CAGGTGCCTGCTGTTGTTGGAGG + Intergenic
1012599623 6:101079101-101079123 AAGGTGCCAGCATCTGCTGTGGG - Intergenic
1013352546 6:109318658-109318680 CAGATGGCTGCACCTGATGCAGG - Intergenic
1014559190 6:122870436-122870458 GAGGTGCCTGCATCTGATGAGGG - Intergenic
1015554957 6:134451731-134451753 CAGGGGCCTGGGCCTGCAGGGGG - Intergenic
1018726866 6:166619544-166619566 CAGGTGCCTGCAGGAGCTGACGG + Intronic
1018804708 6:167249673-167249695 CAGGTGCGTGGACCGGCTGGAGG + Intergenic
1018826014 6:167408391-167408413 CAGGTGCGTGGACCGGCCGGAGG + Intergenic
1018987994 6:168652342-168652364 CAGGGGCCAGCACCTCCAGGAGG + Intronic
1019105480 6:169663972-169663994 CAGGTGCCTCCATCTGCTGATGG + Intronic
1019395567 7:816284-816306 GAGGGGTCTGCACCTGCTGGGGG - Intergenic
1019520521 7:1458766-1458788 CAGGGGCCTGAACAGGCTGGGGG + Intronic
1019723263 7:2586507-2586529 CATGTGCCAGCACCTGCCGCGGG + Intronic
1022178349 7:27894135-27894157 CAGGAGCTTACACCTGTTGGAGG - Intronic
1024385712 7:48748959-48748981 CTGGGCTCTGCACCTGCTGGAGG + Intergenic
1025212502 7:57028099-57028121 TAGGTGGCTGCATCTCCTGGAGG - Intergenic
1025659453 7:63548728-63548750 TAGGTGGCTGCATCTCCTGGAGG + Intergenic
1026986156 7:74556299-74556321 CAAGTGCCAGCATGTGCTGGAGG - Intronic
1029413802 7:100430825-100430847 CGGCTGCCTGCTGCTGCTGGTGG - Exonic
1032141439 7:129334664-129334686 CTGGTACCTGCTACTGCTGGTGG + Intronic
1032967875 7:137122232-137122254 CAGGTAGCAGCACCTGCTTGCGG + Intergenic
1033681983 7:143603787-143603809 CTGGTTCTTCCACCTGCTGGAGG + Intergenic
1033702907 7:143858126-143858148 CTGGTTCTTCCACCTGCTGGAGG - Intronic
1034953539 7:155317482-155317504 CTGGTGCCTGTCCCTGCAGGTGG + Intergenic
1035037793 7:155906711-155906733 CTGGAGTCTGGACCTGCTGGTGG + Intergenic
1035622495 8:1044401-1044423 CAGGTGGCTGCACAGGCTGGAGG + Intergenic
1038652784 8:29420824-29420846 CAGGGGCCTGGAGGTGCTGGGGG + Intergenic
1038756415 8:30345445-30345467 CAGGTGGCTGCATCTGGTGAGGG - Intergenic
1039470353 8:37809612-37809634 CTGGTGCCTGCATCTGCGAGTGG + Intronic
1039475852 8:37839081-37839103 CAGGTGGGTGCTCCTGCAGGAGG + Exonic
1040073431 8:43206452-43206474 CAAGCGCCATCACCTGCTGGAGG + Intergenic
1040538511 8:48330524-48330546 CAGGTCCCTGCACCTTTTGAGGG + Intergenic
1040596838 8:48846818-48846840 CAGCTGCCTGCACTTGGTCGGGG + Intergenic
1041048850 8:53913731-53913753 CAGATGCCTGGCCCTGCTGACGG + Intronic
1047700591 8:127445671-127445693 CTGGTGGCTGCACAGGCTGGGGG - Intergenic
1048508235 8:135040112-135040134 GATGTGGCTGCCCCTGCTGGAGG - Intergenic
1049018669 8:139939346-139939368 CAGGTGCCAGCACCTGAGAGGGG + Intronic
1049262939 8:141649407-141649429 CCGTGGCCTCCACCTGCTGGAGG + Intergenic
1052419409 9:28223248-28223270 CAGGCAACTGAACCTGCTGGAGG - Intronic
1053267261 9:36724366-36724388 CAGATGTCTGCAGCTGCAGGTGG - Intergenic
1053271635 9:36754059-36754081 CAAGTGCCTTCACTTCCTGGTGG - Intergenic
1053600131 9:39602142-39602164 CTGTTGCCTGCTCCTGCCGGAGG - Intergenic
1053857785 9:42355998-42356020 CTGTTGCCTGCTCCTGCTGGAGG - Intergenic
1054253394 9:62740242-62740264 CTGTTGCCTGCTCCTGCCGGAGG + Intergenic
1056020982 9:82438086-82438108 CAGGCTGCTGCACTTGCTGGAGG - Intergenic
1056578002 9:87870618-87870640 CAGGTGCCTGCAAGGGCTGCAGG - Intergenic
1056764654 9:89437298-89437320 CAGGTGCCTGCCGCTGTGGGAGG - Intronic
1057070914 9:92099246-92099268 CAGGCTGCTGCACTTGCTGGAGG + Intronic
1057875317 9:98749187-98749209 CAGGTGGCTGTGCTTGCTGGGGG - Intronic
1061274384 9:129561181-129561203 CTGGTGCCAGCCCCAGCTGGGGG - Intergenic
1061508958 9:131048941-131048963 CAGGTGCCAGCCCCAGGTGGGGG - Intronic
1061908460 9:133710768-133710790 CCGGTGGCTGGTCCTGCTGGTGG + Intronic
1062178021 9:135175141-135175163 CTGGTGGCTGCCCCTCCTGGGGG + Intergenic
1186460675 X:9746089-9746111 CATGTACCTGCCCCTGCTGCTGG - Exonic
1186591242 X:10932067-10932089 GAGGTGCCTTCACTTCCTGGAGG - Intergenic
1187628272 X:21141410-21141432 CAGGTGCCAGCAGTTGCTAGGGG + Intergenic
1193897120 X:87127785-87127807 CAGTTGCCTACAGCTGGTGGAGG - Intergenic
1196015945 X:110939956-110939978 AAGGTGCCAGCACCTGCTTCTGG - Intergenic
1196441157 X:115721360-115721382 CAGCTGCCTTCACCTGCTAAGGG - Intergenic
1196444685 X:115839348-115839370 CAGCTGCCTTCACCTGCTAAGGG - Intergenic
1196462487 X:115944851-115944873 CAGTTGCCAGCACGTGTTGGAGG - Intergenic
1197388170 X:125826672-125826694 GAGGTGCCAGAACCTGCTTGTGG + Intergenic
1199992589 X:152995994-152996016 CAAGGGGCTGCACCTGCTGAGGG + Intergenic
1200769010 Y:7106438-7106460 CAGGTACCTGCCCCTGCTGCTGG - Intergenic