ID: 1104994079

View in Genome Browser
Species Human (GRCh38)
Location 12:132643191-132643213
Sequence GGCCCTCCATGGCAGCACAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 115}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104994079_1104994087 26 Left 1104994079 12:132643191-132643213 CCAATGTGCTGCCATGGAGGGCC 0: 1
1: 0
2: 0
3: 13
4: 115
Right 1104994087 12:132643240-132643262 ACGGATGCCCTGCGCTGTGAGGG 0: 1
1: 0
2: 0
3: 6
4: 96
1104994079_1104994088 27 Left 1104994079 12:132643191-132643213 CCAATGTGCTGCCATGGAGGGCC 0: 1
1: 0
2: 0
3: 13
4: 115
Right 1104994088 12:132643241-132643263 CGGATGCCCTGCGCTGTGAGGGG 0: 1
1: 0
2: 0
3: 15
4: 114
1104994079_1104994084 7 Left 1104994079 12:132643191-132643213 CCAATGTGCTGCCATGGAGGGCC 0: 1
1: 0
2: 0
3: 13
4: 115
Right 1104994084 12:132643221-132643243 CACAGTGTCCAGCACAAAGACGG 0: 1
1: 1
2: 15
3: 151
4: 772
1104994079_1104994086 25 Left 1104994079 12:132643191-132643213 CCAATGTGCTGCCATGGAGGGCC 0: 1
1: 0
2: 0
3: 13
4: 115
Right 1104994086 12:132643239-132643261 GACGGATGCCCTGCGCTGTGAGG 0: 1
1: 0
2: 1
3: 7
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104994079 Original CRISPR GGCCCTCCATGGCAGCACAT TGG (reversed) Intronic
900234001 1:1577931-1577953 GCCCGTCCATGGCTGCCCATGGG + Intergenic
900312032 1:2038223-2038245 CGACCTCCATGGCTGCACAGAGG + Intergenic
900948199 1:5843203-5843225 GGCCCTGCAGACCAGCACATGGG - Intergenic
901768849 1:11520537-11520559 GGCCCTGCATGCCAGCCCGTGGG - Intronic
902188186 1:14741066-14741088 GGACCTCCATGGTAGCACAAGGG - Intronic
903256627 1:22106546-22106568 TGCCCTCCCTGGCAGCAAAAGGG - Intergenic
907249650 1:53129691-53129713 ACCCCTCCATGGCAGCCCAGGGG + Intronic
912511664 1:110194143-110194165 GGCTCTCAATGGAAGCACACCGG - Intronic
913937016 1:125064770-125064792 AGCCCTCCATGGCAGTGCTTGGG - Intergenic
916120375 1:161524125-161524147 GGCCCTCCAAGGCAGCCCGCAGG + Intergenic
916130136 1:161605774-161605796 GGCCCTCCAAGGCAGCCCGCAGG + Intronic
919887740 1:201947054-201947076 GGTCCTCCTTGGCAGAACCTGGG - Intergenic
920069044 1:203289472-203289494 GGCCCTCCTTGGCAGGGCATTGG - Intergenic
922718998 1:227890827-227890849 GGCCCTCCATGGGAGGCCACAGG + Intergenic
1066005366 10:31141748-31141770 GGGCCTCCATGCCAGCCCCTTGG - Intergenic
1067204777 10:44203166-44203188 GGCCCTCCCAGGCAGGACACTGG - Intergenic
1076344070 10:129768649-129768671 GGCTCTCCAAGGCAGCAGCTTGG + Intergenic
1076352376 10:129825975-129825997 GGCCCCACATGGCACCAGATGGG - Intergenic
1076425611 10:130365382-130365404 AGCCCTCCCTGGCATCAGATGGG - Intergenic
1077462957 11:2720066-2720088 GTCCCTCCATGCCAGCTCACTGG + Intronic
1079339189 11:19598035-19598057 GGCCCCCCAGGGCAGCAGAAGGG - Intronic
1081488075 11:43547252-43547274 GGCCCTCCATGTCAGCACCCAGG + Intergenic
1091224152 11:133947438-133947460 GACTCTCCAGGGCAGCACCTAGG + Intronic
1091590972 12:1842778-1842800 CACCCTCGATAGCAGCACATTGG - Intronic
1095039211 12:37423384-37423406 GGCCCTCCGTGGCAGTGCGTTGG - Intergenic
1095741915 12:45616733-45616755 GCCCCTCAATCCCAGCACATTGG + Intergenic
1099322015 12:81162505-81162527 GGCCATCCATGGCTGCTAATAGG - Intronic
1100431404 12:94534580-94534602 GCCCCTCCATGGCGCCATATTGG - Intergenic
1101969974 12:109306064-109306086 GCCCCTCCTGGGCAGCACCTGGG + Intronic
1103447512 12:121003915-121003937 AGCCCTCCGTGGGAGCACAGAGG + Exonic
1103716399 12:122947758-122947780 GGCCCGCGATGGCATCACAGCGG + Intronic
1104994079 12:132643191-132643213 GGCCCTCCATGGCAGCACATTGG - Intronic
1110893744 13:80723047-80723069 GACCCTCCATGGTGGCACACAGG + Intergenic
1111966425 13:94866530-94866552 GGACCACCATGACAGCCCATAGG - Intergenic
1111966616 13:94867892-94867914 GGACCACCATGGCAGCCCATAGG + Intergenic
1112433606 13:99374736-99374758 AGCCAAGCATGGCAGCACATTGG + Intronic
1114257920 14:21018363-21018385 GGCCCGGCATGGGAGCAAATGGG - Intronic
1121433791 14:93905731-93905753 GGTCCTCCTGGTCAGCACATGGG + Intergenic
1122633098 14:103116813-103116835 GGCCTGCCATGCCAGCACCTGGG - Intergenic
1202855057 14_GL000225v1_random:44587-44609 GGCCCTCCATGGTGGCAGCTGGG - Intergenic
1202857480 14_GL000225v1_random:59877-59899 GGCCCTCCATGGTGGCAGCTGGG - Intergenic
1202857887 14_GL000225v1_random:63131-63153 GGCCCTCCATGGTGGCAGCTGGG + Intergenic
1123627841 15:22239683-22239705 GGCCCTCCTTGTCAGCACCAGGG - Intergenic
1129308856 15:74690684-74690706 GGCCCTACATCCCAGCACTTTGG + Intronic
1130907598 15:88251548-88251570 AGCCACCCATGGGAGCACATGGG + Intronic
1131506791 15:93026605-93026627 GGCCCTCCATGGGAGGACTGTGG - Exonic
1134005679 16:10817788-10817810 GGCCCTCCATGGCTGCACTAAGG + Intronic
1135540944 16:23330137-23330159 GGCCCTCAAAGGCGACACATGGG - Intronic
1136472986 16:30494268-30494290 GCCCCTCGATACCAGCACATGGG + Exonic
1137685078 16:50381222-50381244 GGCCCACCATGGGAGCCCAGTGG + Intergenic
1138157626 16:54720712-54720734 TGCCATCCATGCCTGCACATGGG - Intergenic
1139850945 16:69951420-69951442 GGCCCTCCTTGGCACCGCCTGGG + Exonic
1139879927 16:70174332-70174354 GGCCCTCCTTGGCACCGCCTGGG + Exonic
1140372587 16:74421195-74421217 GGCCCTCCTTGGCACCACCTGGG - Exonic
1143260824 17:5596999-5597021 GTCACTCCAAGGCAGCAGATGGG + Intronic
1145264680 17:21374091-21374113 GGCCCTTAATGGCTGCTCATGGG + Intergenic
1145379046 17:22377060-22377082 AGCCCTCCGTGGCAGCGCTTGGG + Intergenic
1145379525 17:22379430-22379452 AGCCCTCCGTGGCAGCGCTTGGG + Intergenic
1145380004 17:22381800-22381822 AGCCCTCCGTGGCAGCGCTTGGG + Intergenic
1145380484 17:22384175-22384197 AGCCCTCCGTGGCAGCGCTTGGG + Intergenic
1145380962 17:22386522-22386544 AGCCCTCCGTGGCAGCGCTTGGG + Intergenic
1145382174 17:22392671-22392693 AGCCCTCCGTGGCAGCGCTTGGG + Intergenic
1145382650 17:22395036-22395058 AGCCCTCCGTGGCAGCGCTTGGG + Intergenic
1145384455 17:22403892-22403914 AGCCCTCCGTGGCAGCGCTTGGG + Intergenic
1145384774 17:22405354-22405376 AGCCCTCCGTGGCAGCGCTTGGG + Intergenic
1145384901 17:22405984-22406006 GGCCCTCCGTGGCAGCGCTTGGG + Intergenic
1151176719 17:72294680-72294702 GGGCCTCCAGAGAAGCACATGGG + Intergenic
1153527566 18:6012243-6012265 GGCCCTCCCTGACAGCTCTTAGG - Intronic
1157529859 18:48410726-48410748 CGCCCTCCTTGGTAGTACATCGG + Intronic
1158941253 18:62407313-62407335 GGTCCTCCCTGGCAGGACACTGG + Intergenic
1165466793 19:35979367-35979389 GGCCCTCCAGGACAGCACACTGG - Intergenic
1165601242 19:37057088-37057110 AGCCCTCCATGGCAGTGCTTGGG + Intronic
1166539249 19:43594739-43594761 GGACCTCCATGGTCGCACCTAGG + Intronic
1167464892 19:49645510-49645532 GGCTCCCCATGCCAGCACAAGGG - Intronic
928844676 2:35656659-35656681 GGCTCACCATGACAGCACAGGGG - Intergenic
931307510 2:61044927-61044949 GGACCTCCATGCAAGCACAAAGG + Intronic
937008115 2:118536369-118536391 GCCCCTGTATGGCAGCACATGGG - Intergenic
937998596 2:127713988-127714010 GGCCCTCCAAACCATCACATGGG - Exonic
940202333 2:151165269-151165291 GGCCCTCCATGAAGGCAAATTGG - Intergenic
945061321 2:205911343-205911365 GACCCTCCATGGTTGCTCATTGG - Intergenic
946228468 2:218277348-218277370 GGCCCTCCATGCCCTCACCTTGG + Exonic
1170893994 20:20398061-20398083 GGCCCTTCAGCACAGCACATTGG - Intronic
1171544067 20:25987403-25987425 AGCCCTCCGTGGCAGTACTTGGG + Intergenic
1173973112 20:47167725-47167747 GGCCCTAAATGGAATCACATGGG - Intronic
1174046026 20:47734101-47734123 GGCCATGCATGGCAGCAAAGGGG - Intronic
1174992934 20:55533736-55533758 GGCCCTGGATGGCATCCCATAGG - Intergenic
1175899501 20:62354463-62354485 GGGCCTCCATGCCTGCACCTGGG + Intronic
1180150188 21:45943351-45943373 GGCCCTCCAGGCCGGCACACGGG - Intergenic
1180707113 22:17816855-17816877 CGGCCTCCTTGGCTGCACATGGG - Intronic
1180913501 22:19469716-19469738 TGCCCTCCAAGACAGCAGATGGG + Intronic
1181040776 22:20191673-20191695 GGCCACCCATGGGGGCACATAGG + Intergenic
1183332315 22:37228256-37228278 GGCCTCCCATGGCAGGACAGAGG - Intronic
1184377585 22:44124485-44124507 GACCCTCCAGGACAGCCCATGGG - Intronic
950739923 3:15042194-15042216 GGCCCTCCAGGGCAGCATTGTGG + Intronic
956796650 3:72724155-72724177 GGCCTTCAATGCCAGCACTTTGG - Intergenic
963836115 3:150059645-150059667 GACCCTCCATGGCACCTCATCGG - Intergenic
967450850 3:189620668-189620690 GGCCCGTGCTGGCAGCACATGGG - Intergenic
969407415 4:7003003-7003025 GGCTCTCCAAGTCAGAACATGGG - Intronic
974466244 4:62260092-62260114 GTTCATCCATGGCAACACATGGG - Intergenic
984998628 4:185462862-185462884 GGATCTCCATGAAAGCACATTGG - Intronic
985536834 5:469675-469697 GGCCTCCCATGGCTGCCCATGGG + Intronic
985802398 5:2013346-2013368 GGTCCTCCATGGATGCACACAGG - Intergenic
986215082 5:5712624-5712646 GGCCCCCCATGGCCACCCATGGG - Intergenic
997001879 5:129771318-129771340 TGCCTTACATGGCAGCACATTGG - Intergenic
1000004980 5:157175192-157175214 TGTCCTCCATGGCAGCAAAATGG - Intronic
1008584573 6:52937084-52937106 GGACCTCCATGGCAGCAGCAGGG + Intergenic
1011175059 6:84551139-84551161 GGACCTGCATGGCATCACCTAGG - Intergenic
1016549304 6:145258947-145258969 TGCCTTGCATGGCAGTACATTGG + Intergenic
1018269780 6:162064890-162064912 GGCCCTTAAGGGCATCACATGGG - Intronic
1018373576 6:163190512-163190534 GGCCCTGCCTAGCAGCACAAGGG + Intronic
1025295447 7:57772487-57772509 AGCCCTCCGTGGCAGTACTTGGG + Intergenic
1028446224 7:90927182-90927204 GCCCCTCCCTGGAGGCACATTGG + Intronic
1036711020 8:11078661-11078683 GGCCCCCCATGACAGCACGAAGG + Intronic
1045385274 8:101666574-101666596 CCCCCTCCATGGCAGCATCTTGG + Exonic
1045820175 8:106328108-106328130 GGCACCACATGGCAGCAAATTGG + Intronic
1046459729 8:114518083-114518105 GCCCATCCATGGCTGCCCATGGG - Intergenic
1048970241 8:139641364-139641386 AGCCCACCCTGGCAGGACATAGG + Intronic
1050426337 9:5516400-5516422 GCCCTTCCATGGCTGCCCATGGG - Intronic
1052339417 9:27350879-27350901 AGCCCACCATGGCAGCAGAGGGG - Intronic
1054160889 9:61671538-61671560 AGCCCTCCATGGCAGTGCTTGGG - Intergenic
1054173555 9:61860235-61860257 AGCCCTCCGTGGCAGTACTTGGG - Intergenic
1054663985 9:67720546-67720568 AGCCCTCCGTGGCAGTACTTGGG + Intergenic
1054716101 9:68559207-68559229 GGCCCTCCATGGCCTCATAGGGG - Intergenic
1057444230 9:95102870-95102892 GGCCCCCCCTGGCAGCACACAGG + Intronic
1061446163 9:130639350-130639372 GGCCTGCCATGGCCGCAGATGGG - Intergenic
1062131327 9:134895137-134895159 GGCCCTGCATTGCAGCACAAGGG + Intergenic
1187405092 X:18996697-18996719 TGCTCTCCATGCCAGCACCTGGG - Intronic
1192553160 X:72069803-72069825 GGCCCCGCATGGCAGCAGCTGGG - Intergenic
1195328279 X:103775645-103775667 GGCCATCCATGGGAGGACACCGG + Intronic