ID: 1104995680

View in Genome Browser
Species Human (GRCh38)
Location 12:132653776-132653798
Sequence TAAGTATGAGGTCTGCTGTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 197}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104995678_1104995680 -8 Left 1104995678 12:132653761-132653783 CCAGTGTTTTGTGGTTAAGTATG 0: 1
1: 0
2: 2
3: 15
4: 132
Right 1104995680 12:132653776-132653798 TAAGTATGAGGTCTGCTGTTAGG 0: 1
1: 0
2: 0
3: 25
4: 197
1104995676_1104995680 8 Left 1104995676 12:132653745-132653767 CCTTACTTCAATGCTTCCAGTGT 0: 1
1: 0
2: 1
3: 15
4: 169
Right 1104995680 12:132653776-132653798 TAAGTATGAGGTCTGCTGTTAGG 0: 1
1: 0
2: 0
3: 25
4: 197
1104995675_1104995680 20 Left 1104995675 12:132653733-132653755 CCATTTCTTACTCCTTACTTCAA 0: 1
1: 0
2: 2
3: 47
4: 601
Right 1104995680 12:132653776-132653798 TAAGTATGAGGTCTGCTGTTAGG 0: 1
1: 0
2: 0
3: 25
4: 197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104995680 Original CRISPR TAAGTATGAGGTCTGCTGTT AGG Intronic
901168958 1:7240836-7240858 TAAGTATGATGTTAGCTGTATGG - Intronic
902219690 1:14957187-14957209 TAAGTAGGAGGTTTGCTTTTGGG - Intronic
905103017 1:35542018-35542040 TAAGTATGAGGTAGGCAGCTGGG - Intronic
905298053 1:36967038-36967060 TAAGTATCAGGTCTTGTGTTGGG + Intronic
908385503 1:63637543-63637565 TTAAAATGAGGTCTGCTGTGAGG - Intronic
908474486 1:64474160-64474182 GATGTATGATGTCTGCTGTCAGG - Intronic
911081378 1:93935165-93935187 TAATTATTAGGGATGCTGTTGGG + Intergenic
911628068 1:100149612-100149634 TAAGTATGTTCTCTTCTGTTTGG + Exonic
917736026 1:177921116-177921138 TAAATATGCTGTTTGCTGTTTGG + Intergenic
922004117 1:221511525-221511547 TAAGTATGAAGGCAGCTGTGTGG - Intergenic
922564441 1:226592429-226592451 TAAGTCTGGGTTCTGCTGTGAGG + Intronic
923878697 1:238079001-238079023 TAAGTATGATGTGAGCTGTGAGG + Intergenic
1062778022 10:171757-171779 TAAGTATGATGTTAGCTGTAGGG - Intronic
1064875047 10:19984222-19984244 CCAGTAAGAGGTCTGGTGTTGGG + Intronic
1065243424 10:23731713-23731735 TAAGTATAAGGTTAGCTGTAGGG + Intronic
1065548814 10:26849475-26849497 TAAGTATGATGGCTCCTGTTAGG + Intronic
1066292568 10:34027572-34027594 TAAGTGTCAGTCCTGCTGTTAGG - Intergenic
1066369861 10:34811405-34811427 TGGGTCTGAGGTCTGCAGTTGGG - Intronic
1067983019 10:51108652-51108674 TAAGTATGATGTTAGCTGTGGGG - Intronic
1068475931 10:57525214-57525236 TAAGTATGATGTCTTCTTCTAGG - Intergenic
1072338838 10:94426271-94426293 TAAGTATGATGTTAGCTGTAGGG + Intronic
1079456461 11:20640520-20640542 TAAGTAAGAGTGCTGGTGTTGGG + Intronic
1080319835 11:30994802-30994824 TGAGTATGATGTCAGCTGTAGGG - Intronic
1081640929 11:44753759-44753781 AAAGGATGAGCTGTGCTGTTAGG + Intronic
1081723891 11:45311988-45312010 TAAGTATAATGTTTGCTGTAGGG + Intergenic
1087419662 11:97905724-97905746 TAAGTATGTAGTCTGATTTTGGG - Intergenic
1088886316 11:114010215-114010237 TAAGTATGAGGTTTCTTTTTAGG + Intergenic
1089041670 11:115457022-115457044 TAACTATGAAGTCTGCACTTAGG - Intronic
1090122297 11:124043595-124043617 TAAGCATGACGTCAGCTGTGGGG + Intergenic
1090130063 11:124131926-124131948 TAAGTATGGTGTTTGCTGTAAGG + Intronic
1090301829 11:125648777-125648799 TAAGTATGATGTTAGCTGTGGGG + Intronic
1091324388 11:134674837-134674859 TAAGTATGATGTTAGCTGTGGGG - Intergenic
1091412159 12:250172-250194 TAAGTATGATGTTAGCTGTAGGG - Intronic
1091875208 12:3928112-3928134 TAAGTTTAAGATCTGCTTTTAGG + Intergenic
1092752436 12:11731103-11731125 TAAGTGTGAGCTTTGCTGTTAGG + Intronic
1093248928 12:16775598-16775620 TAAGTATGATGTTAGCTGTAAGG - Intergenic
1093360524 12:18221158-18221180 TAAGGATGAGGACTACAGTTTGG - Intronic
1094758995 12:33507082-33507104 TATCTATGAGCTCTGATGTTGGG - Intergenic
1094783088 12:33815398-33815420 TTAGTTTGAGGCCTGCTGGTAGG - Intergenic
1095726803 12:45462675-45462697 ATAGTTTGAGGTTTGCTGTTGGG - Intergenic
1097145288 12:56935668-56935690 TAAGCTTTAGGTCTGCTCTTTGG - Intergenic
1098447153 12:70577721-70577743 TAAGTATAAGGTATGCTTTGGGG - Intronic
1102113464 12:110383033-110383055 TCAGCATGGGGTCTGATGTTGGG - Intronic
1104995680 12:132653776-132653798 TAAGTATGAGGTCTGCTGTTAGG + Intronic
1106683868 13:32035985-32036007 TTAGTATGAGGTCAGCTCTGGGG + Intronic
1108097270 13:46916354-46916376 TAAGTATAATGTCAGCTGTAGGG + Intergenic
1111699472 13:91668104-91668126 TATGTATGAGGTCTCCTGGTTGG + Intronic
1112038593 13:95521294-95521316 TAAGTATAAGGTTTGCTTTGGGG + Intronic
1112795548 13:103052622-103052644 TAAGTATGATCTTTGCTTTTTGG + Exonic
1113754463 13:112801018-112801040 TAAGTATGACGTCAGCTGTAGGG - Intronic
1115101250 14:29703350-29703372 TAAATTTGAGGGCTGCTGTTTGG + Intronic
1116476705 14:45348531-45348553 AAAGTGTGAGGGCAGCTGTTTGG + Intergenic
1117794428 14:59377526-59377548 TAATAATGAGGTCTTCTGATGGG - Intergenic
1118090725 14:62474142-62474164 AAAGAATGAGGTCTGTAGTTTGG - Intergenic
1119092118 14:71793610-71793632 TAAGTAAGATGTTAGCTGTTGGG + Intergenic
1119575933 14:75722140-75722162 ACTGTATGAGTTCTGCTGTTTGG + Intronic
1123150137 14:106173118-106173140 AAAGGATGAGGTGTGCTGTAAGG + Intergenic
1123204309 14:106697493-106697515 AAAATATGAGGTGTGCTGTAAGG + Intergenic
1123584948 15:21751087-21751109 AAAGGATGAGGTGTGCTGTAAGG + Intergenic
1123621593 15:22193694-22193716 AAAGGATGAGGTGTGCTGTAAGG + Intergenic
1124138733 15:27058310-27058332 TAATTCTGAGCTCTGCTGTGCGG - Intronic
1124607669 15:31183338-31183360 TAAGTATGATGTTAGCTGTAGGG - Intergenic
1125430428 15:39588220-39588242 TAAGTGTGAGGTCCGCTGCAAGG + Intronic
1128531767 15:68456617-68456639 TAAGCATGAGGTTTGCAGTAAGG - Intergenic
1130035439 15:80356711-80356733 TAAGTATGAAGTTTGTTGTAGGG + Intronic
1131569472 15:93520175-93520197 TAACTCTAAGGTCTGCTCTTGGG - Intergenic
1131708887 15:95031053-95031075 TATTTAGGAGCTCTGCTGTTTGG - Intergenic
1131892604 15:96988649-96988671 TAAGTATGATGTTTGCTATGGGG + Intergenic
1137298044 16:47116113-47116135 TAAGTATGGTGTCAGCTGTAGGG + Intronic
1139414051 16:66792303-66792325 TAAGTATGATGTTTGCTGTAGGG - Intronic
1139694679 16:68665703-68665725 TCAGCATGAGGTGTGCTGTCTGG - Intronic
1140623438 16:76763866-76763888 TAAGTATGACGTTAGCTGTAGGG - Intergenic
1140690947 16:77483242-77483264 CAAGTAAGAGGCCTGCTCTTTGG - Intergenic
1141309029 16:82895165-82895187 TGAGTATGAGCTCTCCTTTTGGG - Intronic
1142793786 17:2291005-2291027 TAAGTATCAGGTCTCCTTTGGGG + Intronic
1145103938 17:20099229-20099251 TAAGTTTAAAGTGTGCTGTTGGG - Intronic
1147516545 17:41123395-41123417 TAAGGATGAGGTTTGCTTATGGG + Exonic
1147571251 17:41572346-41572368 TAAGTCTCAGACCTGCTGTTGGG - Intergenic
1148585489 17:48775926-48775948 TAAGTATGATGTTAGCTGTCAGG - Intronic
1152504648 17:80740794-80740816 TAAGTAAAAGGACGGCTGTTAGG - Intronic
1152593546 17:81226145-81226167 TAAGTATGATGTCAGCTGAGGGG + Intergenic
1153212054 18:2778165-2778187 TTAGTATTTGGTATGCTGTTAGG + Exonic
1155289993 18:24331194-24331216 GAAGTATGAGGCCTGCCCTTAGG + Intronic
1156338797 18:36191991-36192013 TAAGTATGATGTTAGCTGTGGGG - Intronic
1158000786 18:52616297-52616319 TAAGTATGAGATCTCCGTTTTGG + Intronic
1163226780 19:15967638-15967660 TAAGTATGATGTTAGCTGTAGGG - Intergenic
1163709454 19:18837617-18837639 AAAGTATGAGGTCTGTGGGTAGG + Intronic
1165853591 19:38866279-38866301 CAAGAAGGAGGTCTGCTGTTGGG + Intergenic
1166594956 19:44038185-44038207 TAATTAGGAGCTCTGATGTTTGG - Intergenic
1167079423 19:47269248-47269270 TAATTAAGAGGTCTAATGTTAGG + Intronic
1167803770 19:51764674-51764696 TGATTATGAGGTCTGCTATTTGG - Intronic
1167809904 19:51820433-51820455 TGATTATGAGGGCTGCTATTTGG - Intronic
1168569055 19:57449524-57449546 TAAGTATGAGGACTTCCGTCTGG + Intronic
925420361 2:3705165-3705187 TTAGTATGAGGGCTGGTGTATGG + Intronic
925574308 2:5344788-5344810 TAAGAATGAGATGTGCTATTTGG - Intergenic
929657703 2:43750586-43750608 TAAGAATAAGGCCTGATGTTAGG - Intronic
930674360 2:54184412-54184434 TAAGCAAGAGGTCTGCTGCTTGG - Intronic
932266526 2:70371940-70371962 TAAGTATGAAGTTTCCTTTTGGG - Intergenic
935037129 2:99388399-99388421 TAAGTATGATGTCAGCTGCAGGG + Intronic
936096901 2:109537156-109537178 TAAGTATGATGCTTGCTATTGGG + Intergenic
938222671 2:129584481-129584503 TAAGTATGATGTTAGCTGTGGGG - Intergenic
939138703 2:138327026-138327048 TAAGTATGATGTTAGCTGCTAGG - Intergenic
943540113 2:189203280-189203302 TAAGTTAGAGTTCTGGTGTTTGG - Intergenic
944162760 2:196683131-196683153 TAAGTATGATGTCAACTGTGGGG + Intronic
944520268 2:200558247-200558269 TAAATATGATGTCTGCTCTTGGG + Intronic
944965738 2:204930582-204930604 TAAGTAACAGGTCTGAAGTTAGG - Intronic
1169817903 20:9677868-9677890 TAGGTATTAGGCCTACTGTTAGG + Intronic
1170754097 20:19182705-19182727 TAAGTATGAGGTTTCTTTTTGGG - Intergenic
1171488230 20:25498800-25498822 TAAGCCTGAGGGCTGCTGTGGGG - Intronic
1171940643 20:31325777-31325799 TAATTATGTGCTCTGGTGTTGGG - Intergenic
1172098472 20:32472303-32472325 GAAGTCTGAGGCCTGCTGTAAGG - Intronic
1173595098 20:44253877-44253899 AAAGTATCAGGGCTGCTATTTGG - Intronic
1175032327 20:55968257-55968279 TGAGTATGAGGTTTCCTTTTGGG - Intergenic
1177621222 21:23597077-23597099 TAAGTATGATGTTTGCTTTTGGG - Intergenic
1178564121 21:33667705-33667727 TAAGTGGCAGGTCTGGTGTTTGG + Intronic
950606300 3:14084240-14084262 TAAGTCTGAACCCTGCTGTTAGG - Intergenic
950755592 3:15169124-15169146 TGAGTATGAGCCCTGCTGATTGG - Intergenic
951732966 3:25831144-25831166 TAACTGAGAGGTCTGCTGTCTGG - Intergenic
955262795 3:57410901-57410923 TAAGTATGATGTTAGCTGTAGGG - Intronic
957731953 3:84150853-84150875 TAAGTCACAGGTCTGTTGTTGGG + Intergenic
958921033 3:100105794-100105816 TGAGTATGAGGTATGCTATTTGG - Intronic
959029447 3:101281049-101281071 TCAGTATAAGGACTGCTCTTTGG - Intronic
962002911 3:131317864-131317886 TAAAAATGAGGTCTGCAGTAGGG - Intronic
964005345 3:151820450-151820472 CAAGTAAGAGCTGTGCTGTTTGG + Exonic
964628513 3:158783149-158783171 ACAGAAGGAGGTCTGCTGTTTGG + Intronic
965154534 3:165030840-165030862 TAAGTTTGAGATCTGCAATTAGG + Exonic
966106938 3:176347329-176347351 TGATTATGATGTTTGCTGTTGGG - Intergenic
970993677 4:22240374-22240396 TAAGAATGGTGTCTGCTCTTGGG + Intergenic
971285182 4:25282047-25282069 TAAGTACGATGTTTGCTGTTGGG - Intergenic
971658145 4:29376699-29376721 GCAGTATGAGTTCTGCTGTTTGG + Intergenic
971977165 4:33705236-33705258 TAAGTATGTTCTCTGATGTTAGG + Intergenic
973758850 4:54099710-54099732 GAAGTGTGAGGCCTGCGGTTTGG - Intronic
973873189 4:55187348-55187370 TAATTAAGAAGTCTGCTGATTGG + Intergenic
975048999 4:69836036-69836058 TAAATATGCAGTATGCTGTTTGG + Intronic
975567089 4:75768742-75768764 TAAGTATGATGTTAGCTGTAAGG + Intronic
978853918 4:113371209-113371231 TAAGAATGAGATCTGCTGCTAGG + Intronic
979835039 4:125355957-125355979 TAAGTAGCAGCCCTGCTGTTTGG + Intronic
981598676 4:146458342-146458364 TAGGTATGATGTCAGCTGTTTGG - Intronic
982625747 4:157764075-157764097 TAAGTATGAGATCAGCAGTGTGG + Intergenic
984701904 4:182823915-182823937 TAAGAAGGAGGTCTGCTTTGGGG - Intergenic
984734286 4:183096654-183096676 CAAGTTTGAACTCTGCTGTTCGG - Intergenic
986892540 5:12327005-12327027 TAATTATTAGGGCTGCTGTCAGG + Intergenic
988053804 5:26065507-26065529 TAAGTTTCAGGTCTGCTTTATGG + Intergenic
988612726 5:32742691-32742713 TAAGCATGATGTTTGCTGTGGGG + Intronic
989217020 5:38915855-38915877 TAAAAATGAGATGTGCTGTTAGG + Intronic
989461897 5:41709210-41709232 TAAGTATGATGTTAGCTGTAGGG + Intergenic
990858156 5:60295454-60295476 TAATTATGATGTGAGCTGTTGGG + Intronic
991140641 5:63237582-63237604 TAAGTATGATGTTTGCTGTGGGG - Intergenic
991274325 5:64825904-64825926 GAAGTCTGAGCTCTGCTCTTTGG - Intronic
992485840 5:77194228-77194250 TAAGTATGAGGCTTACTGTAGGG + Intergenic
997109315 5:131057584-131057606 TATTTATGGGGTCTGATGTTTGG - Intergenic
997387042 5:133481802-133481824 AAAGGAAGAGGTCTGCTGCTGGG + Intronic
998047432 5:138999770-138999792 TAAGTAGAAGATCTGTTGTTTGG + Intronic
998468602 5:142365424-142365446 CAAGTATGAGGTCAGCTCTTGGG - Intergenic
998670268 5:144345636-144345658 TAGGTAAGAGTCCTGCTGTTAGG + Intronic
999549230 5:152666539-152666561 TAAGGATGATGTCAGCTGTGGGG - Intergenic
1000170477 5:158698115-158698137 TAGGTATGAAGTCTGCATTTAGG + Exonic
1003198392 6:3935458-3935480 TTAGTATGAGGTTAGCTGTAGGG + Intergenic
1006487443 6:34355139-34355161 TAAGTATGATATTAGCTGTTTGG + Intronic
1007389587 6:41543215-41543237 TGAGTATCAGGCCTGCTGCTAGG + Intergenic
1009402042 6:63268403-63268425 TAGGTATGAGAACAGCTGTTTGG + Intergenic
1010180956 6:73086170-73086192 TTAATAAGAGGTCTGCTGGTTGG - Intronic
1010522188 6:76851066-76851088 TAAGTATGAAGTTTTCTTTTGGG - Intergenic
1011722895 6:90177370-90177392 TTAGTATGGGATCTGCTGTACGG - Intronic
1011800417 6:91007065-91007087 TAAATATGATGTTTGCTTTTAGG + Intergenic
1011924912 6:92630270-92630292 TAAGCATGATGTTAGCTGTTAGG + Intergenic
1012759730 6:103283378-103283400 TAAGTATGATGTTAGCTGTTGGG + Intergenic
1015096690 6:129423213-129423235 TAAGTATGATTTTAGCTGTTAGG - Intronic
1018302462 6:162418363-162418385 TGAGTATGAGGTTTTCTTTTGGG + Intronic
1021667632 7:23001844-23001866 TAAGTCAGAGGTTTTCTGTTTGG + Intronic
1022756017 7:33291095-33291117 TATTTATAAGGTCTGCTGTGAGG - Intronic
1026559090 7:71433231-71433253 TGAGTCTGGGCTCTGCTGTTTGG - Intronic
1028095441 7:86754911-86754933 TAAGTATGGGAGCTGCTGGTGGG - Intronic
1029930163 7:104362546-104362568 ACAGCATGAGGTTTGCTGTTAGG - Intronic
1030437774 7:109546855-109546877 CTAGTGTGAGGTCTTCTGTTAGG - Intergenic
1030592224 7:111495953-111495975 GAAGTCTGAGGGCTACTGTTGGG - Intronic
1032935479 7:136725902-136725924 TAAGTATGATGTTGGCTGTGGGG - Intergenic
1035149641 7:156858932-156858954 TAAGTATGATGTTAGCTGTGGGG - Intronic
1036698769 8:10997237-10997259 TATGTATAAGGTGTGTTGTTGGG - Intronic
1037598986 8:20377991-20378013 TAAGGATAAGGTTTGTTGTTTGG - Intergenic
1038526140 8:28275149-28275171 TAAGAATGCAGTCTGATGTTGGG + Intergenic
1038989384 8:32849943-32849965 TTAGTATGAGATTTGCTGTGGGG + Intergenic
1039962015 8:42255549-42255571 AAAGTATGAGGTTGGCTTTTTGG + Intergenic
1040530013 8:48259091-48259113 CAAGCCTGAGGTCAGCTGTTTGG - Intergenic
1040542756 8:48374588-48374610 AAAGTATGAGCTTTGGTGTTTGG + Intergenic
1040652951 8:49470035-49470057 TAAGTATGAGGTCAGCTGCAGGG - Intergenic
1042025614 8:64420517-64420539 TAAGGAGGAGGTCTGTTGGTTGG - Intergenic
1042366627 8:67944387-67944409 TAAGTATGATGTTAGCTGTAGGG - Intergenic
1042529325 8:69798390-69798412 GAAGTATGAAGGCTTCTGTTTGG + Intronic
1043349060 8:79337601-79337623 TAAGTAGGAAGACTGCTATTGGG + Intergenic
1045455482 8:102374805-102374827 TGAGTATAAGAACTGCTGTTGGG - Intronic
1049128377 8:140812854-140812876 TAATAATGAGTGCTGCTGTTTGG - Intronic
1049816442 8:144605074-144605096 TAAAGATGAGGTCTGTTGCTTGG - Intronic
1050740840 9:8818666-8818688 TAAGTATTTGGTCTGTTCTTAGG - Intronic
1055536783 9:77255105-77255127 TGAGTATGATGTCAGCTGTGGGG + Intronic
1055562926 9:77539122-77539144 TCAGTATGATGTCAGCTGTGAGG + Intronic
1056375455 9:86005367-86005389 TAAGTATGATGTTAGCTGTAAGG - Intronic
1058945682 9:109853840-109853862 TAAAGCTGAGCTCTGCTGTTTGG + Intronic
1062019613 9:134311998-134312020 TAAATATGATGTTTGCTGTCAGG + Intergenic
1062358445 9:136176154-136176176 GAAGAATGAGGTCTGCATTTTGG - Intergenic
1188564962 X:31516536-31516558 TTAATTTGAGGACTGCTGTTTGG + Intronic
1188689152 X:33107539-33107561 TAAGTATTAGTTCTGTTGGTTGG - Intronic
1188801417 X:34535899-34535921 TAAGTATGAAGTTTGCATTTTGG + Intergenic
1189566981 X:42252569-42252591 TAAGTATGATGTTAGCTGTAGGG - Intergenic
1189575300 X:42345058-42345080 TAAGTATGATGTCAGCTGTAAGG + Intergenic
1189670017 X:43398477-43398499 TAAGTATGATGTTAGCTGTGGGG - Intergenic
1191749835 X:64529971-64529993 TAAGTATGATGTTAGCTGTCAGG - Intergenic
1192700849 X:73470086-73470108 TTAGTATGATGTTTGCTGTGGGG + Intergenic
1192786038 X:74336396-74336418 TAAGTATAAGGGCTACTTTTGGG + Intergenic
1193561306 X:83020762-83020784 TGAGTATGAGGTTAGCTGTGGGG - Intergenic
1194785459 X:98078561-98078583 TAGGTATGTGGTCTGTTTTTGGG + Intergenic
1194840379 X:98733384-98733406 TGAGTATGAGGTTTCCTTTTTGG - Intergenic
1194893699 X:99412815-99412837 TAAGTATGGTGTTTACTGTTGGG + Intergenic
1195059646 X:101181895-101181917 TAAGTATGATATCAGCTGTTAGG + Intergenic
1195225367 X:102787074-102787096 TAATTATTAGGGATGCTGTTTGG - Intergenic
1195957692 X:110350327-110350349 TAAGTATGATGTTATCTGTTGGG - Intronic
1196371677 X:114986195-114986217 CAAGTGTGAGGTATGTTGTTTGG - Intergenic
1196536093 X:116846211-116846233 TAAAGATGAGGTTTGCTGTTTGG - Intergenic
1197568942 X:128125298-128125320 TGAGTATGATGTTAGCTGTTAGG - Intergenic
1199067328 X:143434804-143434826 TAATTATCAGGAATGCTGTTTGG - Intergenic
1199525559 X:148787732-148787754 TGATTATGAGGTTGGCTGTTTGG - Intronic
1199921735 X:152412733-152412755 TAGGTATGAGGTTTACTTTTGGG + Intronic
1201316370 Y:12650802-12650824 TAAGAATTAAGTTTGCTGTTTGG - Intergenic