ID: 1104998278

View in Genome Browser
Species Human (GRCh38)
Location 12:132672743-132672765
Sequence ACTCCTGCTCTTGCTTGTTG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 190}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104998275_1104998278 -8 Left 1104998275 12:132672728-132672750 CCGTCAGCTTATTGAACTCCTGC 0: 1
1: 0
2: 0
3: 17
4: 177
Right 1104998278 12:132672743-132672765 ACTCCTGCTCTTGCTTGTTGGGG 0: 1
1: 0
2: 2
3: 14
4: 190
1104998273_1104998278 10 Left 1104998273 12:132672710-132672732 CCAGCACGTGTCCGTCGTCCGTC 0: 1
1: 0
2: 0
3: 1
4: 15
Right 1104998278 12:132672743-132672765 ACTCCTGCTCTTGCTTGTTGGGG 0: 1
1: 0
2: 2
3: 14
4: 190
1104998271_1104998278 30 Left 1104998271 12:132672690-132672712 CCCGACGTAGGTCTCAGAGTCCA 0: 1
1: 0
2: 0
3: 5
4: 101
Right 1104998278 12:132672743-132672765 ACTCCTGCTCTTGCTTGTTGGGG 0: 1
1: 0
2: 2
3: 14
4: 190
1104998272_1104998278 29 Left 1104998272 12:132672691-132672713 CCGACGTAGGTCTCAGAGTCCAG 0: 1
1: 0
2: 0
3: 14
4: 249
Right 1104998278 12:132672743-132672765 ACTCCTGCTCTTGCTTGTTGGGG 0: 1
1: 0
2: 2
3: 14
4: 190
1104998274_1104998278 -1 Left 1104998274 12:132672721-132672743 CCGTCGTCCGTCAGCTTATTGAA 0: 1
1: 0
2: 0
3: 2
4: 34
Right 1104998278 12:132672743-132672765 ACTCCTGCTCTTGCTTGTTGGGG 0: 1
1: 0
2: 2
3: 14
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104998278 Original CRISPR ACTCCTGCTCTTGCTTGTTG GGG Exonic
900077449 1:828943-828965 ATTCCTCCTCTTGCTTTCTGAGG - Intergenic
900584438 1:3425719-3425741 TCTCGTGCTCGTGCTTCTTGAGG - Exonic
900608952 1:3536385-3536407 ACTCCAGCTCTTCCAGGTTGTGG - Intronic
900890776 1:5448245-5448267 ACTCTTGTTCTGGCTTCTTGGGG - Intergenic
900956205 1:5887791-5887813 TTTCCTGCTCTTGCTTCCTGTGG - Intronic
902253777 1:15174031-15174053 ACTGCTGCTTTCGCTTGCTGTGG - Intronic
903835601 1:26201378-26201400 ACTCCTGCTCCTGGTTGAAGCGG - Exonic
905422637 1:37859175-37859197 CCTCCTGGTCTTGTTTGTTTCGG - Intronic
905965059 1:42085711-42085733 ACTCCTGCTCTTGCTTTTCATGG - Intergenic
910215079 1:84835521-84835543 AATGCTGTTCTTGCTTGTTTTGG + Intronic
911794977 1:102064292-102064314 GTTCCTGCTTTAGCTTGTTGAGG - Intergenic
912035724 1:105310192-105310214 ACTTTAGCTTTTGCTTGTTGGGG + Intergenic
913087395 1:115451606-115451628 TCTCATGCCCATGCTTGTTGGGG - Intergenic
913171569 1:116237407-116237429 ACTCCTGCTCCTCCTTTTTCAGG + Intergenic
917683422 1:177391599-177391621 TCCCCTCCTCTTCCTTGTTGGGG - Intergenic
918570634 1:185987805-185987827 ACTGCTGCACTTGCTGGCTGTGG + Intronic
919686539 1:200488373-200488395 ACTCATGCTAATGCATGTTGAGG + Intergenic
924212304 1:241783102-241783124 AGCTCTTCTCTTGCTTGTTGGGG - Intronic
1062764759 10:52490-52512 ATTCCTGCTCTTGTTTTCTGAGG - Intergenic
1064288943 10:14015545-14015567 ACTCCTGCTTATCCTTGCTGTGG + Intronic
1068559625 10:58499032-58499054 ATTCCTCCTCTTGCTTTCTGAGG + Intergenic
1069432798 10:68352447-68352469 TCTCCTGCTCATGTTTGTTCTGG - Intronic
1072899364 10:99393759-99393781 ACACCTGCTCTGGGTTGTTGGGG - Exonic
1073114764 10:101085520-101085542 TCCCCTGCTCTGGCTTTTTGGGG + Intergenic
1073516082 10:104076725-104076747 ACACCTGCCCTTACCTGTTGAGG - Intronic
1077184231 11:1229183-1229205 ACTCCTGGTGCTGCATGTTGAGG - Exonic
1077407952 11:2391062-2391084 ACTCCTGCTCCTGCTCCTGGGGG - Intronic
1078434964 11:11316757-11316779 ATTCCTGCTCTCTCTTTTTGTGG + Intronic
1079609434 11:22413403-22413425 ACTCTTGCTCATGGTTGGTGGGG + Intergenic
1080312517 11:30911628-30911650 TCTCCTGCTCTTTCTGGCTGTGG + Intronic
1082167130 11:48962781-48962803 AATGCTGCTGTAGCTTGTTGTGG - Intergenic
1084417081 11:69038786-69038808 ATTCCTCCTCTTGCTTCCTGAGG - Intergenic
1086145168 11:83543834-83543856 ACTGCTGTTCTTGCTTGTAAGGG + Intronic
1087766781 11:102163830-102163852 ACCTCTGCTCTTGCTTTTGGTGG + Intronic
1089794665 11:120970595-120970617 TCTCCTGCTCATTCTTGTGGAGG + Intronic
1091106629 11:132925903-132925925 ACTCATTCTCTTGCTTATTCTGG + Intronic
1093679363 12:21983342-21983364 ATTCCTCCTCTTGCTTTCTGAGG - Intergenic
1094498540 12:31004303-31004325 ACTCCAGCTCTTTCTTCCTGGGG + Intergenic
1094814971 12:34173940-34173962 ATTCCTGCTCTTGTTTTCTGAGG - Intergenic
1096220613 12:49826386-49826408 ACTCCTGCTCCTGCTGGCTTGGG - Intronic
1097242218 12:57583347-57583369 ACTCCTGCTTTCCCCTGTTGGGG + Intronic
1100984228 12:100189416-100189438 GCTCCTGCTCCTGCTGCTTGGGG - Intergenic
1104187073 12:126443094-126443116 ATTCCTCCTCTTGCTTTCTGAGG - Intergenic
1104998278 12:132672743-132672765 ACTCCTGCTCTTGCTTGTTGGGG + Exonic
1105408568 13:20151234-20151256 AGTCCTGCTCTTGCCTGAGGAGG - Intronic
1106590193 13:31092023-31092045 AATCCTGCTCTTTCTTGAAGAGG + Intergenic
1110031199 13:70616237-70616259 ACTCCTGCTTTTAGTTGTTCAGG - Intergenic
1112109026 13:96274131-96274153 ACTCCCGCTCTTTCTTATTAAGG + Intronic
1113588919 13:111484549-111484571 GCTCCTGCTCTTCCTGCTTGTGG + Intergenic
1115701474 14:35957499-35957521 TCCCATGCTCTTGCTTGTTGAGG + Intergenic
1115951563 14:38727651-38727673 ACTCCAGCTCTAACTTGTTCAGG - Intergenic
1118642276 14:67803907-67803929 ATTCCTCCTCTTCCTTGGTGAGG - Intronic
1119432213 14:74575799-74575821 AGCCCTGCTCATGCTTTTTGAGG - Intronic
1120945517 14:89992001-89992023 ACTGCTGCTATTGCTTCTTTAGG + Intronic
1121317108 14:92968815-92968837 ACTCCTGCTCTGGCGTGGGGTGG + Intronic
1122899331 14:104775738-104775760 CCTCCTCCTCCTGCTTCTTGAGG + Exonic
1123627118 15:22235187-22235209 ACTCCTCCTCTTGCTTTCTGAGG + Intergenic
1124199318 15:27663857-27663879 ACTCCAGCTCTTTCTTTTTCTGG + Intergenic
1125416030 15:39453518-39453540 ACACCTGTTCTTGCCTGTTCAGG - Intergenic
1127614299 15:60668292-60668314 ACTCTTGCTCTTGATTTTTAAGG - Intronic
1128477301 15:68008206-68008228 ACTCCTGCTCTGGCATGTGAGGG + Intergenic
1131633637 15:94206640-94206662 CCTCCTGCTCTGGCTTGTGCAGG + Intergenic
1132194280 15:99898594-99898616 ACTCCTCCTCTAGCCTGTTCTGG + Intergenic
1132270132 15:100516886-100516908 AATCCTACTCTTGTTTGCTGAGG - Intronic
1132582048 16:689295-689317 ACAGCTGGTCCTGCTTGTTGCGG + Exonic
1134180349 16:12042928-12042950 GCTGCAGCTCGTGCTTGTTGAGG - Exonic
1134488677 16:14679119-14679141 ACTCCTGCTTTTTGTTATTGGGG + Intronic
1135675716 16:24413312-24413334 AGTACAGCTCTTGCGTGTTGTGG + Intergenic
1137924344 16:52525743-52525765 ACTCCCTCTCTTCCTTGTTATGG + Intronic
1138569545 16:57860671-57860693 ATTCCTCCTCTTGCTTTCTGAGG - Intronic
1138725411 16:59132840-59132862 ATTGCTGTTATTGCTTGTTGAGG + Intergenic
1138926882 16:61603212-61603234 AATCCTGCCCTTGCTTCCTGTGG - Intergenic
1140220456 16:73040100-73040122 AGGCCTACTCTTGCTTGTGGGGG - Intronic
1140604023 16:76512670-76512692 ACTCCTGCTGTTCCATCTTGTGG - Intronic
1140843599 16:78865437-78865459 GCTCCTTCTCTTCCTTGCTGAGG + Intronic
1141976846 16:87522200-87522222 ACTCCTCCTCTTGCTTTCTGAGG - Intergenic
1142665834 17:1463283-1463305 ACTCATTCTCTTTCTTGTGGAGG + Intergenic
1145795424 17:27652745-27652767 ACTACAGCTCTTCCTTGTTTGGG + Intergenic
1147430338 17:40366920-40366942 ACTCCTGCTTGTGTGTGTTGGGG + Intergenic
1147694467 17:42340863-42340885 GCTGCTGCTCTTGCTTATGGTGG - Intronic
1149088776 17:52752163-52752185 ATTCTTGCTCTTGCTTCTTCAGG + Intergenic
1152957668 18:52821-52843 ATTCCTGCTCTTGTTTTCTGAGG - Intronic
1155283124 18:24261318-24261340 ATTCCTTATCTTGATTGTTGTGG + Intronic
1156510466 18:37632235-37632257 AATCCTACCCTTGCTGGTTGTGG - Intergenic
1159726893 18:71972007-71972029 ACTCCTTCTCTTGCTGTGTGAGG - Intergenic
1161675740 19:5647560-5647582 ACTCCTGCTCTTACTTGGCATGG - Intronic
1163872458 19:19833583-19833605 ACACCTGGTCTTCCTTGGTGAGG + Intergenic
1163901454 19:20104349-20104371 ACACCTGGTCTTCCTTGGTGAGG + Exonic
1163910300 19:20184466-20184488 ACACCTGGTCTTCCTTGGTGAGG + Exonic
1163932449 19:20409824-20409846 ACACCTGGTCTTCCTTGGTGAGG - Intergenic
1163936627 19:20451366-20451388 ACACCTGGTCTTCCTTGGTGAGG + Intergenic
1165717748 19:38057517-38057539 ACTCCTGGTGTTGCTCATTGAGG + Intronic
1167604931 19:50476577-50476599 GCTCCTGCTCTTGCTGATGGCGG + Exonic
925858186 2:8150532-8150554 CCTCCTGGTCTTACTTTTTGGGG + Intergenic
928403553 2:30996725-30996747 GCTGCTGCTCTGGCTTGCTGGGG - Intronic
936268124 2:111026840-111026862 ATTCCTCCTCTTGCTTTCTGAGG - Intronic
939035073 2:137121238-137121260 TCTCCTGCTCTTGTTTAATGAGG - Intronic
940661300 2:156548386-156548408 ACTCCTTATTTTGCATGTTGAGG + Intronic
941032846 2:160532633-160532655 TCTCCTTCTCCTGGTTGTTGTGG + Intergenic
941151008 2:161915686-161915708 GTTCCTGCACTTGCTTGTTCTGG + Intronic
941910203 2:170757290-170757312 AATCCTGATCTTGCTGGGTGTGG - Intergenic
942592393 2:177560045-177560067 ACTACTGCACTTGTTTTTTGAGG + Intergenic
943064490 2:183071854-183071876 ACTCCAGCTCTACCTTGTTCAGG + Intergenic
946037965 2:216759079-216759101 GCTCCAGCTCTTCCTTGGTGAGG + Intergenic
946103090 2:217343866-217343888 ACTCCTGCTCTGGGTATTTGGGG + Intronic
947054035 2:226079969-226079991 ACTCCTGCTTATGCTATTTGTGG - Intergenic
947546492 2:231014374-231014396 ATTCCTCCTCTTGCTTTCTGAGG + Intronic
947702512 2:232246346-232246368 GCTCCAGCTCTTGCTTGTGCTGG - Intronic
1171900107 20:30848395-30848417 ATTCCTGCTCTTGTTTTCTGAGG + Intergenic
1173452700 20:43179226-43179248 ACTCTTGGTTTTGGTTGTTGTGG - Intronic
1173969081 20:47137156-47137178 ACTTATGCTGTTGCTTGTTTAGG + Intronic
1175006092 20:55684909-55684931 ACTCCTGCTTCTGCGTGATGTGG + Intergenic
1178455924 21:32751084-32751106 ACCCTTGCTCTGGCTTGTTTGGG - Intronic
1179052162 21:37897243-37897265 ACTCCTCCCCTTGCTTAGTGTGG + Intronic
1180007916 21:45031772-45031794 ACTCCGGCTCCTGCTGGGTGGGG - Intergenic
1183146332 22:35995889-35995911 CCTCCTCCTCCTGCTTCTTGAGG + Intronic
1183185960 22:36291824-36291846 CCTCAGGCTCTGGCTTGTTGAGG - Intronic
953799306 3:46009761-46009783 ATTCCTCCTCTTGCTTTCTGAGG - Intergenic
954490697 3:50901737-50901759 CCTCTTGCTCTTGCTGGGTGAGG + Intronic
955083888 3:55683569-55683591 ATTACTGCTCTGCCTTGTTGGGG - Intronic
957088326 3:75704178-75704200 ACTCCTGCTCTTGTTTTCTGAGG + Intergenic
964752008 3:160061585-160061607 ACTCCTCCCCTTGCTTGTTGTGG + Intergenic
964775880 3:160276522-160276544 ACTCCTGATGTAGTTTGTTGTGG - Intronic
966137552 3:176716717-176716739 TGTCCTGCTATTTCTTGTTGTGG - Intergenic
968357068 3:198117368-198117390 ATTCCTGCTCTTGTTTTCTGAGG + Intergenic
968628024 4:1636870-1636892 ATTCCTGCTCTTGCTGGGGGGGG + Intronic
972463648 4:39330537-39330559 ACTCCTGGTCTAGCTGATTGTGG - Intronic
975070174 4:70125726-70125748 AATCTTGCTCTTGCATGATGTGG - Intergenic
976437823 4:85039055-85039077 ACTCCTGATCTTCATTTTTGGGG + Intergenic
979486142 4:121272456-121272478 ATTCCTCCTCTTGCTTTCTGAGG + Intergenic
980008932 4:127574726-127574748 ACTCCTGATCTTTCTTGTTCTGG - Intergenic
981433611 4:144692348-144692370 CCTCCTATTCTTGCTGGTTGTGG - Intronic
982179750 4:152738842-152738864 ACTCCTGCTAGTGCTTCTAGGGG + Intronic
984192250 4:176619898-176619920 ACTGCTGCTCTTCCCTTTTGTGG - Intergenic
985442596 4:189994224-189994246 ATTCCTGCTCTTGTTTGCTGAGG - Intergenic
988183374 5:27827584-27827606 CCTCCTGAGCTTGGTTGTTGGGG - Intergenic
988959408 5:36354650-36354672 CCTCCTGCTCTTCCTTCTAGTGG + Intergenic
990702005 5:58484089-58484111 ACTCATCCACGTGCTTGTTGTGG + Intergenic
991297815 5:65100312-65100334 ATTCCTCCTCTTGCTTTCTGAGG - Intergenic
994254443 5:97576798-97576820 TCTCCTTCTCTTGCTTGTCACGG - Intergenic
996096003 5:119399957-119399979 ACTTCTGCTCTTGCAATTTGGGG - Intergenic
997498664 5:134353396-134353418 ACTACTGCTCTTCCTAGTTCAGG + Intronic
1002278371 5:178117227-178117249 ACTCCTGTTGCTGCTTCTTGGGG - Intronic
1004216705 6:13711067-13711089 ACTCCTTCTCCTGCTCGTTCAGG + Exonic
1007658742 6:43469227-43469249 AATCCTGCCCCTGCTTGTTCTGG + Intergenic
1007766996 6:44166542-44166564 CCTCCTGCTCTTGCTTCTGGGGG + Intronic
1008543343 6:52564634-52564656 ACTGCTGCTCTTGTGTGTGGTGG - Intronic
1011310007 6:85971427-85971449 ACTCCAGCTCTTGCATTTTTTGG + Intergenic
1011713045 6:90074370-90074392 ACTTTTGTTCTGGCTTGTTGAGG - Intronic
1011754740 6:90486954-90486976 ACTCCAGCCCCTGCTTGGTGTGG + Intergenic
1018552215 6:165010782-165010804 ATTCCTGCTCTTGCTTTCTGAGG - Intergenic
1019235809 6:170611401-170611423 ATTCCTCCTCTTGCTTTCTGAGG + Intergenic
1019460015 7:1152944-1152966 GCTGCTGATCTTGTTTGTTGAGG - Exonic
1022757905 7:33313765-33313787 AATCCAGCTCTTGATTATTGAGG + Intronic
1024311264 7:47971405-47971427 ACTCCTGCTCTTGCTGCCCGGGG + Intronic
1024605934 7:51022642-51022664 TCTCCTCCGCTTGCTGGTTGTGG + Intronic
1026319860 7:69259024-69259046 ACTCCTGCACATTCTTGCTGTGG - Intergenic
1028114719 7:86984013-86984035 ACCCCTGCTTTTTGTTGTTGTGG - Intronic
1028783468 7:94764706-94764728 ACTTATCCTCTTGCTTCTTGTGG - Intergenic
1029173759 7:98649142-98649164 ATTCCTTCTCTTGCTTCCTGAGG + Intergenic
1029362494 7:100097650-100097672 ACTGCTGCTCCTGCTAGTCGGGG - Exonic
1029903304 7:104065446-104065468 TCTCCTGCTCTTTCTTTTTATGG - Intergenic
1029918098 7:104232419-104232441 CCTCCTGATCTTCATTGTTGAGG - Intergenic
1030791219 7:113731455-113731477 ATTCCTACTCTTGCTTGTTGAGG - Intergenic
1033681843 7:143602886-143602908 ACTCCTGCCGCTGCTGGTTGCGG - Intergenic
1033703046 7:143859027-143859049 ACTCCTGCCGCTGCTGGTTGCGG + Exonic
1034303060 7:150033053-150033075 CCTCCTGGTCTTGATTGTTGGGG - Intergenic
1034802988 7:154064215-154064237 CCTCCTGGTCTTGATTGTTGGGG + Intronic
1035812326 8:2503295-2503317 TCTCCTGCACTGCCTTGTTGGGG - Intergenic
1036818890 8:11923426-11923448 GTTCCTGTTCTTGCTTGTGGTGG - Intergenic
1037113783 8:15198845-15198867 CTTCCTGCGCTTTCTTGTTGAGG + Intronic
1037364907 8:18111332-18111354 ACTCCTACTCTTTCTTGGTTTGG + Intergenic
1037558150 8:20046590-20046612 ATTCCTGCTTTTACTTGTTTGGG + Intergenic
1038149407 8:24928979-24929001 ATTCCTCCTCTTGCTTTCTGAGG + Intergenic
1038309079 8:26431499-26431521 ACTCCTGCTCTTGTCTAGTGGGG + Intronic
1039474847 8:37834207-37834229 TCTGCTGCTCTTGCTAGCTGGGG - Intronic
1039619252 8:38981572-38981594 ACTCCTTCTTCTGCTTGTTCTGG + Intronic
1040303401 8:46199800-46199822 AGCCCTGTTTTTGCTTGTTGAGG - Intergenic
1040333085 8:46402195-46402217 GGTCCTGTTTTTGCTTGTTGGGG - Intergenic
1041485205 8:58369061-58369083 TCACCTGCTCTTGCTTGTTTTGG - Intergenic
1041632419 8:60103195-60103217 GCTCCAGCTCTTGCTGGTTTTGG + Intergenic
1043530753 8:81147377-81147399 GTTCCTGCTCTTGGCTGTTGGGG - Intergenic
1045186741 8:99845724-99845746 ACTCCTGCTCTAGATAGCTGTGG - Intronic
1045589184 8:103574441-103574463 ACTCCTGCTCTAGTTTATTATGG + Intronic
1047578003 8:126179625-126179647 ACTCCTTCCCTGCCTTGTTGTGG - Intergenic
1048110557 8:131463382-131463404 ACTCCTACTCTTGCTAGTCTAGG - Intergenic
1049657648 8:143805801-143805823 ACTGCTGCTCCTGGGTGTTGGGG - Intronic
1049870646 8:144972833-144972855 ACTCCTGCACATACATGTTGGGG - Intergenic
1050640841 9:7666006-7666028 ACCCATGCAGTTGCTTGTTGTGG + Intergenic
1051993922 9:23190360-23190382 ACTCCTGCTTTTGCTTTTTCTGG - Intergenic
1054196664 9:62038754-62038776 ATTCCTGTTCTTGCTTTCTGAGG + Intergenic
1054641741 9:67549931-67549953 ATTCCTGTTCTTGCTTTCTGAGG - Intergenic
1054929712 9:70623391-70623413 ACTGCTGCTCTAGCTGGTAGTGG - Intronic
1056221218 9:84452206-84452228 AATTCTGTTCTTGCTTTTTGAGG - Intergenic
1060151130 9:121289108-121289130 GTTCCTGCTGTTGCTTGCTGGGG - Intronic
1060328938 9:122646527-122646549 ACTCCTGCTCTTTTTTTTTTTGG - Intergenic
1062653585 9:137590606-137590628 CCTCCTCCTATTGGTTGTTGCGG - Intergenic
1062740480 9:138171774-138171796 ATTCCTGCTCTTGTTTTCTGAGG + Intergenic
1185877103 X:3710763-3710785 ACTCCTGCGGGTGCTTGTTTGGG + Intronic
1185877867 X:3714227-3714249 ACTCCTGCGGGTGCTTGTTTGGG + Intergenic
1192626796 X:72737189-72737211 ATCCCTGCTCTTGTTGGTTGAGG - Intergenic
1192858258 X:75037437-75037459 ATTCCTGCTCTTTTTTTTTGGGG + Intergenic
1193396700 X:80991651-80991673 ACTGTGGTTCTTGCTTGTTGAGG - Intergenic
1196268019 X:113675826-113675848 ATTCCTGCTCTTGCATTTTAAGG + Intergenic
1197516783 X:127442083-127442105 TCTCCTGCTGTTTCTTTTTGGGG - Intergenic
1197563934 X:128057745-128057767 AATAATGTTCTTGCTTGTTGTGG + Intergenic
1198667268 X:139038222-139038244 ACCCCTGCTGTTGCTTGTCCTGG + Intronic