ID: 1105000341

View in Genome Browser
Species Human (GRCh38)
Location 12:132686844-132686866
Sequence GGGCCGGGGACCCTGCCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 452
Summary {0: 1, 1: 0, 2: 0, 3: 56, 4: 395}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105000341_1105000362 21 Left 1105000341 12:132686844-132686866 CCCCCAGGCAGGGTCCCCGGCCC 0: 1
1: 0
2: 0
3: 56
4: 395
Right 1105000362 12:132686888-132686910 CAGCCGCGCGTCCACCCCGCAGG 0: 1
1: 0
2: 0
3: 6
4: 108
1105000341_1105000365 27 Left 1105000341 12:132686844-132686866 CCCCCAGGCAGGGTCCCCGGCCC 0: 1
1: 0
2: 0
3: 56
4: 395
Right 1105000365 12:132686894-132686916 CGCGTCCACCCCGCAGGGCCTGG 0: 1
1: 0
2: 2
3: 24
4: 177
1105000341_1105000363 22 Left 1105000341 12:132686844-132686866 CCCCCAGGCAGGGTCCCCGGCCC 0: 1
1: 0
2: 0
3: 56
4: 395
Right 1105000363 12:132686889-132686911 AGCCGCGCGTCCACCCCGCAGGG 0: 1
1: 0
2: 0
3: 4
4: 52

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105000341 Original CRISPR GGGCCGGGGACCCTGCCTGG GGG (reversed) Intronic
900131953 1:1091046-1091068 GGACCTGGGCCCCTCCCTGGCGG - Intronic
900138932 1:1130976-1130998 GAGCCGGGGACCCTGCGGCGAGG - Intergenic
900158928 1:1214245-1214267 AGGCCGGGGACCCTGGCTGTGGG + Intergenic
900213084 1:1467057-1467079 GGGCCTGGGACCTTGCCACGTGG + Intronic
900225625 1:1532482-1532504 GGGCCTGGGACCTTGCCACGTGG + Intronic
900389538 1:2427973-2427995 GGGCAGAGGTCCCTGCCTAGAGG + Intronic
900533101 1:3164424-3164446 AGGCGGGGGACCCTGCCAGGAGG + Intronic
900629236 1:3624985-3625007 GGGCCGGGGGCGCGGCCGGGTGG + Exonic
900706805 1:4086090-4086112 GGGCTGGGGCTCCTCCCTGGGGG - Intergenic
901640540 1:10690905-10690927 GGGCCTGGGAATCAGCCTGGTGG + Intronic
901664993 1:10820775-10820797 GGGCTGGGGACGGGGCCTGGGGG + Intergenic
902072107 1:13749206-13749228 GGGCCGGGAGCCCTTCCTGCCGG + Intronic
902440412 1:16425688-16425710 GCTCCTGGGACCCTTCCTGGGGG + Intronic
902509917 1:16960952-16960974 GGGCCGGGCACAAGGCCTGGAGG + Exonic
903280647 1:22248085-22248107 GGCCCAGGCACCCTGACTGGGGG + Intergenic
903808630 1:26022336-26022358 GGGCAGGGGTCCCTGCTGGGAGG + Exonic
903886328 1:26543068-26543090 GGGCCAGAGACCCTGCCTTCTGG + Intronic
903996090 1:27306386-27306408 GGGCTGGGGACCAGGGCTGGAGG - Exonic
904205995 1:28855579-28855601 GAGCCCGGGGCCCTACCTGGCGG + Intronic
905515454 1:38558917-38558939 GGGCTGGGTAACCTGCCTGGGGG - Intergenic
905692796 1:39955390-39955412 GGGCCCGGCACCCCGCGTGGAGG + Intronic
906306534 1:44723632-44723654 AAGCCTGGCACCCTGCCTGGTGG + Intronic
907263305 1:53238314-53238336 GGAGCGGGGACCAGGCCTGGGGG - Intronic
907425879 1:54379016-54379038 GGGGCGGGGACCTGGCCAGGCGG - Intronic
907489125 1:54797873-54797895 GGGGCTGGGACCCTCCCAGGTGG - Intronic
908796290 1:67833554-67833576 GGGCCGGGGAGCCCGCGTTGTGG + Intergenic
910771469 1:90836096-90836118 CGGCCGCGGACCCTGGATGGTGG - Intergenic
910930966 1:92442212-92442234 TGGGTGGGGCCCCTGCCTGGCGG + Intergenic
911188698 1:94927282-94927304 GGGCCGGGGACCTCGCGGGGAGG - Intergenic
913501507 1:119476404-119476426 TGGCCTGGGAGCCTGCCTGTCGG - Intergenic
915073086 1:153288501-153288523 GTGCTGGGGCCCCAGCCTGGAGG + Intergenic
915580218 1:156808921-156808943 TGGAGGGGCACCCTGCCTGGGGG + Intronic
916802889 1:168231092-168231114 TTTCCTGGGACCCTGCCTGGTGG + Intronic
919356870 1:196536009-196536031 GGGCATGTGTCCCTGCCTGGAGG - Intronic
919981142 1:202643581-202643603 GGGGCGGGGGCCCTGCGTCGTGG - Intronic
922030216 1:221790436-221790458 GGGGAGGGGCCCCTGCATGGTGG - Intergenic
922416549 1:225427837-225427859 GGGCCGGGGACCCTGGGCGCGGG - Intronic
922505104 1:226121709-226121731 GGGCCGGGGACCCTGCACTTTGG + Intergenic
922950914 1:229558251-229558273 GGGCAGGGGACGAGGCCTGGCGG - Exonic
923595942 1:235361039-235361061 GGCCCGGGGCCCCTGCCCTGTGG + Intergenic
923684209 1:236142644-236142666 GGGCCGGGGGCGCTGCCGCGCGG - Exonic
1063902805 10:10752199-10752221 GGTCCGTGGACACTACCTGGAGG + Intergenic
1064015146 10:11765796-11765818 GGGCCGGGAAGCCAGACTGGAGG - Intergenic
1064096720 10:12429278-12429300 GGTCAGGGGAGACTGCCTGGAGG - Intronic
1064384449 10:14878469-14878491 GAGCCGGGGACGCTGCCTGTCGG - Intergenic
1064508128 10:16056134-16056156 GGGCTGGGGAAGATGCCTGGTGG + Intergenic
1065971132 10:30806754-30806776 GGGCCTTGGGCCCTGCCAGGAGG + Intergenic
1069716781 10:70526181-70526203 GGGCGGGGGGACCTGCTTGGGGG + Intronic
1069729671 10:70602599-70602621 GGGCCTGGGGCCCTGGGTGGAGG - Intronic
1069817860 10:71210008-71210030 TGGGCAGGGTCCCTGCCTGGGGG - Intergenic
1070658213 10:78285739-78285761 GGGCAGGGGGCACAGCCTGGTGG + Intergenic
1070697679 10:78574889-78574911 CAGCTGGGGACCCTGCCTAGGGG - Intergenic
1070954192 10:80454046-80454068 GGGCCGGCGACCCGGCCTCGCGG + Intergenic
1072591568 10:96832565-96832587 GAGCAGGGGAGCCCGCCTGGAGG - Intronic
1073064382 10:100749672-100749694 GGGCCGCGGACCCTGACTAATGG + Intronic
1073249829 10:102114650-102114672 GGGCCAGGGGGCCGGCCTGGGGG + Intronic
1074160600 10:110833698-110833720 GGGGAGGGGAGTCTGCCTGGGGG - Intronic
1075834589 10:125442975-125442997 GGGCCCAGCACCCTGGCTGGTGG + Intergenic
1076028836 10:127140924-127140946 GTGCCTGGGGGCCTGCCTGGTGG + Intronic
1076149345 10:128150045-128150067 GGGCCGGGGACACAGGCTGGGGG - Intergenic
1076386906 10:130063637-130063659 GTGCCGAGGACACTCCCTGGAGG + Intergenic
1076531481 10:131147961-131147983 GGGCCTGGGGCCCTGCATGTTGG + Intronic
1076684315 10:132190222-132190244 GGGGTGGGGACCATGCCTGTGGG + Intronic
1076737414 10:132465055-132465077 GGGCTGGGGACCCTACCAGGGGG - Intergenic
1076815587 10:132913282-132913304 GGGCTGGGGACCCTGCATTAAGG - Intronic
1076873483 10:133204896-133204918 GGGCAGGGGCACCTGGCTGGGGG - Intronic
1076916176 10:133424004-133424026 GGGCGGGGGAGCAAGCCTGGGGG + Intronic
1076936284 10:133568799-133568821 GGGCGGGGGAGCAAGCCTGGGGG + Intronic
1077109179 11:854554-854576 GGTCCAGGGCCCCAGCCTGGAGG + Intronic
1077166299 11:1140983-1141005 GGGCTGGGCACCCACCCTGGTGG + Intergenic
1077297909 11:1834687-1834709 GGACCCTGGGCCCTGCCTGGGGG - Intronic
1077305352 11:1866493-1866515 CAGCCGGAGACCCTGCCAGGTGG - Exonic
1077491087 11:2861389-2861411 GGGCCCCGGACCCAGCCTGAGGG - Intergenic
1077522190 11:3043060-3043082 TGGCAGGGGTCTCTGCCTGGAGG - Intronic
1078509751 11:11976593-11976615 GGGTCGGGGCCCCAGCCAGGGGG + Intronic
1078565467 11:12410366-12410388 GGCCCGGAGTCCCTGCCGGGGGG - Intronic
1081709064 11:45205425-45205447 GTGCGAGGGACTCTGCCTGGTGG + Intronic
1083033564 11:59615757-59615779 GGGGCGGGGACGCTGCGCGGCGG - Exonic
1083267427 11:61553275-61553297 GGGGCGGGGCTCCTGCCTGAGGG - Intronic
1083572585 11:63768438-63768460 GGGCGGGGGCCCCGGCGTGGGGG - Intronic
1083618197 11:64036488-64036510 GGGCCAGGCCCCCTCCCTGGGGG - Intronic
1083731880 11:64656688-64656710 TGGCCTGGGCCCCTCCCTGGAGG - Intronic
1083812118 11:65112020-65112042 GGCCCGGGGGCCCTGAGTGGGGG - Exonic
1083886139 11:65574337-65574359 GGGCTGGGGGCGCTGCCTGCTGG + Intergenic
1083888869 11:65585834-65585856 AAGCTGGGGACCCTGCCTGGTGG - Intronic
1084086178 11:66856425-66856447 GGGGCGGGGCGCCTGCCCGGAGG + Intronic
1084214361 11:67639518-67639540 GGGGCTGGGAACCTGCCTGCTGG + Exonic
1084575675 11:69986443-69986465 GCGCAGGGGCCCCTGCCCGGCGG - Intergenic
1084594333 11:70107998-70108020 GTGCCACGTACCCTGCCTGGTGG - Intronic
1084607246 11:70179556-70179578 GTGCCAGGGCCCCTGGCTGGAGG - Intronic
1085182023 11:74544013-74544035 GGGCATGTGTCCCTGCCTGGAGG + Intronic
1085470234 11:76752955-76752977 GGGCCGGGCTGCCTGCCTGCTGG + Intergenic
1088389926 11:109302900-109302922 GGGGCAGGGAAACTGCCTGGAGG - Intergenic
1089459589 11:118644780-118644802 CAGCCTGGGACCCTGCCTGCAGG - Intronic
1089508329 11:118979673-118979695 GTGCCGGGGGCCCTGCGAGGAGG + Intronic
1090636838 11:128694726-128694748 GGGCTCGGGTCCCTGCCTGGTGG + Intronic
1091044709 11:132315380-132315402 AGGCCCAGGGCCCTGCCTGGTGG - Intronic
1091703134 12:2677277-2677299 GGGACCGGGACCCTGACTGGAGG - Intronic
1092285206 12:7124646-7124668 GGGCTGGAGACACTGGCTGGAGG - Exonic
1093230320 12:16535720-16535742 GGGCAGAGTAGCCTGCCTGGTGG - Intronic
1096229549 12:49889445-49889467 GGCCAGGGGTCCCTGCCTGCAGG + Intronic
1097981712 12:65742445-65742467 GGGCCGGGGGCGCTCCCCGGCGG + Intergenic
1102214954 12:111154377-111154399 TGGCCTGGGCTCCTGCCTGGTGG - Intronic
1102465741 12:113130038-113130060 GGGGTGGGGAGCCTGCCTGGGGG - Intronic
1102511856 12:113421342-113421364 GGGCTGGGGAGGCTTCCTGGAGG - Intronic
1102569053 12:113816248-113816270 GGGCCGGGCCCCCTGCATGTGGG + Intergenic
1102735353 12:115154253-115154275 GGGCCTGCGAGCCTGCCTGTGGG + Intergenic
1103595340 12:122021779-122021801 GGCCCGGGGGCGCTGCCCGGTGG + Exonic
1104012201 12:124939809-124939831 GCGCCGGGCACCCTGGCTGCTGG + Intergenic
1104930415 12:132336589-132336611 GGGCCCGGGACCCCGACTGGAGG + Intergenic
1105000341 12:132686844-132686866 GGGCCGGGGACCCTGCCTGGGGG - Intronic
1105900060 13:24745989-24746011 GGGCTGGGGACCCTGCGCGCCGG - Intergenic
1106096005 13:26644430-26644452 GGGGCTGGGAACCTGCCTAGTGG + Intronic
1107078295 13:36346715-36346737 CCGCAGGGGACCGTGCCTGGGGG - Exonic
1110318256 13:74134498-74134520 GCGCCGCGGACCCAGCCCGGCGG - Intergenic
1112344040 13:98576354-98576376 GGTCCCGGGGCCCTGCGTGGTGG - Intronic
1113568486 13:111336253-111336275 GGGCAGTGGGCCCTGCCTTGGGG + Intronic
1113855843 13:113445081-113445103 GGGCTGGGGATGCTGCTTGGTGG - Intronic
1113902626 13:113805205-113805227 TGGCCGGGGACCGCGCCAGGTGG + Intronic
1114278630 14:21169880-21169902 GAGCTGGGGGCCCTGCCTAGTGG - Intergenic
1114627045 14:24136603-24136625 GGCCCCGGGACCCTCCCTGAGGG - Intronic
1117452476 14:55865153-55865175 GAGCTGGCGGCCCTGCCTGGTGG + Intergenic
1118590195 14:67395326-67395348 GGGCAGGGGACCCTGCCCCTTGG - Intronic
1118621726 14:67620109-67620131 GGGCGGAGGATCCTGCCCGGCGG - Intronic
1122156090 14:99751268-99751290 GGGCAGGGCAGCCTTCCTGGAGG + Intronic
1122285448 14:100649066-100649088 GGGGTGGGGATCCTGCCTGTTGG - Intergenic
1122348417 14:101074260-101074282 GGCCCGGGGACCTGGCCTGATGG + Intergenic
1122633848 14:103121295-103121317 GAGCAGGGGGCTCTGCCTGGTGG - Intergenic
1122689915 14:103527396-103527418 GGGCTGAGGAGGCTGCCTGGAGG + Intergenic
1122809812 14:104282313-104282335 GTGCTGGGGACACTTCCTGGGGG + Intergenic
1122848061 14:104511439-104511461 TGGCCCGGACCCCTGCCTGGAGG - Intronic
1122880737 14:104689516-104689538 GGGCCGGGGGCGGGGCCTGGGGG - Intergenic
1122920167 14:104876673-104876695 CGGCCTGAGACCCTGCCAGGGGG - Intronic
1124201397 15:27681446-27681468 GAGGAGGGGACCCTCCCTGGGGG - Intergenic
1124389641 15:29242644-29242666 GGGCCTGGCACCATTCCTGGAGG - Intronic
1124484663 15:30103816-30103838 CGGCCGGGGGCCCCGCCTGGTGG + Intergenic
1124518918 15:30393422-30393444 CGGCCGGGGGCCCCGCCTGGTGG - Exonic
1124539738 15:30572824-30572846 CGGCCGGGGGCCCCGCCTGGTGG + Intergenic
1124758914 15:32434758-32434780 CGGCCGGGGGCCCCGCCTGGTGG - Intergenic
1125478372 15:40063000-40063022 GGCCCGTGGGCCCTGGCTGGAGG - Intergenic
1125536290 15:40442304-40442326 GGGCCGGGGCGCCCGCCGGGAGG + Intronic
1125538699 15:40457592-40457614 GAGATGGGGACCCTGCCTGCTGG - Intronic
1128053303 15:64682069-64682091 GGGTGGGGGTCCCTCCCTGGTGG - Exonic
1128992523 15:72272583-72272605 GGGGCGGGGGCCGGGCCTGGCGG + Exonic
1129697034 15:77746618-77746640 GGGCGAGGAGCCCTGCCTGGAGG + Intronic
1132185148 15:99797348-99797370 GGGCCGTGAACTCAGCCTGGAGG - Intergenic
1132330997 15:101012628-101012650 GGCCTGGGCACTCTGCCTGGGGG - Intronic
1132431840 15:101767207-101767229 GGGCCGTGAACTCAGCCTGGAGG + Intergenic
1132457804 16:33753-33775 GGGCTGGTGCTCCTGCCTGGAGG - Intergenic
1132553661 16:563734-563756 GGGGCCGGGACCCTTCCGGGTGG - Exonic
1132712615 16:1276291-1276313 GGGCCGGGGACCCCACCAAGGGG - Intergenic
1132799571 16:1745224-1745246 AGGCCGGGGACCCAGCGTGGAGG + Intronic
1132831434 16:1930154-1930176 GGGCCGCAGACGCTTCCTGGTGG + Intergenic
1132850684 16:2023680-2023702 TGGCCTGGGGCCCTGTCTGGGGG - Intergenic
1132933693 16:2471016-2471038 GGGCCCAGGACCCTGCTGGGTGG + Intergenic
1132942352 16:2514415-2514437 GGGCCGGCGGCCCTGCCAGCCGG + Intronic
1133240575 16:4411988-4412010 GGGCTGGGGAGGATGCCTGGTGG + Intronic
1133403885 16:5508051-5508073 GGGCCGGGGACTGTCCATGGGGG - Intergenic
1134550344 16:15135957-15135979 GCGCCGGGCACCCCGGCTGGTGG + Intronic
1134690046 16:16185099-16185121 GGGCGGGGGATGGTGCCTGGGGG - Intronic
1135651012 16:24206659-24206681 GGGCCAGGAACTCTGTCTGGAGG - Intronic
1136136407 16:28259188-28259210 GAGCCGGGGGCTCTGTCTGGCGG - Intergenic
1136704913 16:32179171-32179193 GGCCTGGGGACCCAACCTGGGGG - Intergenic
1136763001 16:32750236-32750258 GGCCTGGGGACCCAACCTGGGGG + Intergenic
1136805099 16:33120150-33120172 GGCCTGGGGACCCAACCTGGGGG - Intergenic
1137787740 16:51151838-51151860 GGGCTGGGGACCCGGGCTGCCGG + Intergenic
1138178709 16:54928794-54928816 GGGCCGCGGACGCTCCCTCGTGG + Intergenic
1139348929 16:66323140-66323162 GGCCTGGGGCCCCTGTCTGGAGG - Intergenic
1140469903 16:75208069-75208091 GGGCCTAGGGCCCGGCCTGGGGG + Intergenic
1140478700 16:75251342-75251364 GGGCCGCGGACCCCGGCCGGCGG + Intronic
1141687613 16:85579257-85579279 GGGGCGGGGCTTCTGCCTGGAGG + Intergenic
1141753073 16:85972373-85972395 GGGCAGGGGACCCTGTTGGGTGG + Intergenic
1141890818 16:86925448-86925470 AGGCAGGGGCCCCTTCCTGGAGG + Intergenic
1142239942 16:88940584-88940606 GCGCCGGGGACCCGGGCAGGAGG + Intronic
1203065153 16_KI270728v1_random:1010558-1010580 GGCCTGGGGACCCAACCTGGGGG + Intergenic
1143733536 17:8894730-8894752 GGGCTGGGGACCCAGCGGGGTGG + Intronic
1144576574 17:16433523-16433545 CGTCCTGGGACCCTGCCTGGGGG - Intronic
1144930971 17:18858368-18858390 GGGTCGGGGTCCCTGGGTGGTGG + Intronic
1144944646 17:18963711-18963733 GGGCCAGTGCCCCTGCCTGAGGG - Intronic
1144945606 17:18968102-18968124 AGGCAGGGATCCCTGCCTGGGGG + Intronic
1144968179 17:19090743-19090765 GGACCAGCGACTCTGCCTGGGGG + Intergenic
1144979738 17:19161320-19161342 GGACCAGCGACTCTGCCTGGGGG - Intergenic
1144988484 17:19216912-19216934 GGACCAGCGACTCTGCCTGGGGG + Intronic
1145112469 17:20175781-20175803 GGGCCTGGGCCTCTGCCGGGTGG + Intronic
1145250369 17:21293910-21293932 GGGCAAGGGGCCCTGCCTGAAGG + Intronic
1146057610 17:29589187-29589209 GAGGCGGGGGCCCAGCCTGGAGG + Intronic
1147377398 17:40031029-40031051 GTGACTGGGACCGTGCCTGGGGG - Intronic
1147720647 17:42537344-42537366 GGGCCGTGGACCCTCCAGGGTGG + Intronic
1147792480 17:43022103-43022125 GGGCCGGGGGCGCTGCCGGCCGG + Exonic
1150108649 17:62479238-62479260 GGGTCGGGGCCCCTCCCGGGAGG + Exonic
1151320394 17:73349160-73349182 GGGCCCCGGAGCCAGCCTGGCGG + Intronic
1151659254 17:75509991-75510013 GGGCTGGGGACCCTGGCAGGAGG + Intronic
1151660727 17:75516680-75516702 GCGCCCGGGACCCGGCCAGGCGG + Intronic
1151980623 17:77506409-77506431 GGCCCGGGGACACAGCCAGGTGG + Intergenic
1152032311 17:77851570-77851592 GGCCAGGGGACCATGTCTGGGGG + Intergenic
1152094893 17:78267233-78267255 GGTTGGGGGACCCTGCCTGGTGG + Intergenic
1152146174 17:78570189-78570211 GGGGAGGGGACCCAGCCAGGAGG + Intronic
1152306875 17:79526259-79526281 CGGCCCTGAACCCTGCCTGGAGG + Intergenic
1152407927 17:80108071-80108093 GGTTCTGGGGCCCTGCCTGGAGG + Intergenic
1152516244 17:80826504-80826526 GGGCCGGAGGCCCTGGCTGCTGG - Intronic
1152820153 17:82433726-82433748 GCGCCAGGGACTCTGCCTCGTGG - Exonic
1152892276 17:82889253-82889275 GGGCAGGGCGCCCTCCCTGGAGG + Intronic
1155219157 18:23668952-23668974 GGCCAGGGCACCCTGCCAGGTGG - Intergenic
1157592268 18:48843003-48843025 TGCCCGGGGTCCCAGCCTGGTGG + Intronic
1158111083 18:53942244-53942266 GGGCATGTGTCCCTGCCTGGAGG - Intergenic
1159770454 18:72542061-72542083 CGGCTGCGGATCCTGCCTGGGGG - Exonic
1160453043 18:78978817-78978839 GGGCCGGGGGCACATCCTGGCGG + Intergenic
1160631206 18:80247421-80247443 GGGCCGGGGCCGGGGCCTGGGGG - Exonic
1160745418 19:709051-709073 GGGAGGGGGACGCGGCCTGGCGG - Intergenic
1160758955 19:772999-773021 GTCCTGGGGACCCTGACTGGGGG - Intergenic
1160841816 19:1149779-1149801 GGCCCCGGGACCCTGCTTGGAGG + Intronic
1160895428 19:1400020-1400042 GGGCTGGGGAGACTGCCTGGAGG + Intronic
1160895454 19:1400095-1400117 GGGCTGGAGAGGCTGCCTGGAGG + Intronic
1160895505 19:1400242-1400264 GGGCTGGGGAGGCTTCCTGGAGG + Intronic
1160946597 19:1646682-1646704 GCGGCAGGGACTCTGCCTGGCGG - Intronic
1160979994 19:1812351-1812373 GGGCCGGGGGCGGGGCCTGGAGG + Intergenic
1160988707 19:1851962-1851984 GGCCGGGGGACCCTCCGTGGAGG + Intergenic
1161121123 19:2527387-2527409 GGGCCTGGGTTCCTGCCTGGAGG + Intronic
1161221811 19:3121273-3121295 GGGCCGGGGCCTCTGCCCGCGGG + Exonic
1161339873 19:3735559-3735581 AAGCCGGGGACTCTCCCTGGTGG - Exonic
1161353051 19:3804346-3804368 GGCCCGGGACCCGTGCCTGGGGG - Exonic
1161400517 19:4065020-4065042 CGGCCTGGGAGCCTGGCTGGGGG - Intronic
1161800729 19:6415641-6415663 GGGCCGGGGACGGGGCCCGGGGG + Exonic
1161849530 19:6731358-6731380 GGGCTGGGGAGCCTGGATGGGGG + Intronic
1161964942 19:7542674-7542696 AGGCTTGGGACCCTGCCCGGTGG + Intronic
1162070368 19:8149161-8149183 CGGCCGGGGGCCCTGCCGGGTGG - Intronic
1162159710 19:8702692-8702714 GGGCCGGGGGCAGTGCGTGGGGG - Intergenic
1162299964 19:9838856-9838878 GGGCAGAGGACCCAGCCTGGGGG + Intronic
1162523328 19:11194392-11194414 GGGCTGGGGACCTTGCCCTGGGG - Intronic
1163003199 19:14381756-14381778 GAGCCTGCTACCCTGCCTGGAGG + Intronic
1163370025 19:16896650-16896672 TCGCCGGGGAACCAGCCTGGGGG + Exonic
1163636072 19:18437704-18437726 GAGCCGGGGCACCTGCCGGGCGG + Exonic
1163697478 19:18771333-18771355 GGGCGGGGGGACCTGCCTGGGGG + Intronic
1163709975 19:18840613-18840635 GGGCCGAGGGGCCTGGCTGGAGG + Intronic
1163921782 19:20296557-20296579 CGGACGGGGCCCCTGCCGGGCGG - Intergenic
1164605203 19:29593063-29593085 GGCCCAGGGCCACTGCCTGGAGG + Intergenic
1164695807 19:30242567-30242589 GGGGCAGGGACCCTGCTTTGTGG - Intronic
1165349724 19:35269157-35269179 GGGCCGGGGATCTTACCTGGCGG - Exonic
1165958310 19:39515564-39515586 GGGGCTGGGACCCGGACTGGAGG - Exonic
1166416132 19:42595959-42595981 CGGCCGGGGAGCCCGTCTGGGGG + Intronic
1166688904 19:44811154-44811176 GGAGAGGGGACCCTGTCTGGAGG + Intronic
1166804510 19:45477324-45477346 GGGGTGGGGACCCTGCAGGGTGG + Intronic
1167103246 19:47416859-47416881 GGGCTGGGGACACCCCCTGGAGG - Exonic
1167558011 19:50207520-50207542 AGGCTGGGAGCCCTGCCTGGAGG - Intronic
1167593642 19:50416863-50416885 GGGCCGAGGACCCTCTGTGGGGG - Intronic
1167622757 19:50568342-50568364 GGGCCGGGGCCGGGGCCTGGGGG - Intergenic
1168691545 19:58380647-58380669 AGGCCCGGGACCCATCCTGGCGG - Intronic
925167681 2:1728325-1728347 GGCCCAGGGACCCTGCCAGCAGG - Intronic
925925433 2:8666787-8666809 GGGCCGAGGACCAGGGCTGGAGG - Intergenic
926030019 2:9578279-9578301 TGGCCCGGGACCCTGGCTGATGG + Intergenic
926107768 2:10163002-10163024 GGGCCCGGGGCCCTGCGTGCAGG - Intronic
927886742 2:26723470-26723492 TGGCCTGGGACCCTGGCTGGAGG - Intronic
928270846 2:29853458-29853480 GGGCCTGGGATCTTGTCTGGAGG - Intronic
928365317 2:30695970-30695992 GGGGTGGGGACCCTTCCTGGAGG + Intergenic
928808926 2:35198445-35198467 GGGCAGGGGACCCTATGTGGGGG - Intergenic
932604388 2:73155576-73155598 GGGGCGGGGTCCCTGCATTGGGG - Intronic
934853565 2:97715930-97715952 GAGCCGTGGGCCCTGCCTCGGGG + Intronic
935690885 2:105731430-105731452 GGGGGGGGGTCCCTGCCTAGTGG - Intergenic
936467325 2:112764887-112764909 GGGCGTGGGACCCTCCGTGGGGG + Intergenic
937279821 2:120710075-120710097 GGCCCCGAGACCCTGCTTGGAGG + Intergenic
937361824 2:121234989-121235011 CTGCCGCAGACCCTGCCTGGAGG - Intronic
938378771 2:130825204-130825226 GGGCTGAGGAGCCTGCCTGTGGG - Intergenic
938382489 2:130844370-130844392 AGGCGGGGCGCCCTGCCTGGTGG + Intronic
940851712 2:158693378-158693400 GGGAGGGGGCCCCTGCCTTGGGG - Intergenic
941849006 2:170160132-170160154 GGGCTGGGGAGACTGCCTGGAGG - Intergenic
942278744 2:174340985-174341007 GGGCGGGGGACGCGGCCTGGGGG + Intergenic
945993103 2:216412837-216412859 GGGCAGAGGTCCCTGCCTAGAGG + Intronic
947461118 2:230305931-230305953 TGGCTTGTGACCCTGCCTGGGGG - Intronic
947605765 2:231484131-231484153 GGCCCGCGGACCCAGCGTGGGGG + Intergenic
947715382 2:232336501-232336523 GGGCTGTGGACTCTGCCTGCAGG - Exonic
948492903 2:238324990-238325012 TGGCAGGGAACCCTTCCTGGAGG - Intronic
948805594 2:240452480-240452502 GAGCCGGGGCCCCTCCCCGGAGG - Intronic
948825490 2:240571769-240571791 TGGCTGGGGCCGCTGCCTGGAGG - Intronic
948836352 2:240627943-240627965 CAGCCTGGGACCCTGCCTCGTGG - Intronic
949004636 2:241638038-241638060 GGGCGGCGGAGCCTGCCGGGCGG + Intronic
1170746847 20:19107204-19107226 GAGCAGGTGACTCTGCCTGGGGG - Intergenic
1170804407 20:19617239-19617261 AGGCCGTGGAGCCTGCCTGGTGG + Intronic
1170937867 20:20825349-20825371 GGGCCTGGGAGCCTCTCTGGTGG + Intergenic
1172320887 20:33994317-33994339 GGGCCGGGGACCCGGGGCGGCGG - Intronic
1172409171 20:34709531-34709553 GGGCCGGGGGCGGAGCCTGGAGG + Intronic
1172942508 20:38664118-38664140 GCCCAGGGAACCCTGCCTGGTGG - Intergenic
1173894119 20:46537283-46537305 GGGCTGGGACCCCTGCATGGTGG - Intergenic
1174349524 20:49956918-49956940 GGTCCGGGGACCTGGCCGGGGGG + Intergenic
1174396680 20:50251055-50251077 GGCCCGGGGACCTGCCCTGGAGG + Intergenic
1174761519 20:53211345-53211367 GAGCCAGGGACCCTGAGTGGAGG - Intronic
1175204442 20:57301114-57301136 GGGCAGGGGAGCATGCCTGGGGG - Intergenic
1175408704 20:58752135-58752157 GGGAAGGGGACCCGGCCTCGAGG + Intergenic
1175901535 20:62361744-62361766 GGCCCGGGTACCCAGCCTTGAGG - Intronic
1175939407 20:62531167-62531189 GGGCCGGGCATCCTGGCTGAGGG + Intergenic
1175940842 20:62536885-62536907 GGGGTGGGGACGCTGCCTGCCGG - Intergenic
1176242056 20:64079798-64079820 GGCCCGGGGACCGTGCTGGGCGG - Intronic
1176311655 21:5154026-5154048 GGGCCGCGGAGCCGGCCTGGGGG - Intronic
1176380808 21:6111362-6111384 AGGCCAGGGACCCTGCGCGGTGG - Intronic
1178433109 21:32534023-32534045 GGGGCAGGGAGCATGCCTGGCGG - Intergenic
1178953958 21:37006828-37006850 GCCCCGGGGACGCTCCCTGGAGG + Exonic
1179742664 21:43426878-43426900 AGGCCAGGGACCCTGCGCGGTGG + Intronic
1179845395 21:44108009-44108031 GGGCCGTGGAGCCGGCCTGGGGG + Intronic
1179918658 21:44494941-44494963 GGGTCGGGGACCATGCTTAGTGG + Intergenic
1180006996 21:45027468-45027490 CGGCCCGAGACCCTGCTTGGTGG - Intergenic
1180091348 21:45535165-45535187 GGGCCGGGGGGTCTCCCTGGAGG + Intronic
1180800824 22:18631106-18631128 GGGCCGGGGGCCAGGCATGGTGG - Intergenic
1180852057 22:19026663-19026685 GGGCCGGGGGCCAGGCATGGTGG - Intergenic
1180966014 22:19788321-19788343 GGGCTGAGCATCCTGCCTGGTGG + Exonic
1181220893 22:21364156-21364178 GGGCCGGGGGCCAGGCATGGTGG + Intergenic
1181270020 22:21653222-21653244 GGGGCGGGGCCTCTGCCCGGGGG - Intronic
1181314478 22:21962618-21962640 AGGCTGGGGACCCTGAGTGGCGG - Intronic
1181453248 22:23037964-23037986 ATGCCTGGGCCCCTGCCTGGAGG - Intergenic
1181727728 22:24823200-24823222 GTGCCTGGCACCATGCCTGGGGG - Intronic
1181803271 22:25360678-25360700 GGTCCCAGGACCGTGCCTGGGGG + Exonic
1183189419 22:36312207-36312229 TGCCCGGGGGGCCTGCCTGGAGG + Exonic
1183194154 22:36341797-36341819 TGGCCGCGGACCTTGCCTGGTGG - Intronic
1183201027 22:36386272-36386294 GTGCCAGGGACTCTGCCAGGTGG - Intronic
1183299528 22:37052028-37052050 CGGCCGGGTCCCCAGCCTGGCGG - Intronic
1183824039 22:40370878-40370900 GGGCCGGGGACGCGGCGGGGCGG + Intronic
1184017924 22:41800032-41800054 GGCCCGGGGCCCCTGCCGGGCGG - Intergenic
1184021843 22:41826375-41826397 GGGCCTGGGGCCCCTCCTGGTGG - Intergenic
1184088971 22:42282661-42282683 GGAACGGTGACCCTGGCTGGGGG + Intronic
1184119505 22:42440972-42440994 GGGCAGGGGACCGAGCCTCGAGG - Intergenic
1185034505 22:48464950-48464972 GGACCGGGGACCCTGAGAGGAGG + Intergenic
1185116355 22:48940446-48940468 GGTCAGGGAAGCCTGCCTGGAGG + Intergenic
1185223217 22:49639530-49639552 GGGCTGTGGGTCCTGCCTGGGGG - Intronic
1185269114 22:49920359-49920381 GGGTCTGGGACCCTGCCGGATGG + Intronic
1185301517 22:50083617-50083639 GGCCTGGAGCCCCTGCCTGGAGG - Intronic
1185326013 22:50226244-50226266 GGGCAGGGGTCCGTGCCTGTGGG - Intronic
1185397537 22:50600619-50600641 CGGCCGGGGACGCTGGTTGGAGG - Intronic
1185399350 22:50607921-50607943 GGGCAGGGGCCTGTGCCTGGAGG - Intronic
949890155 3:8727648-8727670 GGGCCTGGCACGCTGCCTGCTGG - Intronic
949891264 3:8735039-8735061 TGGCTGGGGACCCTTCTTGGAGG - Intronic
950040470 3:9916423-9916445 TGGCTGGGGAGCCTGCCTGGTGG + Intergenic
950430510 3:12948305-12948327 GGGCAGGTGACCCTGGCTTGGGG - Intronic
950547664 3:13648210-13648232 GGGCTGGGCAGCCTGGCTGGAGG + Intergenic
950550279 3:13662071-13662093 TGGGCGGGGACCCTGTCAGGAGG + Intergenic
952764784 3:36944721-36944743 GGGCCCGCCACCCTTCCTGGCGG - Intronic
953027436 3:39153248-39153270 GGGCCGGGGGCCCGGCCGGCGGG - Intronic
954376042 3:50194672-50194694 GGGGCGGGGGCGCCGCCTGGCGG - Intronic
954389298 3:50260464-50260486 GGGGCGGGGACCGGGCCTGGGGG - Intergenic
954672949 3:52300223-52300245 GGCCCGGGGGCTGTGCCTGGTGG - Intergenic
955356700 3:58237866-58237888 GGGCCGGGGTCCGGGCCCGGCGG + Exonic
959016660 3:101142389-101142411 GGGTGGGGGACGCTGGCTGGAGG + Intergenic
961453746 3:127014369-127014391 GGGCTGGGGGCCCTACCTTGAGG - Exonic
961470291 3:127107164-127107186 GGGCTGGGGCCCCCGCCTGGGGG + Intergenic
961537772 3:127580336-127580358 GGGACTGGGCCCCTGCCTGGGGG - Intronic
963904580 3:150763085-150763107 GGGCCCGGGACGCCGCCGGGAGG - Exonic
964743236 3:159988766-159988788 AGGCCGGGGACCCAGGGTGGTGG + Exonic
965113138 3:164452104-164452126 AAGCCAGGGACCCTGCCTGTTGG + Intergenic
967858204 3:194134134-194134156 GGGCCGGCGACCCGGGCAGGCGG + Intergenic
967912709 3:194555517-194555539 GGGCCGGGGACCAGGCCTGAAGG - Intergenic
968131016 3:196192851-196192873 GAGCCTGGGACGCTGCCTGCGGG + Intergenic
968279408 3:197464671-197464693 GGACTGGGGATGCTGCCTGGTGG + Intergenic
968647330 4:1747324-1747346 CGGCCCAGGACGCTGCCTGGTGG - Intergenic
968660027 4:1795012-1795034 GGGCCGGGGAGGGCGCCTGGAGG + Intronic
968731299 4:2270541-2270563 GGCCCGGGGTCCCTGCAGGGAGG + Exonic
968750609 4:2387072-2387094 GGGCCGGGGCCACTCCCTGGAGG + Intronic
968897730 4:3414438-3414460 GGGCCAGGGACGCTCCCTGGGGG - Intronic
969053332 4:4387311-4387333 GGACCGGGGACCGGGTCTGGAGG + Intronic
969394372 4:6910578-6910600 GGGCCGGGGTAGCTGCCTTGAGG + Intronic
969474328 4:7412688-7412710 GGGGCGGGGGCCCTCCCTGCAGG + Intronic
969499637 4:7544853-7544875 GGGTGGGAGCCCCTGCCTGGTGG + Intronic
969535882 4:7755787-7755809 AGAGCGGGGACTCTGCCTGGGGG + Intergenic
969602975 4:8188141-8188163 GAGCTGGGGAGGCTGCCTGGAGG - Intronic
971360655 4:25935291-25935313 GGTCCACGGACCGTGCCTGGCGG + Intergenic
979335304 4:119455156-119455178 GGTCCCCGGGCCCTGCCTGGGGG - Intergenic
980384044 4:132063042-132063064 GGGCCGGGCACTCTGAGTGGCGG - Intergenic
983939085 4:173522956-173522978 GGGCCCAGGACCCTGGTTGGAGG - Intergenic
985564129 5:606804-606826 GAGCCGCCCACCCTGCCTGGGGG + Intergenic
990381955 5:55227447-55227469 GGGCCGGGGCCCCGCGCTGGCGG - Intergenic
990545406 5:56816224-56816246 GCGCCCCGGACCCAGCCTGGGGG + Intronic
993794507 5:92249730-92249752 GAGCCAGGGGTCCTGCCTGGTGG - Intergenic
997792268 5:136771594-136771616 GGGGCGGGAACTGTGCCTGGTGG - Intergenic
998153209 5:139769082-139769104 GGGCCTGTGACCCAGCCTGGTGG + Intergenic
998394840 5:141811858-141811880 GGGCCGAGGTCCCAGCGTGGTGG - Intergenic
1001234756 5:170020086-170020108 GGGCCGGGGATGCTGGCTAGAGG - Intronic
1002140029 5:177132852-177132874 GGGCCGGGGACTCGGCCCTGCGG - Intergenic
1002195783 5:177500500-177500522 GGGCCGGGCACCGGGCATGGTGG - Intergenic
1002575316 5:180170873-180170895 GGGCAGGGAGCCCTGCCTGCAGG - Intronic
1002576331 5:180176227-180176249 GGGCTGGGGCCCCTGCCTCCAGG - Intronic
1006131447 6:31871592-31871614 GGGCCAGGAGCTCTGCCTGGAGG + Intronic
1006606338 6:35259991-35260013 GGGGCAGGGACCCTGGGTGGGGG - Intronic
1007630675 6:43271598-43271620 GGGCCCTGGCCCCTGCCTGGGGG + Intronic
1013232451 6:108169956-108169978 GCGCGGGGGACCGTGCTTGGGGG - Intronic
1013268357 6:108521961-108521983 GGCACTGGGACCCTGTCTGGAGG + Intronic
1014272379 6:119349185-119349207 GGGCTGCGGATCCTCCCTGGGGG + Exonic
1016992908 6:149942183-149942205 CGGGCGGGGACCAAGCCTGGAGG + Intronic
1017719526 6:157235208-157235230 GGGCCAGGCACCCTCCCTGGAGG + Intergenic
1017992865 6:159505847-159505869 AGGGCAGGGACCCAGCCTGGAGG - Intergenic
1018702969 6:166441878-166441900 GGGGCCGGGACCCTGGCTAGGGG + Intronic
1019327354 7:445037-445059 ACCCCGGGGACCCTGGCTGGGGG - Intergenic
1019504429 7:1383750-1383772 GGGCAGGGGCCCCTACCTCGGGG + Intergenic
1019646487 7:2132232-2132254 GTGCAGGGGAATCTGCCTGGGGG - Intronic
1019731690 7:2632517-2632539 GGGCCGTGGACCCTCACTGGGGG - Intronic
1020012826 7:4815844-4815866 TGGCCTTGGACCCTGCCTTGTGG - Intronic
1020282518 7:6656736-6656758 GGGCCAGGTACCCTTCGTGGTGG + Intergenic
1022465193 7:30648930-30648952 GGGCCGGGCTCCCTGGCTGAAGG + Intergenic
1023984291 7:45085985-45086007 GGGCCGGGCACCCGGCTTGCTGG + Exonic
1024290496 7:47800388-47800410 GGGCCAGGGAAGCTTCCTGGAGG + Intronic
1024323052 7:48088832-48088854 AGACCGGGGATCCTGCCTGGCGG + Exonic
1026202640 7:68227840-68227862 TGGCCTGGGACCCAGCCTGGTGG - Intergenic
1026298691 7:69078453-69078475 GAGCGGGGGACCATGCGTGGTGG - Intergenic
1026592886 7:71712038-71712060 GGGCACGGGACGCTGCCTGGAGG + Exonic
1027592522 7:80134661-80134683 GCCCCGGGGACGCTGCCAGGGGG + Intronic
1029463716 7:100711830-100711852 GGGCAGGGAACCCTGCCTGCAGG + Intergenic
1029562065 7:101309116-101309138 GGGTCAGGGACCCAGCCTGTGGG + Intergenic
1032037669 7:128531754-128531776 GGGTCGGGGCCCCTCCCGGGAGG + Intergenic
1032476393 7:132214204-132214226 TGGGCTGGAACCCTGCCTGGGGG + Intronic
1032784081 7:135186909-135186931 GGGCAGGGGTTCCTCCCTGGAGG - Intronic
1033600302 7:142884315-142884337 TGACCGGGGAGGCTGCCTGGAGG - Intronic
1033757016 7:144403931-144403953 GGGCCTGGGCTCCTGGCTGGGGG - Intronic
1035056856 7:156041591-156041613 TGGCCGGGGTTCCTGTCTGGAGG - Intergenic
1035205289 7:157290599-157290621 GTGCCGGGGGCCCTTCCAGGGGG + Intergenic
1035752678 8:2007596-2007618 GGGCAGGGGACTGTGCCTGACGG - Intergenic
1035759268 8:2057429-2057451 GGGCCTGGGAGCGTGCCAGGTGG - Exonic
1038692285 8:29774268-29774290 GGACAGGTGACCCTGCCTGCTGG - Intergenic
1039078131 8:33710782-33710804 CGGCCCGGGACCCTGCCCTGAGG - Intergenic
1040589199 8:48773817-48773839 TGTCCTGGGACCCTGCCTGCTGG + Intergenic
1045359109 8:101415442-101415464 GCAGCGGGGGCCCTGCCTGGGGG - Intergenic
1048005876 8:130419060-130419082 AGGGCAGGGACCCTTCCTGGAGG + Intronic
1048295417 8:133210220-133210242 GGGCAGGGAAGCCTTCCTGGAGG + Intronic
1049217343 8:141414351-141414373 GGTCTGGGGGCCCAGCCTGGTGG + Intronic
1049353521 8:142176765-142176787 GGGCCCGGCAGGCTGCCTGGAGG - Intergenic
1049378193 8:142299026-142299048 GGGCCTGTGGCCCTGGCTGGAGG - Intronic
1049439903 8:142604550-142604572 GGGCCGGGGAACCTGTCCCGTGG + Intergenic
1049664695 8:143837714-143837736 TGGCCCGGGACCCTGCCCGCCGG - Exonic
1049807826 8:144548829-144548851 GGGCCCAGGAGCCTGCCCGGCGG - Intronic
1051355946 9:16239904-16239926 GGGCCCTGGGCCCTGGCTGGGGG - Intronic
1053173140 9:35905064-35905086 GGGCTGGGGACTCAGCCTGGAGG + Intergenic
1057129419 9:92642675-92642697 GGGCGGGGGCCAGTGCCTGGTGG - Intronic
1057181749 9:93034444-93034466 GGGCCAGGGCCACTGCTTGGGGG - Intronic
1059374828 9:113873972-113873994 GAGGCGGGGACCCGGCCTTGAGG + Intergenic
1060479978 9:124012187-124012209 GGGCCCGGAGCCCGGCCTGGGGG + Exonic
1060528420 9:124333432-124333454 GGGTTGGGGAACCTGCCGGGAGG + Intronic
1060544491 9:124452171-124452193 GGGACTGGGACCCTCCCTGGGGG - Intronic
1060757604 9:126224409-126224431 GGTCTGGGGAACCAGCCTGGGGG - Intergenic
1061089754 9:128420299-128420321 GGGCCGGAGACCCAGCGTGGGGG - Intronic
1061091514 9:128429031-128429053 TGGCTGGTGAGCCTGCCTGGTGG + Exonic
1061545821 9:131303765-131303787 GGGCCAGGCACCATGCCTGCAGG - Intronic
1061546480 9:131307776-131307798 TGAGAGGGGACCCTGCCTGGGGG + Intronic
1061874319 9:133536317-133536339 GGGCTGGGGACCCAGGCGGGGGG - Intronic
1061987203 9:134136492-134136514 AGGCCGGGCACGCTGCCTGCGGG - Intronic
1062004077 9:134230597-134230619 GTGCCAGGCACCTTGCCTGGCGG + Intergenic
1062129745 9:134885921-134885943 GGGTCGGGGGCCCTGAATGGGGG + Intronic
1062234160 9:135500142-135500164 GGGCCTGGGACCCCGCCAGCCGG + Intronic
1062469388 9:136695888-136695910 GGACCCGGGTGCCTGCCTGGGGG - Intergenic
1203759425 EBV:4396-4418 GGGCCTGGTGACCTGCCTGGTGG + Intergenic
1185609733 X:1387246-1387268 GGGCGGGGGACCCTTGCTGCCGG - Intronic
1189320494 X:40084234-40084256 GGGCCATGGGCTCTGCCTGGAGG - Intronic
1189396076 X:40623936-40623958 GGGCTGGGAACCCGGGCTGGTGG - Intergenic
1189850450 X:45171701-45171723 GGGCCAGGAAAGCTGCCTGGAGG - Intronic
1190735073 X:53250645-53250667 GGGATCGGGGCCCTGCCTGGTGG + Exonic
1200239544 X:154486521-154486543 GGCCCGGGGACCCTACCTGCAGG + Exonic
1200267788 X:154655096-154655118 TGTCCGGGGTCCCTTCCTGGGGG - Intergenic
1200424015 Y:3003049-3003071 GGTCTGGGGCCCCAGCCTGGGGG + Intergenic
1201145744 Y:11064548-11064570 GTTCCTGGAACCCTGCCTGGAGG - Intergenic