ID: 1105005735

View in Genome Browser
Species Human (GRCh38)
Location 12:132719458-132719480
Sequence CCTCCGGGTGGTGTGGCCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 196}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105005723_1105005735 10 Left 1105005723 12:132719425-132719447 CCAGACCAGATAGAGCTTTTCTG 0: 1
1: 0
2: 1
3: 9
4: 125
Right 1105005735 12:132719458-132719480 CCTCCGGGTGGTGTGGCCTCAGG 0: 1
1: 0
2: 0
3: 23
4: 196
1105005728_1105005735 5 Left 1105005728 12:132719430-132719452 CCAGATAGAGCTTTTCTGGGGGT 0: 1
1: 0
2: 1
3: 8
4: 122
Right 1105005735 12:132719458-132719480 CCTCCGGGTGGTGTGGCCTCAGG 0: 1
1: 0
2: 0
3: 23
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105005735 Original CRISPR CCTCCGGGTGGTGTGGCCTC AGG Intronic
900090889 1:919963-919985 CCTCAAGGTGCTGGGGCCTCTGG + Intergenic
900161335 1:1225380-1225402 CGTCAGGCAGGTGTGGCCTCTGG + Intronic
900616338 1:3567305-3567327 CCTTCTGGAGCTGTGGCCTCAGG - Intronic
900799222 1:4727248-4727270 CCTCAGAATAGTGTGGCCTCTGG + Intronic
901019929 1:6250360-6250382 GCTCCGAGTGGAGAGGCCTCGGG + Intronic
902491030 1:16780764-16780786 CTTCAGTGTGGTGTGACCTCTGG + Intronic
903827176 1:26154921-26154943 CCTCTGAGGGGTGTGGCCTCTGG - Intergenic
905172945 1:36119728-36119750 CTTCCGGGTGGTGGGGGCTGTGG + Intronic
914214008 1:145608071-145608093 CCCCAGCGTGCTGTGGCCTCGGG + Exonic
914465951 1:147928474-147928496 CCCCAGCGTGCTGTGGCCTCCGG + Exonic
915525253 1:156472188-156472210 CCTGAGGGTGGGGTGGCCTGGGG - Intronic
915902408 1:159856132-159856154 CCTCCTGGTGCTGTTCCCTCAGG - Intronic
918471863 1:184883631-184883653 CCTTGGGGTGGTGTTGCTTCAGG - Intronic
923024784 1:230195803-230195825 CCTCCGGCTTGTGTGGCCAGTGG - Intronic
924557154 1:245128350-245128372 CCTCCCAGGAGTGTGGCCTCTGG - Intergenic
1065727670 10:28681524-28681546 CCTCCCAGGGGTGAGGCCTCAGG + Exonic
1066291488 10:34018272-34018294 CCTCTGGGTGTTGGGGCCTCAGG - Intergenic
1072503832 10:96044271-96044293 TCCCCGGGGGGTGTGACCTCAGG - Intronic
1074400927 10:113140792-113140814 CCTCCTGGAGGTGGGGCCTTGGG + Intronic
1075001064 10:118798264-118798286 CCTCTATGTGGTGTTGCCTCAGG - Intergenic
1076140892 10:128077804-128077826 CCTCCAGGTGGGGTGGACACAGG + Intronic
1076243540 10:128928344-128928366 CCTCCCGGTGATGGGGCCCCCGG - Intergenic
1076698210 10:132257146-132257168 CCTCAGGGGGGTGAGGCCTGTGG + Intronic
1076732364 10:132445094-132445116 CCTCCGGTGGCTCTGGCCTCTGG + Intronic
1077424986 11:2471217-2471239 CCTCCAACTGGTGTGGCTTCAGG + Intronic
1082809414 11:57470016-57470038 CTTCCTGGGTGTGTGGCCTCAGG - Intronic
1083186743 11:61022034-61022056 CCTCCTGGCAGTGTGGCCTCAGG + Intergenic
1084195093 11:67520038-67520060 CTTCCGGGAGGTGCGGCCACTGG - Exonic
1084553891 11:69864644-69864666 CCTCCCTGTGGTGTGAGCTCAGG - Intergenic
1084978083 11:72814250-72814272 CCTCCGGGAGGAGCCGCCTCCGG - Intergenic
1085037405 11:73308603-73308625 ACTCCGGGGGGGCTGGCCTCGGG - Exonic
1085702644 11:78758643-78758665 CTTGCTAGTGGTGTGGCCTCAGG + Intronic
1088895519 11:114075376-114075398 CCGGCCAGTGGTGTGGCCTCAGG + Intronic
1089281924 11:117380741-117380763 CTTCAGGGTGGTGTGGACTTGGG + Intronic
1091295090 11:134468245-134468267 CCTGCTGGTGATGCGGCCTCTGG + Intergenic
1091888125 12:4031420-4031442 CCTCCTGGCGGCGCGGCCTCCGG - Intergenic
1093030499 12:14284342-14284364 CCTCCTGGTTGTGTGGGCTGTGG - Intergenic
1101727242 12:107398216-107398238 TCCCAGGGTGGTGTGGCGTCTGG - Intronic
1102005349 12:109586120-109586142 CCTGGGGTAGGTGTGGCCTCAGG + Exonic
1102124480 12:110469059-110469081 CCCCCGGGTCGTGAGGCCCCCGG + Intronic
1104608114 12:130204672-130204694 TCTCTGGGCGGTGAGGCCTCCGG + Intergenic
1104953546 12:132453215-132453237 CCTCCGGGAGGTGTGGTGGCTGG - Intergenic
1105005735 12:132719458-132719480 CCTCCGGGTGGTGTGGCCTCAGG + Intronic
1106099024 13:26678920-26678942 CTCCCGTGTGGTGTCGCCTCTGG + Intronic
1107958594 13:45540331-45540353 CCTCCTGGTGTTGGAGCCTCTGG - Intronic
1110551362 13:76814430-76814452 CCTGAAGGTGGTGTGGCCCCAGG - Intergenic
1113613788 13:111666385-111666407 CCTCTGGGTGGGGAGACCTCGGG - Intronic
1117642413 14:57813820-57813842 CCTTCCTGTGGTGTGGCCTGCGG - Intronic
1119936140 14:78594016-78594038 GCTCTGGGTGGGGTGGCCTGGGG - Intronic
1122494062 14:102139672-102139694 CCTCCCCCGGGTGTGGCCTCCGG - Exonic
1122600198 14:102917576-102917598 TCTCCTGATGGTGGGGCCTCAGG - Intergenic
1123463470 15:20495585-20495607 CCTCAGTGTTGTGTGGCCTTTGG - Intergenic
1123654591 15:22504832-22504854 CCTCAGTGTTGTGTGGCCTTTGG + Intergenic
1123758813 15:23417051-23417073 CCGCCTGGGGGTGGGGCCTCAGG + Intergenic
1123939324 15:25209197-25209219 CCTCCAGGTGGTGGGGTCTTGGG + Intergenic
1124274312 15:28312993-28313015 CCTCAGTGTTGTGTGGCCTTTGG - Intronic
1124308502 15:28600029-28600051 CCTCAGTGTTGTGTGGCCTTTGG + Intergenic
1124785036 15:32671796-32671818 CCTGCGGCCGGTGTCGCCTCAGG + Intronic
1125599240 15:40906568-40906590 GCTCCTGGGGGTGTGGCCGCCGG + Intergenic
1126335433 15:47582180-47582202 CCTCGGGGTGGTCTGGGCACTGG - Intronic
1128558938 15:68651785-68651807 CCCTCAGGAGGTGTGGCCTCGGG - Intronic
1129084689 15:73076561-73076583 CCTCTGAGTGGTGTGGCATTTGG + Intronic
1129695052 15:77735682-77735704 CCTGGGGGTGGTGGGGCCTGAGG + Intronic
1131269159 15:90935832-90935854 CCTCAGGGTGGTGGGGGATCGGG + Intronic
1132614136 16:831981-832003 TCTCAGGGCGGTGTGGCCTCAGG - Intergenic
1132941401 16:2510208-2510230 CCCCAGGGTGGAGTGGACTCTGG - Intronic
1133271579 16:4613230-4613252 CCTCCGGGTGGGGCTGCCTTGGG + Intronic
1134032312 16:11002113-11002135 CCTCCTGGCTGTGTGACCTCGGG + Intronic
1134457524 16:14405809-14405831 CCGCCTGGGGGTGGGGCCTCAGG - Intergenic
1135380584 16:21993062-21993084 CGTACGGCTGGGGTGGCCTCAGG - Intronic
1136514929 16:30762351-30762373 CCTCCTGCTGGTGAGGGCTCTGG + Exonic
1139475342 16:67200053-67200075 CCTCCGGGGCGGGGGGCCTCTGG - Intronic
1139960272 16:70713596-70713618 ACTCACAGTGGTGTGGCCTCTGG - Intronic
1140112487 16:72015837-72015859 CCTCCTGGTTGTGTGGCATGTGG + Intronic
1141557150 16:84843818-84843840 CTTCCTGGTTGTGTGACCTCAGG + Intronic
1141777872 16:86136316-86136338 CCTCAGGAGGGGGTGGCCTCAGG - Intergenic
1142967796 17:3591987-3592009 CCACAGGGTGGTCTGGCTTCTGG - Intronic
1143508805 17:7384176-7384198 CTTCGGGCTGGTGCGGCCTCTGG + Exonic
1144029294 17:11305105-11305127 CCTGCTGGTGGTGTGCCCTTGGG + Intronic
1146053139 17:29567971-29567993 CCTCCTGGGGGTGAGGCCTGTGG + Intronic
1147176190 17:38657684-38657706 CCTCCAGCTGGGGTGGCCTGAGG + Intergenic
1147375371 17:40019739-40019761 CCTGCTGGTGCTGGGGCCTCGGG - Intronic
1148162849 17:45461347-45461369 TTTCCGGATGGTGTGCCCTCTGG + Intronic
1148665543 17:49371732-49371754 CCTCTGAGTGCTGAGGCCTCAGG - Intronic
1149293005 17:55235420-55235442 CCACAGGGTGGTGGGGCCTGGGG + Intergenic
1150394079 17:64807999-64808021 TTTCCGGATGGTGTGCCCTCTGG + Intergenic
1151407180 17:73896025-73896047 CCTGCCAGTGGTGTGACCTCGGG + Intergenic
1152367469 17:79864882-79864904 CCTCCTCCTGCTGTGGCCTCTGG + Intergenic
1152424468 17:80211416-80211438 CCTCCAGGTGGGGTGGGCCCGGG - Intronic
1152471635 17:80492779-80492801 CCTCCTGGCTGTGTGACCTCAGG + Intergenic
1155057871 18:22200819-22200841 CCTCCTGGCGGCGTGGGCTCAGG - Exonic
1158458854 18:57630363-57630385 CCTCCGGGTGTTGGGGAGTCCGG + Intergenic
1159985060 18:74831882-74831904 CCTCCGTGTGCTGTGGCCCTGGG + Intronic
1160215046 18:76921276-76921298 CCACTGGGTGGTGTGGCCACAGG + Intronic
1161035735 19:2083399-2083421 GCTGCAGGTGGTGTGGCCTGAGG - Intronic
1161752835 19:6110259-6110281 CGTCCGGGTGGTGCGCCCGCGGG - Intronic
1161951824 19:7471740-7471762 CCACTGGGTGCTGTGGGCTCAGG + Exonic
1163615782 19:18327304-18327326 CATCCAGGTGGAGTGGACTCTGG + Intergenic
1164487155 19:28668301-28668323 CCTCCTGGTCATATGGCCTCTGG - Intergenic
1165092359 19:33393823-33393845 CCTTGGGGTGGTCTGGCCTCTGG - Intronic
1165101988 19:33444501-33444523 CCACTGGGTGGTGGGGACTCAGG + Intronic
1166908620 19:46134120-46134142 CCACCTGGTGGTCTGGCCTGTGG + Intergenic
1167202721 19:48077603-48077625 CCTCCTGGCTGCGTGGCCTCAGG + Intronic
1167239342 19:48333958-48333980 CCTCGCGGGGGTGTGGCCCCTGG + Intronic
1167311874 19:48741633-48741655 CCTGCCGGGGGCGTGGCCTCTGG - Intronic
1167771066 19:51518926-51518948 ACACCTGGTGCTGTGGCCTCTGG + Intergenic
1168277885 19:55287125-55287147 CCTGCGGGTGGGGGGGCCTCCGG + Intronic
1168297137 19:55382965-55382987 CCTACGTGTTGTGTGGCCTTGGG + Intronic
925012426 2:495978-496000 ACTCCATGTGGAGTGGCCTCTGG - Intergenic
925057878 2:869385-869407 CCTGCGGGGTGTGTGGACTCGGG + Intergenic
926730195 2:16030687-16030709 CCTCTGGGTGGTGGGTCCGCAGG - Intergenic
927095992 2:19747978-19748000 CCTCTGGGTGGGCTGGCCTTTGG - Intergenic
927494845 2:23545496-23545518 CCTCGGGGTGGGGTGTCCCCAGG + Intronic
927973797 2:27322775-27322797 CTTCCAGGTGGTCTGGCTTCAGG - Intronic
928592070 2:32827488-32827510 CCTGAGGGTGGAGTGGCGTCTGG - Intergenic
929252928 2:39779263-39779285 CCTTCGGGTCACGTGGCCTCGGG + Exonic
931678148 2:64718440-64718462 CCTCCCAGTGGTGTGACCTTTGG - Intronic
933406918 2:81872251-81872273 CCTCTGGGTGGGGTGGCCACAGG - Intergenic
934500681 2:94858042-94858064 CCGCCTGGGGGTCTGGCCTCAGG + Intergenic
934702236 2:96451685-96451707 CCTCAGGGAGGTGGGGTCTCAGG - Intergenic
935132746 2:100273182-100273204 CCTCCAGCTGGTGTGGCTGCTGG - Intergenic
938139210 2:128782675-128782697 CCTGTGGGGAGTGTGGCCTCTGG + Intergenic
940293251 2:152098387-152098409 CCTCCGGGTTGTGGTGCCTCGGG + Exonic
942136322 2:172929797-172929819 CATCAGGGTAGTGTGGCCTCAGG + Intronic
949008675 2:241666196-241666218 CCTCCGGTTGATGTGTCCTCCGG + Intronic
1169113129 20:3045943-3045965 CCGCCCGGCCGTGTGGCCTCTGG - Exonic
1171447735 20:25216772-25216794 CCCCATGGCGGTGTGGCCTCGGG - Intronic
1172231378 20:33338824-33338846 CCTCCTGGCTGTGTGGCCTTGGG - Intergenic
1172301753 20:33855331-33855353 CCTGCAGCTGGTGTGGCCTCTGG + Intergenic
1172695189 20:36817581-36817603 CATCAGGGTGGGGTGGCCTGGGG - Intronic
1175927798 20:62479610-62479632 TCTCCGGGCTGTGTGGCCTTGGG + Intergenic
1176042321 20:63072200-63072222 CCTCCGGGTGGGCCGGGCTCGGG + Intergenic
1178711678 21:34922680-34922702 CCCCCTGGTGGTGAGGCCTGGGG + Intronic
1180163824 21:46010100-46010122 GCTCCAGGTGGTGATGCCTCAGG + Intergenic
1181462418 22:23093692-23093714 CTCCCAGGTTGTGTGGCCTCTGG - Intronic
1181815711 22:25435076-25435098 CCTGCGGGTGCTGTGGTTTCAGG - Intergenic
1182122722 22:27797869-27797891 CCTCCGGGTCCTGGGGCCCCAGG + Exonic
1182411389 22:30189876-30189898 CCTGGGTGGGGTGTGGCCTCAGG - Intergenic
1182953526 22:34399440-34399462 CCTGCTTCTGGTGTGGCCTCAGG - Intergenic
1183440080 22:37818058-37818080 CCTCAGCGTGGTGTGACCTTGGG + Intergenic
1184042225 22:41951114-41951136 CCTCTGGGTGAGGTGGCTTCAGG - Intergenic
1184697943 22:46150340-46150362 CCTCCGGGGGGTGTGTCCCGGGG + Intergenic
1184874091 22:47261772-47261794 CCTAGGGCTGCTGTGGCCTCAGG + Intergenic
950288527 3:11764421-11764443 CCTTCAGGTTGTGTGGCCTTCGG - Intergenic
950684212 3:14604944-14604966 ACTCCTGGTGGTGTGACCTTGGG - Intergenic
952962855 3:38603755-38603777 CTTCCTGGGGATGTGGCCTCTGG + Exonic
954450456 3:50568870-50568892 CCTCCAGGTGTTGGGACCTCTGG - Intronic
957191579 3:77016722-77016744 ACTCCTGGCGGTGTGGCCTCGGG - Intronic
961810659 3:129519797-129519819 CCTCTGGGAGGCGTGGCCCCTGG + Intronic
965601759 3:170461630-170461652 CCTGCGTGTGGTGGGGCCTGCGG + Exonic
966773118 3:183521458-183521480 CCTCCGGGGAGGGTGTCCTCAGG - Intronic
967991602 3:195135577-195135599 CCTCCTGGTGCTGAGGCCTAGGG - Intronic
968512706 4:1002602-1002624 CCTCCGCGTGGCGGGGCCTGGGG + Intronic
968698444 4:2043594-2043616 CCTGCGGGTGGTGTGGGAGCTGG + Intronic
968878568 4:3286939-3286961 CCTCGGGCTGGGGAGGCCTCGGG + Intergenic
969428736 4:7140741-7140763 CCTCCGTGTGCTGAGGCCTGAGG + Intergenic
970188048 4:13483934-13483956 CCTTCTGGTTGTGTGGCCTGAGG - Intronic
979927293 4:126583177-126583199 CCTACTGGTGGTGTGCCCACTGG + Intergenic
982264868 4:153528958-153528980 CCTCCGAGAGTTGTGGCCTCCGG + Intronic
984187595 4:176564948-176564970 CCTCCAGCTGGTGTGGCCAATGG + Intergenic
985445483 4:190019108-190019130 CCTGCGCGTGGTCTGGCCGCCGG + Intergenic
987291088 5:16509075-16509097 CCTAAGGGTGGAGTGGCCACAGG + Intronic
991587515 5:68215661-68215683 GCTCTGGTTGGTGTGGGCTCGGG + Intergenic
991655684 5:68901893-68901915 CATCCGGGTGGAGTGGCTCCAGG - Intergenic
996054514 5:118968638-118968660 GGTCCTGGTGGTGTGGGCTCAGG - Intronic
998266617 5:140671800-140671822 CCTCCAGGTGGTGAGCCCTTTGG + Exonic
999253623 5:150196973-150196995 CAGCCGGGTGGAGTGGCTTCTGG - Intronic
1001675308 5:173507334-173507356 CCTCCCTGTGGGGTGGCCACAGG - Intergenic
1003628814 6:7768105-7768127 CCTCCAGGTGGTTTTGGCTCTGG + Intronic
1004324199 6:14659090-14659112 CCTCTGAGTCGTTTGGCCTCAGG - Intergenic
1007685576 6:43665520-43665542 CCTATGGGAGGTGTGGCATCTGG + Intronic
1007704242 6:43781333-43781355 CCTCACGGAGGTGGGGCCTCTGG + Intronic
1011259725 6:85458340-85458362 CATCCTGGGGCTGTGGCCTCAGG + Intronic
1014402349 6:121006243-121006265 CCTGAGGCTGGTGAGGCCTCAGG - Intergenic
1014913788 6:127120844-127120866 CCTCCGAATGGTGTGTACTCTGG + Intronic
1019162851 6:170080663-170080685 CATCCAGATGGTGTGGCCTCGGG - Intergenic
1019170802 6:170132270-170132292 CCTCCTCCTGGTGTGGCCTCGGG - Intergenic
1019634048 7:2066193-2066215 CCTCCGGCTGGTGGGGGCTCTGG - Intronic
1019759496 7:2799868-2799890 CCTCCGCTTGGTGTTGCCGCTGG - Intronic
1020958465 7:14772772-14772794 CCTCCTGGTGGTTTTGACTCTGG - Intronic
1022363340 7:29684964-29684986 CCTCGGGGGGGCGTGGCGTCGGG - Intergenic
1023879554 7:44310439-44310461 CCACTGGGTTGTGTGGCCTTGGG - Intronic
1027171959 7:75878959-75878981 CCTCTGGGAGGCGTGGCCTCCGG + Exonic
1032720385 7:134546733-134546755 CCTCCGGGTGGGGTGACCGAAGG - Intergenic
1034879589 7:154753061-154753083 CCTCCAGGAAGTGTGGCCACTGG + Intronic
1036786879 8:11693670-11693692 CCTCCTCCTGGTGTGGCCTCAGG - Intronic
1039964217 8:42271862-42271884 CATCCGGTTGCTGTGGCATCAGG - Intronic
1045467352 8:102482528-102482550 CCTCCTGGTTTTGGGGCCTCTGG + Intergenic
1048574765 8:135681757-135681779 CCTCTGGGTGATGTGGTGTCGGG + Intergenic
1049009256 8:139876354-139876376 GCTCCAGGTGGTCTGTCCTCGGG + Intronic
1049465385 8:142749112-142749134 GCTCCGGGTGGTGGGGCCCCTGG + Intergenic
1050271656 9:3952355-3952377 CCCCTGGGTGGTGGTGCCTCTGG - Intronic
1050418342 9:5437417-5437439 CCTCCGGAAGCTGTGGGCTCTGG - Intronic
1053157909 9:35792769-35792791 ACTGCGGGTGCTGTGGCCTCTGG + Exonic
1053656495 9:40222507-40222529 CCGCCTGGGGGTCTGGCCTCAGG - Intergenic
1053906845 9:42851725-42851747 CCGCCTGGGGGTCTGGCCTCAGG - Intergenic
1054528121 9:66153778-66153800 CCGCCTGGGGGTCTGGCCTCAGG + Intergenic
1054676226 9:67858481-67858503 CCGCCTGGGGGTCTGGCCTCAGG - Intergenic
1057204508 9:93163247-93163269 CCTCAGGCAGGTGTGGCCTGGGG + Intergenic
1058128357 9:101222226-101222248 CCTCAGGTTGGTGTGTCCTAGGG + Intronic
1059568242 9:115405992-115406014 CCACAGGGTGGTGGGGTCTCAGG - Intergenic
1059677648 9:116555219-116555241 CCTCTTGCTGGGGTGGCCTCTGG - Intronic
1060536897 9:124397337-124397359 ACTCCTGGTGGTGTGGCCCCTGG - Intronic
1060840826 9:126791959-126791981 CTTCCAGCTGGTGTGGCCCCTGG - Intergenic
1061220233 9:129246383-129246405 GCTACGTGTGGAGTGGCCTCAGG - Intergenic
1061578170 9:131520698-131520720 GCTCGGGGTGGGGCGGCCTCTGG - Intronic
1061961728 9:133992197-133992219 CCACCGGGTGGTGTGGCCCTCGG - Exonic
1062275462 9:135728399-135728421 CCTGCGGGTGGCTTGGCCGCTGG - Intronic
1062349693 9:136132878-136132900 CCTGCGCGTGGGGCGGCCTCAGG - Intergenic
1062442166 9:136575732-136575754 CCCGCTGGTGGTGCGGCCTCAGG - Intergenic
1062454269 9:136628426-136628448 CCTCCGGCCGCTGTGGCCACAGG - Intergenic
1203748452 Un_GL000218v1:57687-57709 CCGCCTGGGGGTCTGGCCTCAGG - Intergenic
1189422835 X:40871830-40871852 CCTGTGGGTGGCGTGGGCTCTGG + Intergenic
1189516620 X:41718964-41718986 CCACCTGGTGGCGTGGCCTGTGG + Intronic
1194591425 X:95804694-95804716 TCTCTGGGTGCTGGGGCCTCCGG + Intergenic
1195679998 X:107538086-107538108 CCTGTGAGTGGAGTGGCCTCAGG + Intronic
1195996570 X:110737691-110737713 CCTCCCTGGGGTGTGGACTCAGG - Intronic
1196843833 X:119882587-119882609 CCTGTGGGTTGTGTGGCCTTTGG + Intergenic
1199716075 X:150508212-150508234 GATCCGGATGGTGTGGCCTTGGG + Intronic
1200052446 X:153442204-153442226 CCTCACGGTGGCCTGGCCTCGGG - Intergenic