ID: 1105007068

View in Genome Browser
Species Human (GRCh38)
Location 12:132728079-132728101
Sequence GTGCACGGCCGGGAACTGAT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 58
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 53}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105007060_1105007068 25 Left 1105007060 12:132728031-132728053 CCTCTGTCTGTCCGAGGGTGAGT 0: 1
1: 0
2: 0
3: 4
4: 108
Right 1105007068 12:132728079-132728101 GTGCACGGCCGGGAACTGATGGG 0: 1
1: 0
2: 0
3: 4
4: 53
1105007062_1105007068 14 Left 1105007062 12:132728042-132728064 CCGAGGGTGAGTAGCACAGGACA 0: 1
1: 0
2: 1
3: 11
4: 163
Right 1105007068 12:132728079-132728101 GTGCACGGCCGGGAACTGATGGG 0: 1
1: 0
2: 0
3: 4
4: 53

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105007068 Original CRISPR GTGCACGGCCGGGAACTGAT GGG Exonic
905938097 1:41840720-41840742 TGGCACGGCCAGGATCTGATGGG - Intronic
907810570 1:57865661-57865683 GAGCACGGCCGCGAGCAGATGGG - Intronic
1064516916 10:16160006-16160028 TTTCAAGGCAGGGAACTGATTGG - Intergenic
1074383739 10:113000913-113000935 GTGGAAGGCCGGGAAGTGAAGGG - Intronic
1076123926 10:127959871-127959893 GTGCTTGGCAGGGCACTGATGGG + Intronic
1076776647 10:132701596-132701618 GAGCAGGGCCGGGAAGTGCTGGG - Intronic
1084510363 11:69599573-69599595 GTGCACGGCTGGGAACTCCAAGG - Intergenic
1093034575 12:14320479-14320501 GTGCACGGCAGGGGACTGGAAGG + Intergenic
1098556768 12:71827304-71827326 TTTCAAGGCAGGGAACTGATTGG + Intergenic
1103419394 12:120768260-120768282 GATCAAGGCCGGGAACAGATAGG + Intronic
1105007068 12:132728079-132728101 GTGCACGGCCGGGAACTGATGGG + Exonic
1108856472 13:54799698-54799720 GCACACGGCCGGGAACTGGCAGG - Intergenic
1110609756 13:77475471-77475493 GCGCACGGCCTGGGACTGATAGG - Intergenic
1137001778 16:35235377-35235399 GTGCATGGCCAGGAGCTGCTGGG - Intergenic
1137018059 16:35395246-35395268 GTGCATGGCCAGGAGCTGCTGGG - Intergenic
1138536428 16:57662815-57662837 CTGCACGGCCAGGAACAGAGGGG - Intronic
1141502689 16:84454752-84454774 GTGCATGGCCGGGCACTGGGAGG + Intronic
1143282169 17:5763028-5763050 GTGCCCAGCCTGGAACTGAATGG - Intergenic
1148771945 17:50072434-50072456 GTGCACAGTAGAGAACTGATGGG + Intronic
1148841632 17:50502538-50502560 ATGCATGGCTGGGAACTGAGGGG - Intergenic
1149755754 17:59184167-59184189 GAGCCCGGCCAGGAACTGACAGG - Intronic
1154172187 18:12060425-12060447 GCCCACGGCCGGGATCTGGTTGG + Intergenic
1160075465 18:75670885-75670907 CAGCACGGTGGGGAACTGATGGG - Intergenic
1160702507 19:514790-514812 AGGCCTGGCCGGGAACTGATGGG + Intronic
1162797792 19:13095588-13095610 GGGCAGGGGCAGGAACTGATGGG - Exonic
1167331545 19:48859405-48859427 GGGCAGGGCCGGAAACTGGTTGG - Intronic
935922622 2:108031930-108031952 GTGCACGGCGCGGGACTGGTGGG + Intergenic
936232944 2:110720179-110720201 GTGCAAGGCAGGGAAGTGGTAGG - Intergenic
938256345 2:129862520-129862542 GTGCACAGTCGGGAACTCAGAGG + Intergenic
948896787 2:240931360-240931382 GAGCACGGCAGGGAACTCACTGG + Intronic
1169935546 20:10879713-10879735 GTGGACGCCCGGGAAATGAATGG + Intergenic
1175210138 20:57348783-57348805 GCGCACGGCCTGGGACTGGTGGG + Intergenic
1179514585 21:41897888-41897910 GTGCACGGCAGGGCGCTGAGTGG + Intronic
1182257631 22:29050070-29050092 GTGCACCGCCGGGAGCTCCTCGG - Exonic
1182715458 22:32353780-32353802 GTGTACGGCAGGGAGCGGATTGG - Intergenic
1185179889 22:49353152-49353174 GGGCCCGGCAGGGAACTGAGGGG + Intergenic
1185298868 22:50068637-50068659 GGGCATGGCCGGGCACTCATGGG + Intronic
950557066 3:13702393-13702415 GCGCACGACAGGGAACTGAGAGG + Intergenic
958486674 3:94720587-94720609 GTGCATGGCTGGGAGGTGATAGG + Intergenic
961688876 3:128653784-128653806 GCGCACGGCCGGGGACTGGCAGG + Intronic
963742852 3:149097695-149097717 GTGCACGGCAGGGGACTGGCAGG - Intergenic
971905121 4:32716199-32716221 GTGCACGGCGCGGGACTGGTAGG - Intergenic
974781671 4:66561466-66561488 GTGCACGGAGGGGGACTGGTAGG - Intergenic
981038526 4:140197212-140197234 GTCCAGGGTCAGGAACTGATTGG - Intergenic
983494494 4:168427960-168427982 TTGCAGGGCCAGGAACTGATGGG - Intronic
1004905489 6:20233560-20233582 GTGCACGGCGGGGAACTGGCAGG + Intergenic
1006287038 6:33104576-33104598 GTGCAAGGGAGGGAACTGGTTGG - Intergenic
1006298872 6:33182785-33182807 GTGCAAGGGAGGGAACTGGTGGG - Intronic
1013639399 6:112058562-112058584 GTGCAAGGCAGGGAAGTTATAGG + Intronic
1018953790 6:168394803-168394825 GTGCTGTGCAGGGAACTGATGGG - Intergenic
1020074137 7:5246633-5246655 GAGCACGGCGGGGAACTCACAGG - Intergenic
1023623651 7:42096068-42096090 GTGCACTGCAGGGAGCTGACGGG + Intronic
1023732461 7:43205421-43205443 GAACACAGCCTGGAACTGATGGG + Intronic
1035603637 8:914593-914615 GTGCCCGGCCCAGAACGGATGGG - Intergenic
1040386478 8:46918049-46918071 GAGCACGGCAGGGAAGTCATAGG + Intergenic
1060629408 9:125143028-125143050 GTGCACGGTCGGGAACGGGTGGG - Intronic
1203785625 EBV:125998-126020 GTGCAAGGCCGGGGACAGACCGG + Intergenic
1196371201 X:114981819-114981841 GTGCACTGACAGGAAATGATTGG - Intergenic