ID: 1105013662 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 12:132773065-132773087 |
| Sequence | CCTTCTGGGGCAGCGGCGCA CGG |
| Strand | + |
| Crispr in exon? | Yes |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 166 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 16, 4: 149} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1105013656_1105013662 | 9 | Left | 1105013656 | 12:132773033-132773055 | CCACACAATCAAATAAATAACAT | 0: 1 1: 0 2: 3 3: 54 4: 612 |
||
| Right | 1105013662 | 12:132773065-132773087 | CCTTCTGGGGCAGCGGCGCACGG | 0: 1 1: 0 2: 0 3: 16 4: 149 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1105013662 | Original CRISPR | CCTTCTGGGGCAGCGGCGCA CGG | Exonic | ||