ID: 1105013662

View in Genome Browser
Species Human (GRCh38)
Location 12:132773065-132773087
Sequence CCTTCTGGGGCAGCGGCGCA CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 149}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105013656_1105013662 9 Left 1105013656 12:132773033-132773055 CCACACAATCAAATAAATAACAT 0: 1
1: 0
2: 3
3: 54
4: 612
Right 1105013662 12:132773065-132773087 CCTTCTGGGGCAGCGGCGCACGG 0: 1
1: 0
2: 0
3: 16
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105013662 Original CRISPR CCTTCTGGGGCAGCGGCGCA CGG Exonic