ID: 1105013877

View in Genome Browser
Species Human (GRCh38)
Location 12:132774196-132774218
Sequence TCCTTGCTCACGGCGGGCGG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 106}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105013877 Original CRISPR TCCTTGCTCACGGCGGGCGG TGG Exonic
900119937 1:1044271-1044293 CCCTGGCTCTCGGCGGGCGGCGG + Intronic
900773487 1:4563980-4564002 TCCTTGCTCACAGGAGGAGGCGG - Intergenic
901086104 1:6613418-6613440 GCCTTGGTCTCGGCGGGCGCGGG - Intronic
903420977 1:23217583-23217605 GCCTTCCTCCGGGCGGGCGGGGG - Intergenic
904645445 1:31962382-31962404 TCCTTGAACTCGGGGGGCGGAGG - Intergenic
906203493 1:43974854-43974876 GCCTTGCTCTAGACGGGCGGCGG + Exonic
917433920 1:174999956-174999978 TGCGTGCTCGCGGTGGGCGGTGG + Exonic
919793861 1:201309360-201309382 TCCTGGCTCACCTCGGGCTGTGG + Intronic
920331455 1:205211321-205211343 TCCTCCCTCACGGGCGGCGGCGG - Exonic
1063390415 10:5646490-5646512 ACCTTGCTCAGGGAGGCCGGAGG + Intronic
1070148059 10:73788973-73788995 TCCTTCCCCAGGGCGGGGGGTGG - Intronic
1072622551 10:97089658-97089680 TCCTTACTCATGGCTGGGGGAGG + Intronic
1073204667 10:101762566-101762588 TCCTTGCAGAGGGCGGGAGGGGG + Intergenic
1076187515 10:128460852-128460874 TCCTTGCTCAGGGGGTGAGGTGG - Intergenic
1076785596 10:132748338-132748360 CCCGTGCTCATGGCGGGCAGAGG - Intronic
1083753846 11:64778505-64778527 TCCTCTCACGCGGCGGGCGGCGG + Intronic
1084070101 11:66728265-66728287 GCCGGGCGCACGGCGGGCGGCGG + Intronic
1090666738 11:128919305-128919327 TCCTGGCTCACGGAGGGCCCTGG - Exonic
1097098046 12:56565672-56565694 TCCCTGCTCACAGCGGACAGAGG - Intronic
1097242350 12:57584065-57584087 GCCTGGGTCACGGGGGGCGGTGG + Intronic
1103856129 12:123972576-123972598 TCGGTCCTCCCGGCGGGCGGCGG + Exonic
1104000518 12:124857065-124857087 TGCATGCTTAAGGCGGGCGGCGG - Intronic
1104681506 12:130755162-130755184 TCCTGGCACACGGCAGGCGCTGG - Intergenic
1105013877 12:132774196-132774218 TCCTTGCTCACGGCGGGCGGTGG + Exonic
1105406626 13:20137490-20137512 CCCTTGCTCACTGCGGGCCAGGG - Intergenic
1114302470 14:21390692-21390714 TGCTTGAACCCGGCGGGCGGAGG + Intronic
1118322004 14:64758772-64758794 TCCTTGCTCACGGGGGAGGAGGG + Intronic
1120856695 14:89218713-89218735 TCCTTGCACACGTCTGGCTGTGG + Intronic
1122211721 14:100178100-100178122 TCCCTGCTCCCGGCGAGCGTTGG - Intergenic
1122275103 14:100587147-100587169 TCCCTGCTCAGCGCGGGAGGTGG - Intronic
1122621033 14:103057687-103057709 TCCCTGCTCCCGGCGGGCTCGGG + Intergenic
1124611905 15:31215125-31215147 TCCTAGCACGCGGGGGGCGGGGG + Intergenic
1131197104 15:90364342-90364364 TCCCTGCTCATGGCTGGCGGGGG - Intronic
1137765868 16:50977268-50977290 TTCATGCTCGCGGCGGGGGGAGG - Intergenic
1138105377 16:54284886-54284908 TCCAGGCTCACGGGGGGCGACGG + Exonic
1138450976 16:57093166-57093188 CCCTGGCTCTCGGCGGGCGCTGG + Intronic
1140368470 16:74399164-74399186 TCCTTGAACACGGGAGGCGGAGG - Intergenic
1141831758 16:86513008-86513030 TCCATGCACTCGGCCGGCGGGGG + Exonic
1143089076 17:4438075-4438097 TCCTTGCTCAGGGAGGGACGTGG - Intronic
1143164131 17:4889542-4889564 TCCTTGCTCACCACGGAGGGTGG - Intronic
1143372720 17:6450281-6450303 TCCCTGCTCACTGCGGGGTGGGG - Intronic
1143504435 17:7356038-7356060 TTCCTACTCACGGCAGGCGGGGG - Exonic
1144846532 17:18222819-18222841 TGCTTGAACCCGGCGGGCGGAGG - Intergenic
1146799805 17:35809522-35809544 TCGTTGTTCTCGGCGGGCTGTGG + Exonic
1147195520 17:38763918-38763940 TCCTTCCTCACCACAGGCGGAGG + Intronic
1147307523 17:39574021-39574043 TCTTTGCTGAGGGCGGGCCGAGG - Intergenic
1147559333 17:41499348-41499370 GCCTTCCTCAAAGCGGGCGGGGG - Intergenic
1148069425 17:44899441-44899463 TCCTTCCTGGCGGCGGGCGCAGG - Exonic
1148225608 17:45896252-45896274 TCCGTGCGCGCTGCGGGCGGCGG + Intronic
1149738168 17:59016308-59016330 CACTTGAACACGGCGGGCGGAGG + Intronic
1151660587 17:75516186-75516208 TCCTTGCCCAGCCCGGGCGGTGG + Intronic
1152433812 17:80263300-80263322 GCCTTGCTCAGGGCAGGCCGTGG + Intronic
1152448780 17:80363325-80363347 GGCTTGCTCAGGGCAGGCGGAGG - Intronic
1152654903 17:81514870-81514892 GCCTGAGTCACGGCGGGCGGGGG + Intronic
1155663536 18:28280142-28280164 TCCTGACTCACGGGTGGCGGAGG + Intergenic
1161069650 19:2253709-2253731 TCCTCGCTCAGGGCCGGGGGCGG + Exonic
1161365625 19:3877777-3877799 TCCCAGCTCACGGCTGGCAGAGG - Intergenic
1161376391 19:3941200-3941222 GCCTTGCCCCGGGCGGGCGGGGG + Intronic
1162924578 19:13923772-13923794 CCTTTGCTCAAAGCGGGCGGTGG - Exonic
1165056167 19:33177453-33177475 TGCTTCCTCAGGGCGGGCGGTGG + Intergenic
1165571191 19:36776076-36776098 TCCTGGTTCTCGGCGGGCTGTGG - Exonic
1166703196 19:44893909-44893931 TCCCTGCTCACGGTGGCCGAGGG - Intronic
1167300555 19:48675101-48675123 ACCTTCCTCATGGTGGGCGGAGG + Intergenic
1168694364 19:58396375-58396397 TCGTTGGCCACGGCGGGCGGCGG + Exonic
928916689 2:36479548-36479570 TCCTTGCCCACGGAGACCGGTGG + Exonic
929999269 2:46849950-46849972 TCCTTGCTGAGAGCAGGCGGAGG + Intronic
935055767 2:99565294-99565316 CCCTTGCTCACGGAGGACAGAGG + Intronic
935701090 2:105812567-105812589 TCCTTGGTCAGGGAGGGAGGAGG + Intronic
942273855 2:174303659-174303681 TCCTTTCTCACTGGGCGCGGTGG + Intergenic
945095377 2:206214253-206214275 TCCTTGAACACGGGAGGCGGAGG - Intronic
946024317 2:216662761-216662783 TGCTTGAACACGGCAGGCGGAGG - Intronic
947984761 2:234438534-234438556 TCCTGGCTCTCGGCGGGCTGGGG + Intergenic
1174151734 20:48490584-48490606 TCCTTGAACATGGCGGGTGGAGG - Intergenic
1174386670 20:50191535-50191557 GCCTTGAGCTCGGCGGGCGGCGG - Exonic
1174494716 20:50931276-50931298 TCATGGATCCCGGCGGGCGGCGG + Intergenic
1181482767 22:23211567-23211589 TCCTTGAACCCGGCAGGCGGAGG - Intronic
1184260188 22:43310492-43310514 TCTTTGCTCACAGCTGGTGGTGG - Intronic
1184439142 22:44498075-44498097 ATCTTGGTCACGGCCGGCGGCGG - Exonic
1184680734 22:46071185-46071207 CCCTTGCCCGGGGCGGGCGGCGG + Intronic
952114021 3:30158138-30158160 TCCTTGCTGAAGGCAGGCCGAGG + Intergenic
953562069 3:43999258-43999280 CCCTTACTCGCGGGGGGCGGGGG - Intergenic
973279300 4:48342025-48342047 TCCTTGCTAGCGGCGGGCGAGGG + Exonic
973803492 4:54501136-54501158 TCCTTGGTCATGGCAGACGGTGG - Intergenic
981243064 4:142501926-142501948 TCCATGCTCACGGGTGGAGGTGG - Intronic
981579562 4:146238186-146238208 TCCTTGTTCCAGGCTGGCGGAGG - Intergenic
984581139 4:181511411-181511433 TCCTTGCTCAGGCCTGGAGGAGG + Intergenic
984973519 4:185210240-185210262 TACTTACCCCCGGCGGGCGGCGG - Intronic
985614974 5:914793-914815 CCCTTGCTCAGGGAGGGCGCTGG + Intronic
987100022 5:14582729-14582751 TGCTTGAACCCGGCGGGCGGAGG + Intronic
990165502 5:52989329-52989351 TCCCTGCTCTCACCGGGCGGGGG + Exonic
1001989474 5:176104479-176104501 TCCTTGCTCAAGATGGGTGGTGG - Intronic
1016597204 6:145815334-145815356 CCCTGGATCCCGGCGGGCGGCGG + Intergenic
1019174060 6:170150966-170150988 GCCTTGCTGACTGCAGGCGGAGG + Intergenic
1024089090 7:45920962-45920984 TCCGCGCACACGGCGGGCGGAGG + Exonic
1027374399 7:77536704-77536726 TCCCAGCCCACGGCTGGCGGCGG + Intergenic
1030095240 7:105892750-105892772 TCATTGCTCAGGGAGGGCTGTGG + Intronic
1032151619 7:129434394-129434416 GCCTGGCTCCCGGCGCGCGGCGG + Intronic
1035251990 7:157603779-157603801 TCCCGGCTCACGCTGGGCGGTGG - Intronic
1036207320 8:6814917-6814939 TTCTTGCTCACAGCAGCCGGGGG - Intronic
1039854234 8:41398644-41398666 TCCTTCCTCAGGGCAGGCAGGGG + Intergenic
1042367344 8:67952383-67952405 TCCTCGCTCATGGTCGGCGGCGG - Exonic
1044670563 8:94676266-94676288 TGCTTGATCACGGGAGGCGGAGG + Intronic
1048265548 8:132982314-132982336 TCCTTGCTCACAGGGAGCTGCGG - Intronic
1049580226 8:143407651-143407673 CGCTTCCTCATGGCGGGCGGGGG + Intergenic
1049585389 8:143430480-143430502 CCCCTGCTCCCCGCGGGCGGCGG + Intergenic
1049657231 8:143804239-143804261 TCCTTGGGGATGGCGGGCGGGGG + Intronic
1053241573 9:36499866-36499888 TCTTTGCTCTCAGCGGGCAGTGG - Intergenic
1061975890 9:134067904-134067926 TCCTTGCGCGCGCGGGGCGGCGG - Intronic
1062413953 9:136438821-136438843 TCCAGGCTCAGGGCAGGCGGTGG + Exonic
1192153786 X:68728074-68728096 TCCTTGCTCAAGGCCTGGGGGGG + Intergenic
1192230828 X:69263856-69263878 CCCTTGCTCACTGCGGGGAGGGG + Intergenic
1193024312 X:76828544-76828566 TTCTTGCTCACTGTGGGCTGTGG + Intergenic
1198228528 X:134668855-134668877 TACTTGCTCACTGGGGGAGGTGG - Intronic
1200065660 X:153503112-153503134 TCCTTGCTACCAGCGGGCCGGGG - Intronic