ID: 1105014433

View in Genome Browser
Species Human (GRCh38)
Location 12:132777494-132777516
Sequence GAGGCTCAGGATTCTGGAGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 386
Summary {0: 1, 1: 0, 2: 1, 3: 34, 4: 350}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105014420_1105014433 25 Left 1105014420 12:132777446-132777468 CCTGCTGGGGCGCTTTCTCTCTT 0: 1
1: 0
2: 0
3: 15
4: 199
Right 1105014433 12:132777494-132777516 GAGGCTCAGGATTCTGGAGACGG 0: 1
1: 0
2: 1
3: 34
4: 350

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105014433 Original CRISPR GAGGCTCAGGATTCTGGAGA CGG Intronic
900462315 1:2807592-2807614 GAGGCTCAGGGTGCAGGAGAGGG - Intergenic
900483955 1:2912725-2912747 GAGGCTCTGGCTGCTGGGGATGG - Intergenic
900555759 1:3279612-3279634 GTGGCACAGGAGTCTGGAGAGGG - Intronic
900608699 1:3535432-3535454 GAGGGGCAGCCTTCTGGAGAGGG - Intronic
900885726 1:5414060-5414082 GATGCCCAGGATGCTGGAGGGGG - Intergenic
901093169 1:6657094-6657116 GAGGTTCAGGATCAAGGAGAGGG - Intronic
901427458 1:9191520-9191542 GAGAGCCAGGCTTCTGGAGACGG - Intergenic
901645954 1:10716848-10716870 GTGGCTAAGGAAGCTGGAGAGGG - Intronic
901677789 1:10897087-10897109 GAGGCTCAGGCTGCCGGGGAGGG - Intergenic
902535947 1:17119436-17119458 GGGGCGCAGGCTGCTGGAGAAGG - Intergenic
903133216 1:21292584-21292606 AAAGCTGTGGATTCTGGAGAGGG - Intronic
904915690 1:33968747-33968769 GTGGGTCAGGATTCTGGGTATGG - Intronic
905961360 1:42045124-42045146 CAGGCTCAAGATCATGGAGATGG + Intergenic
906076889 1:43058544-43058566 GAGGCTCAGGATTGCTGAGCTGG + Intergenic
906291124 1:44619798-44619820 GAGGCTGAGGAGTCTGCTGAAGG - Intronic
907229089 1:52978409-52978431 GAGTCTCATGATTCTTGTGATGG + Intronic
908135975 1:61133087-61133109 GAGGTTCAAAATTATGGAGAGGG - Intronic
910201879 1:84708442-84708464 GAGGCTCAGGGCTCAGCAGAGGG - Intergenic
910523114 1:88146088-88146110 AAGGCTCAGGAGTATGAAGAGGG - Intergenic
911518435 1:98898285-98898307 GACACTAAGGATTCTGGAGAAGG + Intronic
913446872 1:118959476-118959498 GAGGCTCCAGATTCTGTAGCTGG + Intronic
915256678 1:154636776-154636798 AGGGGTCAAGATTCTGGAGAAGG + Intergenic
915799102 1:158769629-158769651 GAATTTCAGGATCCTGGAGAGGG - Intergenic
916687950 1:167164530-167164552 GAGGATCAGGAATGTAGAGAGGG - Intergenic
917722262 1:177796934-177796956 AAGGCTCAGTATTCTGGGAAAGG + Intergenic
920438131 1:205961350-205961372 GAGGCTCAGGAGCCTTGAGCTGG + Intergenic
921042117 1:211442825-211442847 GCTGCTCAGGGCTCTGGAGATGG - Intergenic
921780483 1:219157179-219157201 GAGGCTCAGAATACAGGAGATGG - Intergenic
921959924 1:221023949-221023971 GAGTCTGAAGATTCAGGAGAAGG - Intergenic
922433495 1:225580484-225580506 GAGGGTCAGGATTCTGGGTTTGG - Intronic
922812673 1:228426427-228426449 GAGCCTTAGGATTCTGAAGAAGG + Intergenic
923480344 1:234377730-234377752 GAGGGGCAGGTCTCTGGAGAAGG + Intronic
924335885 1:242986530-242986552 GAGTCTTAGGATTCTAGATATGG - Intergenic
1062813947 10:485564-485586 GAGGCTCAGGCTGCAGGAAACGG - Intronic
1064398762 10:15003002-15003024 GAGCCTCAGGATACAGGTGATGG + Intergenic
1064550074 10:16491733-16491755 GAGTCCCAGCATTCTGGAGGGGG - Intronic
1064605695 10:17036441-17036463 GAGGCTGAGAAGCCTGGAGAAGG - Intronic
1064920322 10:20509616-20509638 ATGGCTCTGGATTCTGGTGAGGG - Intergenic
1067349065 10:45459290-45459312 GAGGCTCAGGCTTCTGGGGAAGG + Intronic
1070530723 10:77335074-77335096 CAGGCACAGGAGTGTGGAGAAGG + Intronic
1072334763 10:94388170-94388192 GTGGCCCATGACTCTGGAGAGGG - Intergenic
1074470246 10:113720333-113720355 TAGGATCAGAAATCTGGAGATGG - Intronic
1075446685 10:122518229-122518251 GAGGCTGAGGAGTCTGGAGCAGG + Intergenic
1075473663 10:122713829-122713851 GAAGCTCAAGATGCTGGTGATGG + Intergenic
1076562869 10:131378317-131378339 CAGGCTCAGTAGGCTGGAGAGGG - Intergenic
1077148218 11:1055368-1055390 GAGGCTCAGGAGACTGGGGTGGG - Intergenic
1077630190 11:3806439-3806461 GGGGCTCCGAAGTCTGGAGAAGG - Intronic
1079966363 11:26984908-26984930 TTGGCTCATGATTCTGGAGCTGG - Intergenic
1081129061 11:39354414-39354436 GGGGGTCAGGAATCTGGACATGG - Intergenic
1081516508 11:43836335-43836357 GATGCTTAGGATGCAGGAGAAGG + Intronic
1081586737 11:44390212-44390234 GTGGATCAGGAATCTGGACATGG + Intergenic
1081847779 11:46253126-46253148 GAGGCTCAGGAATCTGCCTAAGG + Intergenic
1082959093 11:58901996-58902018 GAGCCTCTGGAGTCTGGAGGTGG + Intronic
1082974621 11:59059579-59059601 GAGCCTCTGGAATCTGGAGGGGG + Intergenic
1083631362 11:64097163-64097185 CAGGCTCAGGATGCTGCAGAGGG - Intronic
1084429777 11:69104737-69104759 GGGGCTCAGGCATCTGGAGATGG + Intergenic
1084610135 11:70196933-70196955 GGGCCTCTGGATGCTGGAGAAGG - Intergenic
1085112763 11:73902598-73902620 GAGACTTAGGATTCTGTAAAGGG - Intronic
1085297605 11:75439782-75439804 GAGGCCCAGGGCTCAGGAGAGGG + Intronic
1085423932 11:76386340-76386362 GAGGATCAGAATTCAGAAGATGG - Intronic
1085561895 11:77479333-77479355 GTGGGTCAGGAGTCTGGAAATGG - Intergenic
1088994842 11:114987313-114987335 GTGACTCTGGATTCTGCAGATGG + Intergenic
1089125615 11:116174560-116174582 GAGGCAGAGAATTCTGGAGAGGG + Intergenic
1089398673 11:118152283-118152305 GAGGTTCAGGATGCTGGAGGAGG - Intronic
1089576043 11:119444776-119444798 GAAGCTGAGCCTTCTGGAGATGG - Intergenic
1089696966 11:120221890-120221912 GAGGCTCAGGACCCAGGATAGGG - Intronic
1089905185 11:122031224-122031246 GAGGTGCAGGAGTGTGGAGAGGG + Intergenic
1090067020 11:123511693-123511715 AAGGCTCAGACTTCTGGAGCAGG + Intergenic
1090839539 11:130476171-130476193 AAGGCACAGGTTTCTGGTGATGG + Exonic
1090987433 11:131781864-131781886 GAGGCTGAGGAGACTGCAGAAGG + Intronic
1093053630 12:14532856-14532878 CAGTCTCAGGATGCTGGAGGGGG + Intronic
1093366204 12:18302494-18302516 GATCCTCAGGACTCTGGATAAGG + Intronic
1094348458 12:29497565-29497587 GAGGCTGAGCGTGCTGGAGAGGG - Intronic
1094442998 12:30500280-30500302 GAGGCACAGGAATCAGGAAAGGG - Intergenic
1094576676 12:31693187-31693209 GCTGCTCAGGAGTCTGGAGTGGG - Intronic
1095454639 12:42370182-42370204 GTGACTCAGGATTCTGCATAAGG - Intronic
1095506702 12:42906130-42906152 GAGGTTCCAGATTCTGGAAATGG + Intergenic
1096468508 12:51862113-51862135 TAGTCTTAGGCTTCTGGAGAGGG + Intergenic
1096481369 12:51943474-51943496 GAGCCTGTGGATTCTGAAGAAGG + Intergenic
1096530471 12:52239524-52239546 CAGGCTAAGGATTCGGGAGGAGG + Intronic
1098629168 12:72706184-72706206 GAGGCTTTGGATTGTGAAGAAGG - Intergenic
1099694015 12:85995346-85995368 GAGACTCAGAATTCTGCAGACGG + Intronic
1102010521 12:109615774-109615796 CTGGCTGAGGATTCTGGAGGGGG + Intergenic
1102498097 12:113333264-113333286 GAGTCTCAGGCTTCTGGGGCAGG + Intronic
1103916917 12:124380505-124380527 GAGGCTCAGGATTCGGGGCAGGG - Intronic
1104172743 12:126298182-126298204 GAGGGTCAGGAATCTGGGAAAGG + Intergenic
1105014433 12:132777494-132777516 GAGGCTCAGGATTCTGGAGACGG + Intronic
1105627532 13:22127250-22127272 GAGCCTGAGAATTCTGGTGATGG + Intergenic
1106915266 13:34507066-34507088 GAGGATCAGGTCTTTGGAGAAGG - Intergenic
1107979507 13:45720992-45721014 CAGGGTCAGGCTTCTGGAGATGG + Intergenic
1108206375 13:48094654-48094676 GGGGCTCAGCATTGGGGAGACGG - Intronic
1109476730 13:62888030-62888052 GAGGCTCGGAACTCTGGACAGGG - Intergenic
1112412982 13:99179739-99179761 GAGGCACTGGCTTCTGGTGAGGG - Intergenic
1112596691 13:100814189-100814211 GAGTCTCTGGACTCTGGAAAAGG - Intergenic
1115470452 14:33763458-33763480 GAGGCTTAGGGTTTTGGTGATGG + Intronic
1115940932 14:38608875-38608897 GAGGGCAAGGTTTCTGGAGAGGG - Intergenic
1117071715 14:52063405-52063427 CAGGCTCTGGTTTCTGCAGAGGG - Intronic
1117228756 14:53693083-53693105 GAGGCACAGCATTCTGCATATGG - Intergenic
1117440488 14:55754659-55754681 GTGGCTCAGGAATCTGGGCATGG + Intergenic
1118662273 14:68028017-68028039 GAGGGTCAGGACTCTGTACAGGG + Intronic
1119731164 14:76952091-76952113 GAGGATAAGGATGCTGGAGTCGG - Intergenic
1119771531 14:77223076-77223098 GAGGCTCTGCACTTTGGAGAGGG - Intronic
1120914447 14:89698329-89698351 GAGGATCAGGATTCTGACCAAGG - Intergenic
1121683910 14:95817480-95817502 GAGGCTTAGGAGTGTGGGGAGGG - Intergenic
1121830856 14:97050877-97050899 GAGTCTCAGGATACTGGGGAGGG + Intergenic
1123409110 15:20043992-20044014 GGGGCTCTGGGTTCTGAAGAGGG - Intergenic
1123518441 15:21050700-21050722 GGGGCTCTGGGTTCTGAAGAGGG - Intergenic
1124051593 15:26201632-26201654 GGTGCTAAGGATACTGGAGAGGG + Intergenic
1127605516 15:60583529-60583551 GAGGCTGGGGCTTCTGGACAAGG + Intronic
1127609540 15:60623256-60623278 GACCCCCAGGAATCTGGAGAGGG + Intronic
1128158237 15:65405544-65405566 GAGGGTCAGGGTTGTGAAGAAGG - Intronic
1128229399 15:66024277-66024299 CAGGTTCAGAATTCTGGAGCTGG - Intronic
1128559538 15:68655566-68655588 GAGGGCAAGGATTCTGGGGAAGG - Intronic
1129165618 15:73775487-73775509 GAGGCTGAGGAGTAGGGAGAGGG + Intergenic
1130078555 15:80710911-80710933 GTGGCTCAGGATTGTGGGGCAGG + Intronic
1130669428 15:85898572-85898594 GAGCCACAGGATGCTGCAGAAGG - Intergenic
1131523446 15:93134247-93134269 GATGCTCAGGACTATTGAGAAGG - Intergenic
1132378290 15:101347597-101347619 GAGGCTCAGCACTTTGGACATGG - Intronic
1132709168 16:1258868-1258890 GAGGCTCAGGATGGAGGAGGGGG - Exonic
1132743669 16:1428073-1428095 GAGCCTCTGGATGCTGGAGGGGG - Intergenic
1132890620 16:2202622-2202644 CAGGCCCAGGAGTCTGGAGAGGG + Intergenic
1133098828 16:3466818-3466840 GGGGCTCTGGATTTTGCAGAGGG + Intronic
1133233059 16:4375326-4375348 GAGGCTCTGTATCCTGGAGCAGG - Intronic
1133414535 16:5596080-5596102 CAGGCTCAGGGATGTGGAGAGGG + Intergenic
1134055258 16:11166001-11166023 GAGTCTCAGGCTTCTGCTGATGG - Intronic
1134829838 16:17314008-17314030 GAGGGTCAGGACACTGGAGAGGG + Intronic
1136284501 16:29233208-29233230 GAGGCTGAGGATGCTGCACAGGG - Intergenic
1136451919 16:30358385-30358407 GAGGCTGAGGAGGCTGGAGGAGG + Exonic
1137463842 16:48690194-48690216 AAGGCTTAGGATACTGGAGCTGG - Intergenic
1138624254 16:58236645-58236667 GAGGGACAGGATTATGGGGAAGG + Intronic
1139426761 16:66885361-66885383 GCAGCGCAGCATTCTGGAGAGGG + Exonic
1141404795 16:83782975-83782997 GAGGCACAGAACTCTGGTGATGG + Intronic
1141763050 16:86041442-86041464 AAGGCTTAGGATTTTGGCGAAGG - Intergenic
1143151749 17:4811209-4811231 GAGGGTCAGTATTGTAGAGAGGG - Intronic
1143679236 17:8464007-8464029 AAGGATCAGGACACTGGAGAGGG - Intronic
1143974490 17:10820034-10820056 CAGGCTCAGGGCTCTGGGGATGG + Intergenic
1144036152 17:11367728-11367750 GAGGCTGAGGATGCTGAGGATGG + Intronic
1144608955 17:16691381-16691403 GAGACTCAGAATTCTGGTGATGG - Intronic
1144903808 17:18624124-18624146 GAGACTCAGAATTCTGGTGAGGG + Intergenic
1145128770 17:20322597-20322619 GAGACTCAGAATTCTGGTGATGG - Intergenic
1145195904 17:20895012-20895034 GAGACTCAGAATTCTGGTGAGGG + Intronic
1145902082 17:28495953-28495975 GTGGCTCAAGAGCCTGGAGAAGG - Intronic
1146815583 17:35939432-35939454 GAGCCTGGGGAATCTGGAGAGGG + Exonic
1146936198 17:36814055-36814077 GAGGCTCAAGGTTGTGGAGTGGG - Intergenic
1148452555 17:47789684-47789706 GAGGCGCAGAATTTTGGAGTGGG - Intergenic
1149469475 17:56904021-56904043 CTGGCTCAGGAATCTGGACATGG - Intronic
1149523547 17:57336855-57336877 GAGGGTCAGGAATCTGGAGTGGG + Intronic
1150372198 17:64649411-64649433 ATGGCTCAGGATTTTGGAGTTGG - Intronic
1150433979 17:65139919-65139941 GATGTTCAGCTTTCTGGAGAAGG + Intronic
1150680882 17:67283490-67283512 GAAGCTCAGGATTTTGGGGAGGG + Intergenic
1151358223 17:73572725-73572747 GATGCTCAGCTTGCTGGAGAAGG + Intronic
1151405333 17:73882463-73882485 AAGGCTCAGAGATCTGGAGAGGG - Intergenic
1152282931 17:79396067-79396089 GATGCTCAGAGTTCTGGGGAAGG - Intronic
1152557117 17:81058970-81058992 GAGCCTCAGCATTAGGGAGACGG - Intronic
1153666286 18:7370030-7370052 GGGGCTCAGGATACTGAGGATGG + Intergenic
1153786191 18:8537407-8537429 GAGGCTCCCACTTCTGGAGAAGG + Intergenic
1154269056 18:12903581-12903603 GAGCTTCAGGATGCTGAAGAGGG - Intronic
1155226857 18:23736901-23736923 GTGGCTGAGCATTCTGGAGAGGG - Intronic
1155923917 18:31633703-31633725 GAGGCTGTGCACTCTGGAGAAGG - Intronic
1156399051 18:36724476-36724498 GAGTCACAGGATTCCTGAGAAGG - Intronic
1157200827 18:45658156-45658178 GAGGCCCAGGAAGCTGGGGAGGG + Intronic
1157438818 18:47694243-47694265 TAGGGGCAGGATTCTGGAGTTGG + Intergenic
1158805655 18:60968921-60968943 GAGGCCAGGGATTCTGGAGCAGG - Intergenic
1160015353 18:75135822-75135844 AAGGCAAAGGTTTCTGGAGAAGG + Intergenic
1160154002 18:76419097-76419119 GAGGCTCAGGTTTCCAGAGTAGG - Intronic
1160231358 18:77052043-77052065 GAGGATGAGGAGGCTGGAGAAGG + Intronic
1160414232 18:78696914-78696936 GAGGCTGAGTTTTGTGGAGATGG - Intergenic
1160997511 19:1890149-1890171 GAGCCAGAGGATGCTGGAGAAGG - Intergenic
1161332657 19:3695656-3695678 GAGGCTGAGGACACTGGGGACGG - Intronic
1161872270 19:6879275-6879297 GAGGATCAGGAGTCTGGGGGTGG + Intergenic
1163878570 19:19897815-19897837 ATGGCCCATGATTCTGGAGAGGG - Intergenic
1166105588 19:40596717-40596739 GAGACTGAGGATTCTGCAAATGG - Intronic
1166747327 19:45147536-45147558 GGGTCTCAGGATGCTGGATATGG + Intronic
1167470556 19:49673461-49673483 GAGGGTCAGGACACTGGAGTGGG - Intronic
1167657360 19:50773681-50773703 GAGGCTCAGAACTCTGCACAAGG - Intergenic
1168277721 19:55286449-55286471 GAGGCTGGGGGTTCAGGAGAAGG + Intronic
925162786 2:1697733-1697755 GGGGCTGAGGGTACTGGAGAGGG + Intronic
925468818 2:4136482-4136504 GAGGCTGAGGATGCTGCAGCAGG + Intergenic
927227355 2:20781802-20781824 GAAGCTGTGGTTTCTGGAGAGGG - Intronic
928106744 2:28475428-28475450 GAGGCTCATGGTGGTGGAGAAGG - Intronic
929269366 2:39956740-39956762 TAGGCTCAGAATTGTGGAGGCGG + Intergenic
929294067 2:40226556-40226578 GTCACTCAGGATTCTGGAAAGGG + Intronic
930402165 2:50904090-50904112 GAGCCTAAGGGTTCTGGGGAGGG - Intronic
930875448 2:56210493-56210515 GTGGCTCAGGAATTTGGACAAGG + Intronic
930945018 2:57062762-57062784 CAGGGTCAGGATTCTGGGAATGG - Intergenic
935180789 2:100689526-100689548 GAGGCTCAGCATTCTGGGTAAGG + Intergenic
935634887 2:105242652-105242674 GAGGATCAGGATGGTGGTGAAGG - Exonic
936684639 2:114813494-114813516 TAGGCACAGGATTGTTGAGAAGG - Intronic
937583143 2:123513642-123513664 GAGGCTAAGCATTCTGGAAATGG - Intergenic
937857796 2:126685214-126685236 GATGCTCAGGAATCTAGAGTAGG + Intronic
937876670 2:126831167-126831189 GAGGGTCAGGAATTTGGATAGGG - Intergenic
938056621 2:128220283-128220305 GGGGCGCAGGATGCTGGAGGTGG + Intergenic
938271503 2:129976054-129976076 GAGGCTCAGGAGCCTGCAGTGGG - Intergenic
940018958 2:149136402-149136424 GAGTCTCTGGATGCTGGAGTTGG - Intronic
944684597 2:202106853-202106875 GAGGCTCAGTTTTCTGAAAATGG - Intronic
946043002 2:216798459-216798481 GAGGCTCAGTAGGATGGAGAAGG + Intergenic
946166873 2:217869786-217869808 GAGCCCCAGGACTCTGGTGAGGG + Intronic
946336508 2:219040861-219040883 GAGGCTGAGGCTCCGGGAGATGG - Intronic
946374472 2:219299774-219299796 CAGGCTCAGGGGCCTGGAGATGG + Exonic
946894929 2:224313956-224313978 CAGGATCAGGACTCTGGGGAAGG - Intergenic
947745778 2:232506648-232506670 GAGGCTCAGGATCAAGTAGAGGG - Intergenic
948596710 2:239084032-239084054 GAAGCTTAGGTTTCTGGAAACGG - Intronic
948604043 2:239123516-239123538 CAGGCTCAGGATTGAGGAGATGG - Intronic
1169140450 20:3224603-3224625 GAGGCTCAGGAGGCTGGGCAGGG - Intergenic
1169550717 20:6698493-6698515 GAGGATTAGTATTCTGGAGATGG - Intergenic
1169974582 20:11310238-11310260 GATGAACAGAATTCTGGAGATGG - Intergenic
1170539188 20:17371014-17371036 GAGGCACTGGGTCCTGGAGATGG - Intronic
1170814318 20:19699817-19699839 GAGGCTGAGGCTTTTGGGGAGGG + Intronic
1171401338 20:24874583-24874605 GAAGCACAGGTTGCTGGAGAAGG - Intergenic
1172943605 20:38671531-38671553 GAGGCTCGGGAGTGTGGACAGGG - Intergenic
1173764877 20:45598178-45598200 GAAGCTAAGGGTGCTGGAGATGG + Intergenic
1174291837 20:49514335-49514357 GGGCTTCAGGATTCTTGAGAAGG + Exonic
1174385486 20:50186472-50186494 GAGATCCAGGATTTTGGAGACGG - Intergenic
1174393992 20:50234693-50234715 GAGGCTCTGGATTCAGGCCAGGG + Intergenic
1175085856 20:56458330-56458352 GAGGGCCAGGATTCTAAAGAAGG - Exonic
1175216969 20:57396378-57396400 GAGGTGCAGCAGTCTGGAGAGGG + Intronic
1175714855 20:61248401-61248423 GAGGGTCAGGATTCTGCTGGTGG + Intergenic
1175759845 20:61554527-61554549 GGGGCTCAGCAGTCTGGAAAGGG + Intronic
1176793859 21:13354934-13354956 GTGGCTCAGGAGCCTGGACATGG + Intergenic
1177833737 21:26169357-26169379 GGGGCACAGGATGCTGGGGAGGG - Intronic
1178731918 21:35111680-35111702 GAGGCTCAGGTACGTGGAGATGG - Intronic
1179218412 21:39386369-39386391 GAGTCACAGGATTCTGGGGTAGG - Intronic
1179977728 21:44879393-44879415 GAGGCTCAGATTTCTTTAGATGG - Intergenic
1180666088 22:17513624-17513646 GAGGAAGAGGATACTGGAGAAGG - Intronic
1181610516 22:24008317-24008339 GAGGTCCAGAATTCTGGGGAGGG - Intergenic
1182759606 22:32711589-32711611 GGTGCACAGGAATCTGGAGAAGG - Intronic
1183566402 22:38618410-38618432 GAGGTTTAGGCTTCTGGGGATGG - Intronic
1183734256 22:39635319-39635341 GGGGCTCAGGATGCGGCAGAAGG + Intronic
1184158200 22:42682748-42682770 CAGCCTCAGGATCTTGGAGAAGG - Intergenic
1184182916 22:42843102-42843124 GAGGCTGAGGATGCAGGAGCGGG - Intronic
1184674405 22:46032631-46032653 CAGGCTCTGGACTCTGGGGAAGG - Intergenic
1185402195 22:50625068-50625090 GAGGCTCAGGTGTCTGGAGGGGG - Exonic
950656020 3:14436840-14436862 GGGGCTCAGGAGGCTGGACAGGG - Intronic
950772066 3:15319894-15319916 GTGGGTCAGGAATTTGGAGAGGG - Intronic
951563395 3:23989508-23989530 GAGGCACAGGGTTGGGGAGAGGG - Intergenic
953623738 3:44553977-44553999 GAAGCTTAGGATTCTTGAGGAGG - Intergenic
953623746 3:44554019-44554041 GAAGCTTAGGATTCTTGAGGTGG - Intergenic
956130097 3:66045176-66045198 GATGATTAGGATTCTGAAGAAGG + Intergenic
956360526 3:68442023-68442045 GAGCAGCAGGATTCTGGTGAGGG - Intronic
958168301 3:89905835-89905857 GAGGCTTACAAGTCTGGAGAGGG + Intergenic
960952488 3:123008726-123008748 TAGGTGCAGGTTTCTGGAGAAGG + Intronic
961330782 3:126136721-126136743 GAGGCTGGGGAATGTGGAGAAGG + Intronic
961478844 3:127166574-127166596 GTGGGTCAGGAATTTGGAGAGGG + Intergenic
962144661 3:132828128-132828150 GAGATTCAGGCTACTGGAGAAGG - Intergenic
962575647 3:136752625-136752647 GAGGCGTAGGCTTCTGGATAAGG + Intergenic
963125899 3:141815945-141815967 GAGGGTCAAGAATCTGGACATGG - Intronic
966294251 3:178400399-178400421 TTGGCTCACGATTCTGCAGATGG - Intergenic
967212062 3:187178407-187178429 GAGGCTTTGGATTGTGAAGAAGG + Intronic
967760030 3:193213436-193213458 GAGGCTCAGGCTGATTGAGAGGG + Intergenic
968091563 3:195901272-195901294 GAGGCTCAGGATCTGGGGGAGGG + Intronic
968187311 3:196641844-196641866 GAGCCTCAGAAGTCAGGAGAGGG + Intronic
968460236 4:721088-721110 GAGGCTGAGGACCCTGGGGAGGG + Intronic
969436186 4:7191014-7191036 GAGGCTCGGGAGTTTGGGGAAGG + Intergenic
969700064 4:8762999-8763021 GAGGCTCTGGGTCCTGGAGGAGG + Intergenic
969929608 4:10617957-10617979 AAGAATCAAGATTCTGGAGATGG + Intronic
969942573 4:10749055-10749077 AGGGCTCAGGATTCTGGGTAAGG + Intergenic
969977000 4:11113952-11113974 GGGGCCCAGGCTCCTGGAGATGG - Intergenic
971143939 4:23956208-23956230 GAGGAGCAGGAGTCTGGAGCAGG - Intergenic
972900487 4:43675858-43675880 GTGGGTCAGGAATCTGGAGGTGG - Intergenic
974039746 4:56847207-56847229 GCGGGTCAGGATTCTGGACATGG + Intergenic
975169031 4:71212404-71212426 GAGGCCCAGGCCTCTGGAGCTGG + Intronic
975344744 4:73281411-73281433 AAGGCAGAGGATTCTGGAGCAGG + Intergenic
976479165 4:85519418-85519440 TAGACTCAGGACTCAGGAGAAGG - Intronic
977653804 4:99498607-99498629 GAATCTCATGATTCTTGAGATGG + Intergenic
978438720 4:108711982-108712004 GAGGCTTTGGATTGTGAAGAAGG - Intergenic
979241243 4:118448754-118448776 GAGTCTTAGGATTCTAGATATGG + Intergenic
982224639 4:153154283-153154305 GAGGCTCAGGTTTCTTGATGTGG + Intronic
982713961 4:158787260-158787282 GAGGCTTAGGATACTGAAGTTGG + Intronic
983414006 4:167432797-167432819 GTGGGTCAGGAATTTGGAGATGG - Intergenic
984725407 4:183015167-183015189 GAGGCTTCGGTTTCTGGAAATGG + Intergenic
986043156 5:4012380-4012402 GAGGCAGAGGGTTCTGGAGGAGG + Intergenic
986072423 5:4298651-4298673 CAGGCACAGGATTCAGGTGAAGG + Intergenic
986241272 5:5961882-5961904 GCAGCTCTGGAATCTGGAGAAGG - Intergenic
986691226 5:10315545-10315567 GAGGGTCAGGAATCTGGGGGTGG - Intergenic
988288276 5:29250496-29250518 ATGGCTCTGGCTTCTGGAGAAGG - Intergenic
988738802 5:34049262-34049284 GAGACTCAGGCTTCTGAGGAGGG - Intronic
989411196 5:41121865-41121887 GAGGCTCAGGAGTCTGAGGCAGG - Intergenic
990662305 5:58029758-58029780 GAGGGTCAGGGTACTGGAGATGG + Intergenic
992823167 5:80518886-80518908 GAGGCTATGAATTTTGGAGATGG - Intronic
993073875 5:83201597-83201619 GAGGCTGAGGTTTCTAGAGAAGG - Intronic
993706901 5:91181431-91181453 GAGGGTCAGGAATCTGGGAATGG + Intergenic
994679127 5:102863447-102863469 GAGACTCAGAATTTTGAAGAAGG - Intronic
996635128 5:125679814-125679836 GGGGCCCATGATTCTGGAGATGG - Intergenic
997200721 5:132008616-132008638 GTGGGAGAGGATTCTGGAGAAGG - Intronic
997452332 5:133993987-133994009 GAGACTAATGATTCTGGGGATGG - Intronic
998105821 5:139468573-139468595 CAGGCTGAGGAGTCTGCAGAGGG - Intergenic
998866941 5:146515041-146515063 GATGCTGGGGATTCTGGAGATGG + Exonic
999453392 5:151695170-151695192 ATGGCTCATGATTCTGGAGCTGG + Intergenic
999871889 5:155760249-155760271 GATGCTGAGGATGATGGAGAGGG - Intergenic
1000096091 5:157972007-157972029 GAGGGTCAGGAATCTGGGAATGG + Intergenic
1001406017 5:171478181-171478203 GAGGCTGGGGATTAAGGAGATGG - Intergenic
1002050564 5:176568391-176568413 GAAACTCGGTATTCTGGAGAGGG + Intronic
1002451425 5:179321170-179321192 GAGGATGAGGATCCGGGAGATGG - Intronic
1002639326 5:180623311-180623333 GAGGCCCAGGGTTATTGAGAGGG + Intronic
1002701374 5:181127592-181127614 CAGGCCCAGGACCCTGGAGATGG + Intergenic
1002966919 6:1975899-1975921 GAACCTCAGGCTTCTGCAGAGGG - Intronic
1003238115 6:4316867-4316889 CAGCCTCAGAAATCTGGAGACGG - Intergenic
1003599127 6:7501697-7501719 AAGGTTCAGAAGTCTGGAGAGGG + Intergenic
1006059797 6:31411577-31411599 CAGGCTCAGGATTCTGTCGGAGG - Intronic
1006303406 6:33205791-33205813 GTGGCTGCCGATTCTGGAGAGGG - Intronic
1006506221 6:34490512-34490534 CAGGCTCAGGAGTCATGAGATGG - Intronic
1006884421 6:37368998-37369020 GAGCCTCAGAATCCTGGACATGG - Exonic
1008823637 6:55664661-55664683 GTGGGTCAGGAATCTGGACAAGG + Intergenic
1009306182 6:62092161-62092183 GAGTCTCAGGTTGCTGGAAATGG - Intronic
1010096110 6:72048388-72048410 TTGGCTCAGGACTCAGGAGAAGG - Intronic
1010865216 6:80967939-80967961 CAGGCTCATGATGCTGGTGATGG - Intergenic
1011636671 6:89380978-89381000 GAGGAACAGTATTCTGGGGAAGG - Intronic
1011668144 6:89655875-89655897 GAGGCTGAGGACTGTGGATACGG - Exonic
1011746566 6:90412817-90412839 GAGGCTCAGTATCATGGGGAGGG + Intergenic
1013130300 6:107226403-107226425 GAGACTGGGGTTTCTGGAGATGG + Intronic
1013313617 6:108920644-108920666 GAGGCTAAGGAGGCTGGGGATGG + Intronic
1015176401 6:130313678-130313700 GAGGGCCAGGTTCCTGGAGAGGG + Intronic
1019038492 6:169083205-169083227 GAGGCACACGATTCTTGATAAGG + Intergenic
1019309291 7:352442-352464 GAGGGCCACGATTCTGGGGACGG + Intergenic
1019559463 7:1648745-1648767 CGGGCTGAGGATTCAGGAGAAGG - Intergenic
1019801308 7:3090279-3090301 GAGTCTCAGGAGTCTGGGGTGGG + Intergenic
1020274694 7:6616987-6617009 GAGGCTCAGGACTGGGGAGTTGG - Intronic
1022175484 7:27868418-27868440 GGGGCGGAGGAATCTGGAGAGGG - Intronic
1022498596 7:30868627-30868649 AAGGCTCAGAATTTTGCAGAAGG - Intronic
1022540418 7:31129590-31129612 GAGGCTCAGGCTTATTAAGAAGG - Intergenic
1023187459 7:37547235-37547257 GAGGCTCAGGAGCCCAGAGAAGG - Intergenic
1023904040 7:44508593-44508615 GAGGGACTGGATGCTGGAGATGG - Intergenic
1024798757 7:53051216-53051238 GAGGCTCAGACTTCTGTAAAGGG - Intergenic
1026618360 7:71928014-71928036 AAGCCTTAGGATGCTGGAGAAGG - Intronic
1027189672 7:75989419-75989441 GGGGGTCAGGATTCCGGAGCAGG - Intronic
1027192590 7:76005742-76005764 GGGGCTCAGGAGGATGGAGAGGG + Intronic
1028879429 7:95863371-95863393 TAGGCACAGGATTTTTGAGAGGG + Intronic
1029435672 7:100562731-100562753 GAGTCTAAGGACTCTGGACAGGG + Intronic
1030823637 7:114126952-114126974 GGGGTTCAGGAATCTGGATATGG + Intronic
1030917601 7:115336163-115336185 GAAACTCAGGATTCTGGCTAAGG + Intergenic
1031004771 7:116458333-116458355 GAGGCTTTGGATTGGGGAGAAGG - Intronic
1031971963 7:128071682-128071704 CAGGCTGAGGTTTGTGGAGAAGG + Intronic
1032074007 7:128827706-128827728 CAGGCTCAGGTTTCTGAGGACGG + Intergenic
1034921122 7:155083231-155083253 GAGTCACAGTATGCTGGAGAGGG + Intronic
1035765817 8:2104633-2104655 TTGGCTCATGATTCTGGAGGCGG + Intronic
1035917150 8:3637046-3637068 GAGGATCCTGATTCTGGCGAGGG - Intronic
1036016018 8:4785558-4785580 GTGGCTCAGGACTATGGAGATGG - Intronic
1036534527 8:9633939-9633961 GAGGGTCAGGAATCTGGGAATGG - Intronic
1037089079 8:14890855-14890877 GAGCCTGAGGATTTTGGAAATGG - Intronic
1038715621 8:29988149-29988171 GAGGCACAGGATTCTGCTGCTGG - Intergenic
1038746509 8:30259615-30259637 CAGGCGTAGGATGCTGGAGATGG + Intergenic
1039235164 8:35495050-35495072 GAGGGTCAGGATTCTGGCCCAGG + Intronic
1040394655 8:46985564-46985586 TTGGCTCATGATTCTGGAGGTGG - Intergenic
1040784259 8:51146953-51146975 GACTCTCAGGATTCTAAAGAGGG + Intergenic
1041256471 8:55983444-55983466 GAGGCTGAGGTAGCTGGAGAGGG - Intronic
1044173103 8:89081514-89081536 GAGGCGCAGGACTCTTGTGATGG + Intergenic
1044272277 8:90260277-90260299 GAGTTTCAGTATTCTGCAGATGG - Intergenic
1044922093 8:97177907-97177929 GAGGCTTTGGATTGGGGAGAAGG - Intergenic
1046531935 8:115457507-115457529 GAAGATCAGAGTTCTGGAGATGG + Intronic
1047235865 8:123041793-123041815 GAGGCTCTGGGATCTGGAGCGGG - Intronic
1049008184 8:139870758-139870780 GAGGATCAGGGTTAAGGAGAAGG + Intronic
1049599293 8:143499632-143499654 GAGGCCCTGAATGCTGGAGAGGG - Intronic
1050706067 9:8399197-8399219 AATGTTCAGAATTCTGGAGATGG + Intronic
1051224975 9:14889661-14889683 CAGACTCAGAACTCTGGAGAGGG + Intronic
1052971803 9:34381253-34381275 GAGGCCGAGGGTCCTGGAGAGGG - Intronic
1053861890 9:42395459-42395481 TTGGCTCAGTATTCTGGAGCTGG - Intergenic
1055033522 9:71794065-71794087 GAGGCCCAGAATTCAGGAAAAGG + Intronic
1056753715 9:89369241-89369263 GGGGCCCAGGGCTCTGGAGAGGG - Intronic
1057180654 9:93028140-93028162 CAGGCTGAGGTTTCTGGAGCTGG - Intronic
1059456308 9:114402389-114402411 AAGGCTCAGGCATCTGGGGATGG + Exonic
1059580512 9:115542439-115542461 GATGCTCTGCATTCTGGAGTTGG - Intergenic
1060441584 9:123644702-123644724 GAGGCTTTGGCTTCTGGAAAGGG - Intronic
1060949165 9:127590009-127590031 GAGGGTCAGGACTCAGGTGATGG - Intergenic
1061014668 9:127974863-127974885 GAGGCTGAGCACACTGGAGAGGG - Intronic
1061295622 9:129675368-129675390 GGGGGTCAGGATGCTGGTGAGGG - Intronic
1061654291 9:132076788-132076810 TAGGCTCATGAATCTGGAAACGG - Intronic
1062612056 9:137379845-137379867 GAGGGCCAGGATTTTGCAGAAGG - Intronic
1185858328 X:3556011-3556033 GAGGCTCTGGATTGGGAAGAAGG + Intergenic
1185991159 X:4894415-4894437 GAGGCTCTGGATTGGGAAGAAGG - Intergenic
1186539277 X:10383576-10383598 GTGGCTCTGGCTTCTGGTGAGGG + Intergenic
1186807175 X:13151988-13152010 GAAGCCCAGGGTTCTGGAAATGG - Intergenic
1188910306 X:35839390-35839412 GAGGCTATGGAATCAGGAGAAGG + Intergenic
1189373447 X:40447851-40447873 GTGGGTCAGGAATCTGGAAAGGG - Intergenic
1189705293 X:43753546-43753568 AAAGCTCAGGTTTCTGGAGCTGG + Intergenic
1190420828 X:50282557-50282579 AAGGCTCAGGGTTCTGTAGGTGG + Intronic
1190511676 X:51179364-51179386 AAGGCCAAGGATCCTGGAGATGG + Intergenic
1191673830 X:63774199-63774221 GAGGTTTAGGATTCTGGCCAAGG + Intronic
1195094989 X:101493576-101493598 GAGGATCAGGCTTGTGGAGGAGG + Exonic
1195933479 X:110103260-110103282 GAGGCTCAGGATACTAGGCAAGG + Intronic
1199650917 X:149945497-149945519 GAGAATCAGGTTTCAGGAGAGGG - Intergenic
1201400370 Y:13598217-13598239 CAGTTTCAGGATTCTGGAGTTGG - Intergenic
1202076433 Y:21041964-21041986 GAGGCTTTGGATTGGGGAGAAGG + Intergenic
1202373581 Y:24214141-24214163 TAGGCTCATGTTTCTGGAGGAGG - Intergenic
1202388958 Y:24350579-24350601 GAGTCTTAGGATTCTAGATATGG + Intergenic
1202481829 Y:25319545-25319567 GAGTCTTAGGATTCTAGATATGG - Intergenic
1202497200 Y:25455979-25456001 TAGGCTCATGTTTCTGGAGGAGG + Intergenic