ID: 1105015589

View in Genome Browser
Species Human (GRCh38)
Location 12:132784961-132784983
Sequence CTTGCTGCCTCGATGGTACC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 82}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105015589 Original CRISPR CTTGCTGCCTCGATGGTACC AGG Intronic
901438302 1:9262774-9262796 CTTACTGCCTGGCTGCTACCTGG - Intronic
902031058 1:13422557-13422579 CTTGTTGCCTCCCTGTTACCAGG - Intergenic
902130792 1:14258867-14258889 CTTGCTGTCTCCATGGTAAATGG + Intergenic
908241241 1:62191025-62191047 CATGCTGCCTCTACGGTACTTGG - Intergenic
915544799 1:156590971-156590993 CTTAGTGCCTTGATGGTAACTGG + Intergenic
916728425 1:167544560-167544582 CTGGCTGCCTCACTGGTAGCTGG - Intronic
917122369 1:171655669-171655691 CCTGCTGCCTCCATCGTGCCCGG - Intergenic
919703363 1:200653748-200653770 CTTGCTTCCTTGTTGGCACCTGG + Intronic
920926784 1:210348975-210348997 CATGCTGCCCCGATGGGAACTGG + Intronic
921290943 1:213656772-213656794 TTTGCTGCCTGGATGGTATTTGG + Intergenic
921518085 1:216122508-216122530 ATTGCTGCCTGGCTGTTACCAGG - Intronic
921818389 1:219589517-219589539 CTTGCTGCCACCTTGTTACCAGG + Intergenic
922209466 1:223476553-223476575 CTTGCTGCCTCCTTGATCCCAGG - Intergenic
923460748 1:234207272-234207294 TTTGCTGCCTGCATGGCACCAGG - Intronic
924305994 1:242689763-242689785 CTTGGGCCCTCGATGGGACCAGG - Intergenic
1062865153 10:846387-846409 CTTCCTGTCTGGATGGCACCAGG - Intronic
1064682156 10:17821207-17821229 CTCGCTGCCTCTATGCCACCTGG - Intronic
1069312904 10:67061168-67061190 CTTGCTTCCTCTATGATACCTGG + Intronic
1078091670 11:8268165-8268187 CTGGCGGCCTCGTTGGGACCGGG + Intronic
1087361871 11:97170915-97170937 CTTGAAGCCTAAATGGTACCAGG - Intergenic
1087525995 11:99313969-99313991 CTAGCTGCCTCTAAGGTATCTGG + Intronic
1089146783 11:116335186-116335208 CTTGCTGCCCCCCAGGTACCTGG - Intergenic
1089311015 11:117558151-117558173 TTTGTTGCCTCTATGGCACCCGG - Intronic
1091002251 11:131919507-131919529 CTTACTGACTCGTAGGTACCAGG + Intronic
1100677737 12:96886576-96886598 CTTGCAGCCTCTGTTGTACCAGG + Intergenic
1105015589 12:132784961-132784983 CTTGCTGCCTCGATGGTACCAGG + Intronic
1110711593 13:78656709-78656731 CTTTCTGCTTCCATGGTACCTGG + Intronic
1113541924 13:111115674-111115696 CTTACTTTCTCGATGGTCCCGGG - Exonic
1114256012 14:21001899-21001921 CTGGTTGCCTAGATGCTACCTGG + Intergenic
1118510020 14:66461952-66461974 ATTGCTGCCAAGTTGGTACCAGG - Intergenic
1119644685 14:76339769-76339791 CTGGCTGCCTCTATGGCCCCAGG + Intronic
1121395041 14:93614070-93614092 CATGCTCCCTTGATGATACCAGG - Intronic
1121641560 14:95487880-95487902 CTTGCTGTCTCGAGGGTGGCAGG - Intergenic
1122379492 14:101291651-101291673 CTGGCTGCCTGGCTGGTCCCTGG - Intergenic
1122994153 14:105253544-105253566 CTTGCTGACTCCAGGGTACTGGG + Intronic
1140281287 16:73557234-73557256 CTTGCTTCTTTGATTGTACCAGG - Intergenic
1141137333 16:81474769-81474791 CTTCCTGCCTCCTTGGTGCCAGG + Intronic
1143400593 17:6639985-6640007 CTTGCAGCCTCGATGGAGCCTGG + Intronic
1143462507 17:7112834-7112856 CCTCCTGCCTCCATGGAACCCGG + Intronic
1149533563 17:57415033-57415055 CTTGCTGCTTGGGAGGTACCAGG + Intronic
1156020873 18:32597959-32597981 CTTGCTGGCTGGATGGAAGCTGG + Intergenic
1161462292 19:4405172-4405194 CATGCTGCACCTATGGTACCTGG - Intronic
1161524224 19:4743473-4743495 CTTCCTGCCTCGGTTGTCCCTGG - Intergenic
1161895693 19:7078196-7078218 CTTGCGGCCTCCATGGTTTCTGG + Intronic
1165494764 19:36146033-36146055 CCTGCTGCCTCAAAGGCACCTGG - Exonic
928609543 2:32977807-32977829 CTTGCTGCCTTGATGGATCCCGG + Intronic
936372737 2:111916850-111916872 CATGCTGCCTCGTTGCTGCCAGG + Intronic
941622567 2:167794847-167794869 CTTGCTGCCTCCATGGAAGAGGG + Intergenic
942743590 2:179206889-179206911 CTTGCTGACTCTATGGGAGCTGG + Intronic
946099994 2:217312083-217312105 CATGGTGCCTCGATGGCACCTGG + Intronic
1170994804 20:21342670-21342692 CATGCTGCCTACATGGTACATGG - Intronic
1173893810 20:46534437-46534459 CCTGCTGTCTTCATGGTACCAGG - Intergenic
1175737995 20:61400443-61400465 CTTGCAGCCTAGATGATCCCCGG + Intronic
1175762545 20:61571394-61571416 CTTGATGCCCAGAGGGTACCTGG + Intronic
1178024677 21:28452579-28452601 CTTGCTGCCTTGATGTCATCTGG - Intergenic
1178502316 21:33135866-33135888 CTTGCTGCCAGGATGGTTTCTGG - Intergenic
1184130480 22:42514113-42514135 CTTGCTCTCTCGATGCTGCCAGG + Exonic
1184140656 22:42575938-42575960 CTTGCTCTCTCGATGCTGCCAGG + Intergenic
1185266462 22:49906732-49906754 TTTGCTGCCTTGATGGGAACAGG - Intronic
955122126 3:56071139-56071161 CTGGCTGCCTCAAAGGTACTGGG - Intronic
957305944 3:78458997-78459019 CTTGCTGTCTCAAGGGTAGCAGG - Intergenic
964381920 3:156105952-156105974 CTTCCTGCCTCAATGGTACATGG - Intronic
964830334 3:160877485-160877507 GATGCTGCTTCGATGGCACCTGG - Intronic
974123342 4:57665978-57666000 CTTGCTGCCTCTAGGGCAGCTGG + Intergenic
975725387 4:77286578-77286600 CTTGCAGCATTGCTGGTACCTGG + Intronic
977296875 4:95219990-95220012 CTTGCTGCCTTGATGTTCACAGG + Exonic
979372727 4:119908313-119908335 CTTGATGCCTTGATGGAGCCTGG + Intergenic
981241893 4:142487156-142487178 CTTGCTGCCTGGATGGCAGCAGG - Intronic
985501588 5:251197-251219 CTTGCTGTCTGGATGGGTCCTGG + Intronic
985735291 5:1576428-1576450 CTTGCTGTCTGGATGGGTCCTGG - Intergenic
986589894 5:9357699-9357721 CTTCCCGCCTTGATGTTACCAGG - Intronic
990268866 5:54113133-54113155 TTTGCTGCCACGTTGGAACCTGG - Intronic
990852718 5:60225030-60225052 CTTGCTTCCCAGGTGGTACCTGG - Intronic
997948549 5:138223641-138223663 CTTGCTGCCCTGAAGGAACCAGG + Intergenic
998213116 5:140216652-140216674 CTTGCTGCCTGTATGCTATCAGG + Intronic
1001803955 5:174567447-174567469 CTTGATGCCTGGATGGCATCAGG - Intergenic
1002868620 6:1146262-1146284 GCTGCTGCCTCCAGGGTACCTGG - Intergenic
1007071760 6:39043204-39043226 CTTGCTGCCTGGATGAGACCTGG + Intergenic
1009567289 6:65325079-65325101 CTTGCTGCCACCTTGTTACCAGG - Intronic
1009644315 6:66377965-66377987 CTTGTTGCCTGGATGGGAGCTGG + Intergenic
1021309990 7:19082727-19082749 CCTGCTGCCTGGATGGTCCCTGG - Intronic
1031687732 7:124752427-124752449 CTTGCTGGCTGCATGGTAGCAGG - Intronic
1032338522 7:131049016-131049038 CCTGCTGACTCCATGGGACCAGG + Intergenic
1034646506 7:152652443-152652465 CTGGCTGCCTCTATGGGAGCAGG - Intronic
1035018536 7:155787317-155787339 CTGGCTGCCCCGAGGGTCCCAGG + Intergenic
1040820117 8:51546833-51546855 CTTGCTGACTCCATGGGAACAGG + Intronic
1053128973 9:35604951-35604973 CTTTCTGCCCCGTTGGTCCCTGG + Intergenic
1057616364 9:96594269-96594291 CTTGCTGCCTTGATTTTCCCTGG - Intronic
1057700729 9:97361662-97361684 CCTGCTGCCTCGCTGGCACCTGG + Intronic
1061842790 9:133369361-133369383 TGTGCTGGCTGGATGGTACCAGG - Intronic
1062156531 9:135051944-135051966 CTTGAAGCCACGTTGGTACCAGG - Intergenic
1194076455 X:89400309-89400331 CTTGCTGGCTGCATGGGACCTGG - Intergenic
1200429095 Y:3055829-3055851 CTTGCTGGCTGCATGGGACCTGG - Intergenic